Los puntos clave no están disponibles para este artículo en este momento.
Thioredoxin reductases (TRR) serve critical roles in maintaining cellular redox states. Two isoforms of TRR have been identified in mammals: both contain a penultimate selenocysteine residue that is essential for catalytic activity. A search of the genome of the invertebrate, Caenorhabditis elegans, reveals a gene highly homologous to mammalian TRR, with a TGA selenocysteine codon at the corresponding position. A selenocysteyl-tRNA was identified in this organism several years ago, but no selenoproteins have been identified experimentally. Herein we report the first identification of a C. elegans selenoprotein. By75Se labeling of C. elegans, one major band was identified, which migrated with the predicted mobility of the C. elegans TRR homologue. Western analysis with an antibody against human TRR provides strong evidence for identification of the C. elegans selenoprotein as a member of the TRR family. The 3′-untranslated region of this gene contains a selenocysteine insertion sequence (SECIS) element that deviates at one position from the previously invariant consensus “AUGA.” Nonetheless, this element functions to direct selenocysteine incorporation in mammalian cells, suggesting conservation of the factors recognizing SECIS elements from worm to man. Thioredoxin reductases (TRR) serve critical roles in maintaining cellular redox states. Two isoforms of TRR have been identified in mammals: both contain a penultimate selenocysteine residue that is essential for catalytic activity. A search of the genome of the invertebrate, Caenorhabditis elegans, reveals a gene highly homologous to mammalian TRR, with a TGA selenocysteine codon at the corresponding position. A selenocysteyl-tRNA was identified in this organism several years ago, but no selenoproteins have been identified experimentally. Herein we report the first identification of a C. elegans selenoprotein. By75Se labeling of C. elegans, one major band was identified, which migrated with the predicted mobility of the C. elegans TRR homologue. Western analysis with an antibody against human TRR provides strong evidence for identification of the C. elegans selenoprotein as a member of the TRR family. The 3′-untranslated region of this gene contains a selenocysteine insertion sequence (SECIS) element that deviates at one position from the previously invariant consensus “AUGA.” Nonetheless, this element functions to direct selenocysteine incorporation in mammalian cells, suggesting conservation of the factors recognizing SECIS elements from worm to man. The synthesis of selenoproteins requires several specialized components of the translational machinery (reviewed in Ref. 1Low S.C. Berry M.J. Trends Biochem. Sci. 1996; 21: 203-208Abstract Full Text PDF PubMed Scopus (391) Google Scholar). In addition to tRNASec and the enzymes necessary for generation of charged selenocysteyl-tRNASec, this process requires a selenocysteine specific elongation factor, SelB, identified so far only in prokaryotes. Specific secondary structures in the mRNAs of selenoproteins are required to distinguish UGA selenocysteine codons from stop codons. These structures, termed selenocysteine insertion sequence (SECIS) 1The abbreviations used are: SECIS, selenocysteine insertion sequence; D1, type 1 deiodinase; GPX, glutathione peroxidase; GR, glutathione reductase; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; TR, thioredoxin; TRR, thioredoxin reductase; UTR, untranslated region.1The abbreviations used are: SECIS, selenocysteine insertion sequence; D1, type 1 deiodinase; GPX, glutathione peroxidase; GR, glutathione reductase; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; TR, thioredoxin; TRR, thioredoxin reductase; UTR, untranslated region. elements, are located adjacent to the UGA codons in prokaryotes and in the 3′-UTR of selenoprotein mRNAs in eukaryotes (2Berry M.J. Banu L. Harney J.W. Larsen P.R. EMBO J. 1993; 12: 3315-3322Crossref PubMed Scopus (348) Google Scholar). Eukaryotic SECIS elements are characterized by a small number of conserved nucleotides at specific positions in the stem-loop. These are foremost, the invariable sequence motif “AUGA,” which pairs with “GA” opposite each other on the 5′ and 3′ arms of the stem, respectively, and two or three adenosines in either the terminal loop or an internal bulge. In all vertebrate selenoprotein mRNAs identified to date these sequences are highly conserved. Mutagenesis studies have shown that the conserved nucleotides and secondary structural features are necessary to suppress the stop codon function of a UGA codon and to decode it as selenocysteine (3Martin III, G.W. Harney J.W. Berry M.J. RNA (N. Y.). 1998; 4: 65-73PubMed Google Scholar, 4Martin III, G.W. Harney J.W. Berry M.J. RNA (N. Y.). 1996; 2: 171-182Crossref PubMed Scopus (5) Google Scholar). The ability to synthesize selenoproteins is of fundamental importance in mammals, as deletion of the gene for selenocysteyl-tRNA leads to an embryonic lethal phenotype in a mouse model (5Bosl M.R. Takaku K. Oshima M. Nishimura S. Taketo M.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5531-5534Crossref PubMed Scopus (280) Google Scholar). The selenoprotein or proteins responsible for this lethality have not been determined. Cytoplasmic glutathione peroxidase, a selenoprotein functioning in breakdown of toxic hydroperoxides, appears not to be critical for normal development of mammals, probably due to redundancy in the glutathione peroxidase gene family (6Ho Y.S. Magnenat J.L. Bronson R.T. Cao J. Gargano M. Sugawara M. Funk C.D. J. Biol. Chem. 1997; 272: 16644-16651Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar). Among the 13 eukaryotic selenoproteins identified to date, thioredoxin reductase (TRR) is a strong candidate for an essential selenoprotein. TRR is a disulfide oxidoreductase with a broad substrate specificity; it reduces among many other substrates the active site disulfide in oxidized thioredoxin. Thioredoxin (TR) is an important cofactor in a large number of biological processes. While a knockout model for TRR has not been reported to date, targeted disruption of the TR gene causes early embryonic lethality, and TRR is the only known reductant of TR (7Matsui M. Oshima M. Oshima H. Takaku K. Maruyama T. Yodoi J. Taketo M.M. Dev. Biol. 1996; 178: 179-185Crossref PubMed Scopus (422) Google Scholar). Two TRR isoforms have been described in several mammalian species, both of which contain a UGA codon encoding selenocysteine as the penultimate C-terminal amino acid (8Gasdaska P.Y. Gasdaska J.R. Cochran S. Powis G. FEBS Lett. 1995; 373: 5-9Crossref PubMed Scopus (177) Google Scholar, 9Gladyshev V.N. Jeang K.T. Stadtman T.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6146-6151Crossref PubMed Scopus (409) Google Scholar, 10Gasdaska P.Y. Berggren M.M. Berry M.J. Powis G. FEBS Lett. 1999; 442: 105-111Crossref PubMed Scopus (98) Google Scholar, 11Lee S.R. Kim J.R. Kwon K.S. Yoon H.W. Levine R.L. Ginsburg A. Rhee S.G. J. Biol. Chem. 1999; 274: 4722-4734Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar, 12Miranda-Vizuete A. Damdimopoulos A.E. Pedrajas J.R. Gustafsson J.A. Spyrou G. Eur. J. Biochem. 1999; 261: 405-412Crossref PubMed Scopus (148) Google Scholar). Putative SECIS elements are present in the 3′-UTRs of both sequences. In contrast to other selenoenzymes, it has been proposed that the selenocysteine residues in the TRRs are not in the predicted catalytic site, but function to carry reducing equivalents from the active site to substrates (13Gromer S. Wissing J. Behne D. Ashman K. Schirmer R.H. Flohe L. Becker K. Biochem. J. 1998; 332: 591-592Crossref PubMed Scopus (87) Google Scholar). Nonetheless, selenocysteine is critical for reducing thioredoxin, as demonstrated by the loss of activity upon chemical alteration (14Nordberg J. Zhong L. Holmgren A. Arner E.S. J. Biol. Chem. 1998; 273: 10835-10842Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar) or proteolytic removal of this amino acid (13Gromer S. Wissing J. Behne D. Ashman K. Schirmer R.H. Flohe L. Becker K. Biochem. J. 1998; 332: 591-592Crossref PubMed Scopus (87) Google Scholar). The C. elegans gene for selenocysteyl-tRNA was identified by Lee et al. in 1990 (15Lee B.J. Rajagopalan M. Kim Y.S. You K.H. Jacobson K.B. Hatfield D. Mol. Cell. Biol. 1990; 10: 1940-1949Crossref PubMed Scopus (106) Google Scholar), indicating that selenoprotein genes would likely be present. To date, no selenoproteins have been experimentally identified in C. elegans. Since the complete genome of C. elegans has been sequenced, and this organism is amenable to genetic studies, it promises to be a valuable model system for the study of eukaryotic selenoprotein synthesis. In this study, we show that C. elegans expresses at least one selenoprotein. This protein migrates with the predicted size of a thioredoxin reductase homologue in the C. elegans sequence data base. We further show that the selenium-labeled protein reacts in Western blotting analysis with an antibody prepared against a human TRR peptide, providing evidence for its identification as a TRR homologue. Finally, we report identification and characterization of a functional SECIS element in the 3′UTR of the C. elegans TRR gene. This SECIS element deviates at a previously invariant position from all vertebrate SECIS elements reported to date, but functions to direct selenocysteine incorporation in a mammalian cell line. C. elegans strain bristol (N2) was used throughout these studies (16Mandel S.J. Berry M.J. Kieffer J.D. Harney J.W. Warne R.L. Larsen P.R. J. Clin. Endocrinol. Metab. 1992; 75: 1133-1139Crossref PubMed Google Scholar). For 75Se labeling of worms, their food source,Escherichia coli strain OP50, was grown overnight in 1 ml of Luria broth medium containing 20 μCi of 75Se.75Se-labeled bacteria were harvested by pelleting, resuspended in M9 buffer (22 mmKH2PO4, 42 mmNa2HPO4, 85 mm NaCl, 1 mm MgSO4), and dispensed on 60-mm plates containing 3 ml of nematode growth medium agar. Worms were grown at 22 °C on lawns of 75Se-labeled E. coli and harvested by washing them off the plates in M9 buffer, followed by sedimentation at 800 × g for 5 min and three washes in M9 buffer. The pellets were resuspended in phosphate-buffered saline and sonicated. As a protease inhibitor 1 mmphenylmethylsulfonyl fluoride was added. Lysates were stored at −20 °C until further use. All of the predicted protein sequences were first identified in the genomic sequences generated by the C. elegans Genome Sequencing Consortium. The TBLASTN algorithm was run against the Washington University Genome Sequencing Center C. elegans data base to identify sequences that encode proteins with homology to mammalian selenoproteins. We identified a gene with 71% sequence similarity to human (h)TRR (GenBankTM accession number 2500117). This sequence was used to search the GenBankTM expressed sequence tag data base and led to the identification of the cDNA clone yk384f6 (provided by Y. Kohara, National Institute of Genetics, Mishima, Japan). The cDNA sequence of yk384f6 was determined by automated sequencing (Applied Biosystems, Foster City, CA). The sequence of this cDNA clone confirmed the predicted intron/exon junctions. Total RNA was isolated from mixed stage populations ofC. elegans. Worms were first ground into a fine powder using a liquid nitrogen-cooled mortar and pestle. Powdered C. elegans (200 mg) were homogenized in 2 ml of TRIzol (Life Technologies, Inc.). RNA was collected from the aqueous phase following the addition of chloroform, precipitated by adding isopropyl alcohol, and air-dried. First strand cDNA was synthesized by reverse transcriptase using oligo(dT) as primer and used as template in PCR with primers flanking the predicted start and stop codon. The PCR product was sequenced with primer CB 122 (see below) by automated sequencing. The minimal SECIS element of TRR was generated by PCR using the overlapping primers CB122 (CCAAGCTTTAGGCGGGTGACGACCTTTGGCTAAACT) and CB124 (GGGCGGCCGCCATCAGACCAGAGGCGCTCACGATGG). The mutant SECIS element (for construct 151) was generated using primer CB123, CCAAGCTTTAGGCGGGTAACGACCTTTGGCTAAACT (mutation indicated in bold). Constructs 150 (wild type SECIS) and 151 (mutant SECIS) were derived by subcloning the PCR fragments (viaHindIII and NotI) into a construct expressing rat D1 (G16D10ΔH3), substituting the TRR SECIS element for that of rat D1 (4Martin III, G.W. Harney J.W. Berry M.J. RNA (N. Y.). 1996; 2: 171-182Crossref PubMed Scopus (5) Google Scholar). Sequences were confirmed by automated sequencing. All constructs were cotransfected with plasmid pTKGH, a thymidine kinase promoter-directed human growth hormone-expressing plasmid, into HEK-293 cells by calcium phosphate precipitation as described previously (17Buettner C. Harney J.W. Larsen P.R. J. Biol. Chem. 1998; 273: 33374-33378Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Transfection efficiencies were monitored by assay of human growth hormone in the media. Cell sonicates were assayed for the presence of 5′ deiodinase activity as described previously (18Berry M.J. Maia A.L. Kieffer J.D. Harney J.W. Larsen P.R. Endocrinology. 1992; 131: 1848-1852Crossref PubMed Scopus (108) Google Scholar). Deiodinase activities were calculated per microliter of cell sonicate and normalized to amount of growth hormone secreted into the media. Typically 200 μg of crude 75Se-labeled C. elegans homogenate was combined with 5× SDS-PAGE sample buffer (0.3125 mTris-HCl, 4% β-mercaptoethanol, 50% glycerol, 0.5 mg/ml bromphenol blue, pH 8.3) and heated for 5 min at 100 °C. Samples were subjected to SDS-PAGE analysis on 10% polyacrylamide gels (acrylamide:bis, 37.5:1), followed by electrotransfer to Immobilon (Millipore) in 20% methanol, 25 mm Tris-HCl, pH 8.3, 192 mmglycine. Membranes were blocked with 5% (w/v) nonfat milk in TBS-Tween (20 mm Tris-HCl, pH 7.6, 140 mm NaCl, 0.1% Tween 20), incubated with antibody 2098 (generous gift of John Gasdaska), at 1:200 dilution in 1.25% (w/v) nonfat milk in TBS-Tween, followed by incubation with peroxidase-conjugated secondary antibody (NEN Life Science Products). Reaction products were visualized by enhanced chemiluminescence (Amersham Pharmacia Biotech) and exposure to X-Omat film (Eastman Kodak Co.). After extensive washing of the membrane and decay of the chemiluminescent signal, the membrane was subjected to autoradiography for 7 days. To identify selenoproteins in C. elegans, we developed a75Se labeling technique based on their food source, bacteria. E. coli were cultured in Luria broth media containing 75Se. This led to incorporation of75Se predominantly into two E. coliselenoproteins. Worms were allowed to feed on a lawn of75Se-labeled bacterial for 24 h, until bacteria were depleted, then harvested for analysis of 75Se incorporation. Since there are always trace amounts of bacteria in the gut of C. elegans, we also prepared a lysate of the75Se-labeled bacteria. SDS-PAGE analysis of C. elegans homogenate reveals three major selenoprotein bands, two in the 80–95 kDa size range and one of ∼58 kDa. The two upper bands are also present in the bacterial lysate and correspond in size to the isoforms of bacterial formate dehydrogenases (19Heider J. Baron C. Bock A. EMBO J. 1992; 11: 3759-3766Crossref PubMed Scopus (154) Google Scholar). The most prominent selenoprotein in C. elegans, which is not in the bacterial is the protein the band likely a C. elegans selenoprotein. In we the C. elegans lysate with A. in labeling was with the suggesting that of the bands by autoradiography are of RNA not We a search of elegans genome data base with the sequences of all known mammalian selenoproteins. This search a gene highly homologous to mammalian TRR, with a TGA selenocysteine codon at the corresponding position number of of the three isoforms of the selenoprotein or selenoprotein were of glutathione and a selenoprotein V.N. Jeang K.T. Hatfield J. Biol. Chem. 1998; 273: Full Text Full Text PDF PubMed Scopus Google Scholar) are but each contains a codon in of the TGA selenocysteine codon in the corresponding mammalian gene. the C. elegans thioredoxin reductase is the only homologue of a known mammalian selenoprotein containing a conserved selenocysteine codon. To evidence for the of the75Se-labeled protein as a thioredoxin we Western analysis using a antibody against human The antibody was against an which of amino with the corresponding C. elegans sequence and be predicted to with the worm Western analysis of the75Se-labeled C. elegans lysate an protein of the predicted size and two After extensive washing of the membrane and decay of the chemiluminescent signal, we used autoradiography to the 75Se-labeled the and chemiluminescence film that the C. band and one of the three Western bands 75Se providing strong evidence for identification of the 75Se-labeled band as a TRR homologue. The presence of bands to further the C. elegans data base for other sequences homology to the human TRR After TRR, the were the glutathione reductase sequence and an both and not contain UGA selenocysteine codons and not correspond in their predicted to the protein identified The predicted of and are and We the sequence of the C. 3′-UTR for a SECIS there are several in the in the of a SECIS by the search to sequences which are but not to this we identified a SECIS element that deviates from the vertebrate consensus by one The worm with of is predicted to a vertebrate 2 SECIS element with a stem, an and an upper and small terminal loop To the ability of this SECIS element to direct selenocysteine incorporation in a mammalian cell we generated a construct containing the TRR SECIS element to the rat D1 region. This construct was into the human embryonic cell and of deiodinase activity was We have shown previously that a functional SECIS element is required for incorporation of selenocysteine into this which in is required for deiodinase activity M.J. Kieffer J.D. Harney J.W. Larsen P.R. J. Biol. Chem. Full Text PDF PubMed Google Scholar) (18Berry M.J. Maia A.L. Kieffer J.D. Harney J.W. Larsen P.R. Endocrinology. 1992; 131: 1848-1852Crossref PubMed Scopus (108) Google Scholar). The C. elegans SECIS element selenocysteine incorporation at an activity the type rat D1 SECIS of the invariant the in the in either the rat glutathione peroxidase or rat D1 SECIS elements was shown previously to activity to A. RNA (N. Y.). 1998; 4: Google Scholar) or to (3Martin III, G.W. Harney J.W. Berry M.J. RNA (N. Y.). 1998; 4: 65-73PubMed Google Scholar) (17Buettner C. Harney J.W. Larsen P.R. J. Biol. Chem. 1998; 273: 33374-33378Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar), In the C. elegans SECIS this to also in complete of rat In this study, we report identification of the first selenoprotein and the first SECIS element in C. elegans. The protein migrates with the of a thioredoxin reductase homologue in the sequence data base and antibody with of this family of against the genome sequence of C. elegans number using the protein sequences of all known vertebrate selenoproteins the TRR sequence to be the only homologue of a vertebrate selenoprotein with a UGA codon at the corresponding position has been that this C. elegans homologue be a selenoprotein based on the presence of the conserved UGA codon V.N. J. E.S. Lee B.J. Chem. 1999; 4: Google Scholar). we evidence the of the major C. elegans selenoprotein as TRR by Western analysis of 75Se-labeled C. elegans and autoradiography of the of the two labeling studies that this protein is by far the most prominent selenoprotein in C. elegans. In addition to the TRR a 75Se-labeled band at kDa was with in labeling The and of this band are it a product derived from of either the worm TRR or one of the bacterial selenoproteins. All vertebrate selenoproteins contain at least one SECIS which is required for UGA as a selenocysteine codon. motif the structural of a SECIS element is invariant in all previously characterized eukaryotic selenoprotein sequences. for structures, for from the we identify a loop the of a 2 SECIS In this SECIS a motif is present of This sequence of the shown to be critical for SECIS function in (3Martin III, G.W. Harney J.W. Berry M.J. RNA (N. Y.). 1998; 4: 65-73PubMed Google Scholar). the C. elegans TRR SECIS element selenocysteine incorporation in a mammalian cell line. Finally, a the ability to the in complete loss of with this element functioning to mammalian SECIS This that the of selenocysteine incorporation be conserved in is not known the motif is specific for The of an expressed sequence tag clone from the nematode encoding a TRR homologue with a UGA codon at the corresponding position number that in this TRR is also a selenoprotein. The sequence of the which would the search for a SECIS element in this to be determined. Since the genome of C. elegans has been sequenced, this sequence to the identification of components of the translational machinery required for selenoprotein synthesis. The genome of C. elegans contains selenocysteyl-tRNA and the only two components of the selenoprotein translational machinery identified in eukaryotes to and have two of one a C. elegans has only one GenBankTM accession number This homologue similarity to both type 1 and type 2 but contains a codon at the position corresponding to in human type A cDNA sequence from the presence of a homologue (GenBankTM accession number peroxidase is a in but elegans, as as in the and the to contain residues for selenocysteine in the active The of a activity with GPX, expressed in a bacterial system C. L. M.M. 1998; PubMed Scopus Google Scholar). This that in it is important to have a highly TRR a highly active GPX, providing the to the translational machinery required for selenoprotein synthesis. Since the genome of not contain genes for selenocysteyl-tRNA or and no selenoproteins have been identified experimentally in genetic studies of selenoprotein synthesis in eukaryotes have not been to C. elegans a model system for genetic of this process in The technique of in C. elegans and the of for selenoprotein as as the functions of this important redox protein in cellular and in to for on C. elegans to Y. Institute of Genetics, Mishima, for providing the expressed sequence tag clone to for with the and to John Gasdaska for human TRR While this was in a 75Se labeling and of the C. elegans thioredoxin reductase in V.N. M. Lee B.J. Hatfield Biochem. 1999; PubMed Scopus Google Scholar).
Buettner et al. (Thu,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: