Los puntos clave no están disponibles para este artículo en este momento.
Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 μm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.
Li et al. (Wed,) studied this question.