Los puntos clave no están disponibles para este artículo en este momento.
Germinal center kinases (GCKs) compose a subgroup of the Ste20 family of kinases. Here we describe the cloning and characterization of a novel GCK family kinase, Traf2- and Nck-interacting kinase (TNIK) that interacts with both Traf2 and Nck. TNIK encodes a polypeptide of 1360 amino acids with eight spliced isoforms. It has 90% amino acid identity to the Nck-interacting kinase in both the N-terminal kinase domain and the C-terminal germinal center kinase homology region. The homology drops to 53% in the intermediate region. TNIK specifically activates the c-Jun N-terminal kinase pathway when transfected into Phoenix-A cells (derivatives of 293 cells), similar to many GCKs. However, in contrast to other GCKs, this activation is mediated solely by the GCK homology region of TNIK. In addition, in Phoenix-A, NIH-3T3, and Hela cells, overexpression of wild type TNIK, but not the kinase mutant form of TNIK, results in the disruption of F-actin structure and the inhibition of cell spreading. Furthermore, TNIK can phosphorylate Gelsolin in vitro. This is the first time that a GCK family kinase is shown to be potentially involved in the regulation of cytoskeleton. Germinal center kinases (GCKs) compose a subgroup of the Ste20 family of kinases. Here we describe the cloning and characterization of a novel GCK family kinase, Traf2- and Nck-interacting kinase (TNIK) that interacts with both Traf2 and Nck. TNIK encodes a polypeptide of 1360 amino acids with eight spliced isoforms. It has 90% amino acid identity to the Nck-interacting kinase in both the N-terminal kinase domain and the C-terminal germinal center kinase homology region. The homology drops to 53% in the intermediate region. TNIK specifically activates the c-Jun N-terminal kinase pathway when transfected into Phoenix-A cells (derivatives of 293 cells), similar to many GCKs. However, in contrast to other GCKs, this activation is mediated solely by the GCK homology region of TNIK. In addition, in Phoenix-A, NIH-3T3, and Hela cells, overexpression of wild type TNIK, but not the kinase mutant form of TNIK, results in the disruption of F-actin structure and the inhibition of cell spreading. Furthermore, TNIK can phosphorylate Gelsolin in vitro. This is the first time that a GCK family kinase is shown to be potentially involved in the regulation of cytoskeleton. The Ste20 family of kinases can be divided into two structurally distinct subfamilies. The first subfamily contains a C-terminal catalytic domain and an N-terminal binding site for the small G proteins Rac1 and Cdc42 (1Herskowitz I. Cell. 1995; 80: 187-197Abstract Full Text PDF PubMed Scopus (875) Google Scholar). The yeast serine/threonine kinase Ste20 and its mammalian homologue, p21-activated kinase 1 (PAK1), 1The abbreviations used are:PAK1p21-activated kinase 1MAPKmitogen-activated protein kinaseJNKc-Jun N-terminal kinaseERKextracellular signal regulated kinaseMEKMAPK/ERK kinaseMEKKMEK kinaseTNFtumor necrosis factorGCKgerminal center kinaseGCKHgerminal center kinase homology regionGCKRgerminal center kinase-relatedNIKNCK-interacting kinaseTraf2TNF receptor-associated factor 2TNIKTraf2- and NCK-interacting kinaseMsnMisshapenGFPgreen fluorescent proteinPCRpolymerase chain reactionGSTglutathioneS-transferasentnucleotide(s)mAbmonoclonal antibodyHAhemagglutininWTwild typeKMkinase mutant belong to this subfamily. Ste20 initiates a mitogen-activated protein kinase (MAPK) cascade that includes Ste11 (MAPK kinase kinase), Ste7 (MAPK kinase), and FUS3/KSS1 (MAPK) in response to activation of the small G protein Cdc42, as well as signals from the heterotrimeric G proteins coupled to pheromone receptors (1Herskowitz I. Cell. 1995; 80: 187-197Abstract Full Text PDF PubMed Scopus (875) Google Scholar). Similar to Ste20, PAK1 has been demonstrated to be a Cdc42 and Rac1 effector molecule and specifically regulates the JNK pathway, one of the mammalian MAPK pathways (2Bagrodia S. Derijard B. Davis R.J. Cerione R.A. J. Biol. Chem. 1995; 270: 27995-27998Abstract Full Text Full Text PDF PubMed Scopus (598) Google Scholar, 3Kyriakis J.M. Avruch J. J. Biol. Chem. 1996; 271: 24313-24316Abstract Full Text Full Text PDF PubMed Scopus (1028) Google Scholar). The JNK pathway is activated by a variety of stress-inducing agents, including osmotic and heat shock, UV irradiation, protein inhibitors, and proinflammatory cytokines such as TNF (4Ip Y.T. Davis R.J. Curr. Opin. Cell Biol. 1998; 10: 205-219Crossref PubMed Scopus (1392) Google Scholar). JNKs are activated through threonine and tyrosine phosphorylation by MAPK/ERK kinases 4 and 7 (MAPK kinase), which are in turn phosphorylated and activated by MAPK kinase kinases, including MEKK1, mixed lineage kinase 2, and mixed lineage kinase 3 (4Ip Y.T. Davis R.J. Curr. Opin. Cell Biol. 1998; 10: 205-219Crossref PubMed Scopus (1392) Google Scholar). In addition to the activation of the JNK pathway, PAK1 has also been demonstrated to be a regulator of the actin cytoskeleton (5Sells M.A. Knaus U.G. Bagrodia S. Ambrose D.M. Bokoch G.M. Chernoff J. Curr. Biol. 1997; 7: 202-210Abstract Full Text Full Text PDF PubMed Scopus (585) Google Scholar). p21-activated kinase 1 mitogen-activated protein kinase c-Jun N-terminal kinase extracellular signal regulated kinase MAPK/ERK kinase MEK kinase tumor necrosis factor germinal center kinase germinal center kinase homology region germinal center kinase-related NCK-interacting kinase TNF receptor-associated factor 2 Traf2- and NCK-interacting kinase Misshapen green fluorescent protein polymerase chain reaction glutathioneS-transferase nucleotide(s) monoclonal antibody hemagglutinin wild type kinase mutant The second subgroup of Ste20 family of kinases is represented by the germinal center kinase (GCK), and this family is, therefore, often referred to as GCK family of protein kinases (6Kyriakis J.M. J. Biol. Chem. 1999; 274: 5259-5262Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). In contrast to Ste20 and PAK1, GCK family members have an N-terminal kinase domain and a C-terminal regulatory region. Many GCK family members, including GCK, GCKR, hematopoietic protein kinase 1, GCK-like kinase, HPK/GCK-like kinase, and NCK-interacting kinase (NIK), have also been demonstrated to activate the JNK pathway when overexpressed in 293 cells (7Pombo C.M. Kehrl J.H. Sanchez I. Katz P. Avruch J. Zon L.I. Woodgett J.R. Force T. Kyriakis J.M. Nature. 1995; 377: 750-754Crossref PubMed Scopus (204) Google Scholar, 8Shi C.-S. Kehrl J.H. J. Biol. Chem. 1997; 272: 32102-32107Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 9Kiefer F. Tibbles L.A. Anafi M. Janssen A. Zanke B.W. Lassam N. Pawson T. Woodgett J.R. Iscove N.N. EMBO J. 1996; 15: 7013-7025Crossref PubMed Scopus (203) Google Scholar, 10Diener K. Wang X.S. Chen C. Meyer C.F. Keesler G. Zukowsky M. Tan T-H Yao Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9687-9692Crossref PubMed Scopus (122) Google Scholar, 11Yao Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T-H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). Among those, GCK and GCKR have been implicated in mediating TNF-induced JNK activation through TNF receptor-associated factor 2 (Traf2) (7Pombo C.M. Kehrl J.H. Sanchez I. Katz P. Avruch J. Zon L.I. Woodgett J.R. Force T. Kyriakis J.M. Nature. 1995; 377: 750-754Crossref PubMed Scopus (204) Google Scholar, 10Diener K. Wang X.S. Chen C. Meyer C.F. Keesler G. Zukowsky M. Tan T-H Yao Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9687-9692Crossref PubMed Scopus (122) Google Scholar, 13Yuasa T. Ohno S. Kehrl J.H. Kyriakis J.M. J. Biol. Chem. 1998; 273: 22681-22692Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). NIK interacts with the SH2-SH3 domain containing adapter protein NCK and has been proposed to link protein tyrosine kinase signals to JNK activation (12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). Recently, Eichinger et al. (14Eichinger L. Bahler M. Diez M. Eckerskorn C. Schleicher M. J. Biol. Chem. 1998; 273: 12952-12959Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar) purified a novel GCK family kinase from Dictyostelium that can phosphorylate Severinin vitro. Severin is an F-actin fragmenting and capping enzyme that regulates Dictyostelium motility. This finding raised the intriguing possibility that the GCK family kinases may also be involved in regulating cytoskeleton function in addition to their role in regulating the JNK pathway. However, there has being no evidence suggesting the involvement of mammalian GCKs in cytoskeleton regulation. Here, we report a novel mammalian GCK family kinase identified in our yeast two-hybrid screening. It interacts with both Traf2 and NCK, and was therefore designated Traf2- and NCK-interacting kinase (TNIK). It shares highest homology to NIK. We demonstrate in this report that TNIK, like many other GCK family members, is able to specifically activate the JNK pathway when overexpressed in Phoenix-A cells. In addition, overexpression of TNIK results in the disruption of F-actin structure in Phoenix-A, NIH-3T3, and Hela cells, thereby providing for the first time evidence that a mammalian GCK family kinase may regulate the cytoskeleton. Antibodies used in this report include anti-HA mAb (Babco) and pAb (Santa Cruz Biotechnology), anti-FLAG mAb (Sigma) and pAb (Santa Cruz), anti-Myc mAb (Babco), anti-Traf2 pAb (Santa Cruz), anti-NCK mAb (Transduction Laboratories), and anti-β-actin mAb (Sigma). TNFα was purchased from Calbiochem. Using yeast two-hybrid screening, overlapping cDNA fragments were identified that interacted with Traf2 and NCK. The sequences of the fragments were contained in a partial cDNA clone, KIAA0551 (GenBankTM accession number AB011123). Antisense oligos TGCGCTTATATTCCAGAAGTAGAGCT and CTGTCTCTGCTCCTCCTCTA were designed according to the 5′ end sequence of KIAA0551, and the full-length TNIK cDNA was cloned from reverse-transcribed human brain mRNA by rapid amplification of cDNA ends-PCR. Northern blotting was performed on human multitissue Northern blot according to the manufacturer's recommendations (CLONTECH). A PCR product amplified from nt 1264 to 2427 of TNIK coding region was used as a probe. Full-length human TNIK was cloned into pCI (Promega)-derived expression vector pYCI under the control of the cytomegalovirus promoter with an HA epitope tag (AYPYDVPDYA) inserted on the N terminus by PCR. A kinase mutant form of TNIK, designated as TNIK (KM) was constructed using the QuikChange mutagenesis kit (Stratagene) with oligos and to the in the kinase domain to Full-length human Traf2 was cloned into pYCI with a epitope tag inserted on the N terminus by PCR. Full-length human NCK was cloned into pYCI with a epitope tag the N and were constructed in the vector with a epitope tag inserted on the N terminus of and of the were constructed by PCR. were by Phoenix-A cells (derivatives of 293 Curr. 1999; Scholar) were in with of Phoenix-A cells was performed using the Curr. 1999; Scholar). 4 cells well in a 3 cells in a were 3 of was used in the for well of a and was used for was were in with and Cell were by for cell were with of and of a of protein for were and the were with were to and and were used as for the the JNK in was into Phoenix-A cells with TNIK as cells were with with 1 1 and was from cell with an anti-Myc and the were with and two with kinase 1 1 the kinase were with 1 of (Santa Cruz in of kinase with 1 of for were by addition of of for and and in kinase were in a similar kinase an anti-Myc mAb was used to and protein (Sigma) was used as an kinase an anti-FLAG mAb was used to and (Santa was used as an in kinase on TNIK, 3 of wild type 3 of kinase mutant form of was in Phoenix-A cells and with an anti-HA were to kinase as in the of of Gelsolin as an Phoenix-A cells in were with and TNIK as cells were using a fluorescent of (Sigma) was to transfected Phoenix-A cells 2 and the cells were for 4 Phoenix-A cells well in a were transfected with 3 of control were were on the using of with Cell were for represented the were with of and in of was by This represented the and from the number of cells were on and with an anti-β-actin mAb to the of and Using a human brain cDNA and a cell in our yeast two-hybrid pathway we identified a novel germinal center kinase family that interacted with both Traf2 and NCK. A that this kinase is to a partial cDNA with KIAA0551 (GenBankTM accession The 5′ end sequence of KIAA0551 was cloned from from human brain mRNA by rapid amplification of cDNA and full-length cDNA of KIAA0551 were by We designated this protein TNIK, for Traf2 and of TNIK sequence of TNIK to NIK are with are with The spliced are by a the TNIK PCR of TNIK fragments from human and brain to nt and nt were used as of NIK and TNIK spliced isoforms. The of homology TNIK and NIK in is The spliced are and the amino acid to the are in kinase of TNIK. Phoenix-A cells in were transfected with 3 of 1 and 2 and proteins were with an anti-HA were to in kinase 1 with an anti-HA antibody 3 and The TNIK was by a polypeptide of 1360 amino It an N-terminal kinase an intermediate domain and a C-terminal germinal center kinase homology region. It 90% amino acid identity with a cloned GCK family in both the kinase domain and the domain (12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). However, TNIK was 53% to NIK in the intermediate region 1, A and of TNIK were also one nt acids and nt acids and the other two nt acids 1 that TNIK may have spliced isoforms. spliced were designed and used for PCR from and brain The of the as amplified from both and the 1 fragments were cloned into a cloning vector and the eight from the of were eight spliced of TNIK were designated as to 1 was used in the in this that the cDNA we represented an protein kinase, a kinase mutant form of TNIK, designated as was constructed with a in the binding to HA epitope tag was inserted on the N-terminal of and proteins were in Phoenix-A cells, and the proteins were to and kinase A phosphorylated was in the but not in the 1 1 and with an anti-HA antibody of expression of both and 1 3 and the phosphorylated in the in kinase represented TNIK, and the mutant was in protein kinase The expression of the TNIK was by human Northern TNIK homology with a to nt of TNIK was used to This region amino acid identity with NIK. of and were in the coding region is to for the the the is the in the region of be This is not to TNIK. NIK and HPK/GCK-like kinase also have TNIK is with of in and and the and the and a similar It is have the of TNIK with N-terminal TNIK was in Phoenix-A cells, and was by an anti-HA The were on and with an anti-Traf2 Traf2 specifically with the domain on TNIK that mediated its with we constructed of TNIK and with were with an anti-FLAG antibody to the and with suggesting that the intermediate domain of TNIK is for TNIK to with Traf2 3 1, However, with Traf2 suggesting that the domain was also involved in the with the TNIK mutant with the kinase to with Traf2 of the transfected proteins were by cell with anti-HA and anti-FLAG 3 and In addition, the form of TNIK, was able to with Traf2 not suggesting that the spliced were not for TNIK to with We the on Traf2 that mediated the with TNIK. Traf2 3 were with and the were to anti-HA The were with an anti-FLAG and were able to with to with 3 cell with anti-HA and anti-FLAG expression of the transfected proteins and This that the domain is for Traf2 to with TNIK. However, the of full-length Traf2 with TNIK is that of the N-terminal may to the may the of the Traf2 molecule to this The of TNIK with NCK was in a similar expression of in Phoenix-A cells, the cell were with an anti-HA antibody and with an anti-NCK NCK specifically with the on TNIK for this TNIK were with NCK, and the were with an anti-HA The were with an anti-FLAG and were able to with NCK, suggesting that the intermediate domain is also for TNIK to NCK 1, and the domain the kinase domain binding to NCK 2 and cell with anti-HA and anti-FLAG of expression of the transfected 4 We TNIK was able to activate the JNK pathway. 1, 2, 3 of TNIK expression was into Phoenix-A cells with was from cell and its kinase using as a of TNIK kinase in a 1 3 of TNIK was was A similar of activation was when cells were for with of TNF 1, 2, and with G. A. A. Woodgett J.R. C. M. 1997; PubMed Scopus Google Traf2 activated The expression of were by cell with an anti-Myc antibody TNIK can also activate the and and were into Phoenix-A cells with of TNIK. The transfected kinases were from cell and the kinase using protein and as In contrast to was activated by TNIK of activated both kinases and In addition, TNIK not activate not the of this the of TNIK were into Phoenix-A cells with and the of to kinase was by the in kinase and were able to activate and were not This that the C-terminal region is both and for activation of the JNK pathway, the kinase domain is TNIK was overexpressed in Phoenix-A cells, the cells a In control cells, of cells were and well In in TNIK and cells, of cells cell spreading. cells and to the Similar was also in Hela and cells transfected with TNIK not We transfected the of TNIK into Phoenix-A cells to which domain of TNIK was involved in the and which the kinase to the and and not and were both in the inhibition of cell and not the kinase the domain for JNK was both and for TNIK to regulate cell spreading. This that the JNK pathway was not involved in this regulation. with this overexpression of to cell JNK has been implicated in in cells S. 1998; PubMed Scopus Google we cells transfected with TNIK were of cells transfected with control were with was in cells, were in of cells transfected with the control cDNA In addition, no activation of was in cells not results that TNIK cell but not in transfected Phoenix-A cells. raised the possibility that overexpression of TNIK have F-actin We therefore actin in the and in control and Phoenix-A cells. of wild type TNIK, but not vector in the of actin in with the in cells We that overexpression of TNIK may to phosphorylation of Recently, a GCK family protein kinase that phosphorylate the protein Severin was purified and cloned from Dictyostelium (14Eichinger L. Bahler M. Diez M. Eckerskorn C. Schleicher M. J. Biol. Chem. 1998; 273: 12952-12959Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). We therefore to TNIK was able to phosphorylate the mammalian Severin homologue, Gelsolin Nature. PubMed Scopus Google Scholar). TNIK and were in Phoenix-A cells, and in an in with purified type TNIK, but not the kinase mutant form of TNIK, phosphorylated Gelsolin in We describe in this report the cloning of a novel of the GCK TNIK. TNIK shares homology with NIK in both the kinase domain and the C-terminal However, from NIK in the intermediate 53% of amino acids are In addition, in the intermediate domain can be in a of eight spliced isoforms. The the eight are many other GCK family kinases, overexpression of TNIK specifically activated the JNK pathway It no on the pathway the pathway However, other GCK family members, both the kinase mutant form of TNIK and the domain of TNIK were as as the wild type protein in and the kinase domain of TNIK was This that the C-terminal domain was solely for the This is in contrast to other GCK family kinases, which activate the JNK pathway using the kinase domain as is with GCKR, HPK/GCK-like kinase, and hematopoietic protein kinase 1, using the kinase domain the as is with GCK, GCK-like kinase, and NIK (7Pombo C.M. Kehrl J.H. Sanchez I. Katz P. Avruch J. Zon L.I. Woodgett J.R. Force T. Kyriakis J.M. Nature. 1995; 377: 750-754Crossref PubMed Scopus (204) Google Scholar, 8Shi C.-S. Kehrl J.H. J. Biol. Chem. 1997; 272: 32102-32107Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 9Kiefer F. Tibbles L.A. Anafi M. Janssen A. Zanke B.W. Lassam N. Pawson T. Woodgett J.R. Iscove N.N. EMBO J. 1996; 15: 7013-7025Crossref PubMed Scopus (203) Google Scholar, 10Diener K. Wang X.S. Chen C. Meyer C.F. Keesler G. Zukowsky M. Tan T-H Yao Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9687-9692Crossref PubMed Scopus (122) Google Scholar, 11Yao Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T-H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). The domain of NIK interacted with MEKK1, and the mutant of JNK activation (12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). the of sequence identity the of NIK and the of TNIK, TNIK activated the JNK pathway through NIK was cloned by its to with the adapter protein NCK. It with NCK two sequences in the intermediate acids and acids sequences were for (12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). Similar to TNIK also interacted with NCK the intermediate However, is not in TNIK. TNIK contained two other acids and acids in addition to the acids TNIK interacted with NCK through the with NCK is an adapter protein involved in many factor signal pathways J.H. 1998; PubMed Scopus Google Scholar). It has been proposed that the may NIK to tyrosine kinases to regulate (12Su Y. Han J. Xu S. Cobb M. Skolnik E.Y. EMBO J. 1997; 16: 1279-1290Crossref PubMed Scopus (221) Google Scholar). TNIK may be in a similar TNIK also interacts its intermediate domain with the domain of GCK and GCKR have been to with and has been that JNK activation (7Pombo C.M. Kehrl J.H. Sanchez I. Katz P. Avruch J. Zon L.I. Woodgett J.R. Force T. Kyriakis J.M. Nature. 1995; 377: 750-754Crossref PubMed Scopus (204) Google Scholar, 10Diener K. Wang X.S. Chen C. Meyer C.F. Keesler G. Zukowsky M. Tan T-H Yao Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9687-9692Crossref PubMed Scopus (122) Google Scholar, 13Yuasa T. Ohno S. Kehrl J.H. Kyriakis J.M. J. Biol. Chem. 1998; 273: 22681-22692Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). a GCK family Misshapen has been to with and JNK activation H. Y. J. Skolnik E.Y. Curr. Biol. 1998; Full Text Full Text PDF Scopus Google Scholar). has highest homology to NIK and TNIK. Similar to NIK and TNIK, also interacted with the of NCK H. Y. J. Skolnik E.Y. Curr. Biol. 1998; Full Text Full Text PDF Scopus Google Scholar). In in results in Y. I. J. Pawson T. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google and in mammalian cells, NCK interacts with a effector protein involved in the regulation of cytoskeleton M. J.M. B. S. F. U. A. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar, A. J.H. Cell. Biol. 1995; 15: PubMed Scopus Google Scholar). that the NCK pathway is to the to that cell and cell in addition to the activation of the JNK pathway N. G.M. 1997; PubMed Scopus Google Scholar). of with may regulate cell TNIK may in the regulation of a similar pathway in mammalian cells. this overexpression of TNIK cell in Phoenix-A cells, cells and Hela cells A and not This is to the disruption of actin F-actin be by with of cells transfected with a F-actin were in cells transfected with not with this overexpression of TNIK in a of actin in the The contains the actin the contains the actin This is the first evidence that a mammalian GCK family an on GCK was cloned that can phosphorylate the Dictyostelium actin fragmenting in (14Eichinger L. Bahler M. Diez M. Eckerskorn C. Schleicher M. J. Biol. Chem. 1998; 273: 12952-12959Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). TNIK can phosphorylate the mammalian Severin homologue, in Gelsolin is also an F-actin fragmenting and capping enzyme that can the of is not Gelsolin phosphorylation its this a possibility that TNIK may regulate F-actin through Gelsolin other actin This is with the that the kinase domain of TNIK is for the regulation of cell The mammalian p21-activated kinase, PAK1, which is to GCK family members and an effector protein of small G proteins Rac1 and has been demonstrated to regulate actin cytoskeleton proposed of the regulation is through phosphorylation and inhibition of the chain kinase F. Bokoch G.M. P. 1999; PubMed Scopus Google Scholar). overexpression of a form of PAK1 also in the inhibition of cell Y. I. J. Pawson T. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google an similar to that by overexpression of TNIK A and It is therefore of to TNIK can also phosphorylate the chain in this that GCK family kinases may in regulating the cytoskeleton in addition to their in regulating the JNK pathway. It be of to NIK has a similar of the of homology TNIK and NIK in the kinase domain and two kinases may the sequence in the intermediate domain may the of two kinases. We are using yeast two-hybrid to proteins that to the intermediate domain of TNIK, which may on its We for in the of the We also and from Xu and
Fu et al. (Fri,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: