CHOP Is Involved in Endoplasmic Reticulum Stress-induced Apoptosis by Enhancing DR5 Expression in Human Carcinoma Cells

It has been shown that excess stress to the endoplasmic reticulum (ER) triggers apoptosis, but the mechanisms underlying these processes remain unclear. We and others have reported previously that DR5 expression is up-regulated in thapsigargin (THG)-treated human cancer cells. Here, we provide evidence that CHOP is involved in THG up-regulation of DR5, which is a critical step for ER stress-induced apoptosis in human cancer cells. In human colon cancer HCT116 cells, knockdown of DR5 by siRNA blocked THG-induced Bax conformational change along with caspase-3 activation and cell death. Moreover, inhibition of CHOP expression attenuated DR5 up-regulation and apoptosis induced by THG, whereas ectopic expression of DR5 restored the sensitivity of CHOP siRNA-transfected cells to THG-induced apoptosis. In addition to HCT116 cells, inhibition of CHOP or DR5 induction also attenuated THG-induced cell death in other cancer cell lines including LNCaP, A2780S, and DU145, indicating that CHOP and DR5 are critical for ER stress-mediated apoptosis in human carcinoma cells. Furthermore, we identified a potential CHOP-binding site in the 5′-flanking region of the DR5 gene. Mutation of this site abrogated the enhanced reporter activity in response to THG treatment. Together, our findings suggest that CHOP regulates ER stress-induced apoptosis, at least in part, through enhancing DR5 expression in some types of human cancer cells. It has been shown that excess stress to the endoplasmic reticulum (ER) triggers apoptosis, but the mechanisms underlying these processes remain unclear. We and others have reported previously that DR5 expression is up-regulated in thapsigargin (THG)-treated human cancer cells. Here, we provide evidence that CHOP is involved in THG up-regulation of DR5, which is a critical step for ER stress-induced apoptosis in human cancer cells. In human colon cancer HCT116 cells, knockdown of DR5 by siRNA blocked THG-induced Bax conformational change along with caspase-3 activation and cell death. Moreover, inhibition of CHOP expression attenuated DR5 up-regulation and apoptosis induced by THG, whereas ectopic expression of DR5 restored the sensitivity of CHOP siRNA-transfected cells to THG-induced apoptosis. In addition to HCT116 cells, inhibition of CHOP or DR5 induction also attenuated THG-induced cell death in other cancer cell lines including LNCaP, A2780S, and DU145, indicating that CHOP and DR5 are critical for ER stress-mediated apoptosis in human carcinoma cells. Furthermore, we identified a potential CHOP-binding site in the 5′-flanking region of the DR5 gene. Mutation of this site abrogated the enhanced reporter activity in response to THG treatment. Together, our findings suggest that CHOP regulates ER stress-induced apoptosis, at least in part, through enhancing DR5 expression in some types of human cancer cells. The endoplasmic reticulum (ER) 1The abbreviations used are: ER, endoplasmic reticulum; THG, thapsigargin; siRNA, small interfering RNA; GFP, green fluorescent protein; JNK, c-Jun NH2-terminal kinase; siGFP, siDR5, siBid, and siCHOP, siRNA specific for GFP, DR5, Bid, and CHOP, respectively. is the major organelle for protein synthesis and maturation as well as the regulation of intracellular calcium (Ca2+) homeostasis. The accumulation of unfolded proteins in the ER lumen or depletion of Ca2+ from the ER lumen leads to the ER stress response known as unfold protein response (1Harding H.P. Calfon M. Urano F. Novoa I. Ron D. Annu. Rev. Cell Dev. Biol. 2002; 18: 575-599Crossref PubMed Scopus (809) Google Scholar, 2Rutkowski D.T. Kaufman R.J. Trends Cell Biol. 2004; 14: 20-28Abstract Full Text Full Text PDF PubMed Scopus (1187) Google Scholar). This response improves the ability of protein folding by inducing ER resident chaperones such as Bip and protects the cell from ER stress (1Harding H.P. Calfon M. Urano F. Novoa I. Ron D. Annu. Rev. Cell Dev. Biol. 2002; 18: 575-599Crossref PubMed Scopus (809) Google Scholar, 2Rutkowski D.T. Kaufman R.J. Trends Cell Biol. 2004; 14: 20-28Abstract Full Text Full Text PDF PubMed Scopus (1187) Google Scholar). However, the excess stress from which the cell cannot recover triggers apoptosis through largely unknown mechanisms (3Breckenridge D.G. Germain M. Mathai J.P. Nguyen M. Shore G.C. Oncogene. 2003; 22: 8608-8618Crossref PubMed Scopus (652) Google Scholar, 4Oyadomari S. Mori M. Cell Death Differ. 2004; 11: 381-389Crossref PubMed Scopus (2241) Google Scholar, 5Rao R.V. Ellerby H.M. Bredesen D.E. Cell Death Differ. 2004; 11: 372-380Crossref PubMed Scopus (819) Google Scholar). Apoptosis is executed by caspases, a family of cysteine proteases, the activation of which is controlled by two major pathways (6Cryns V. Yuan J. Genes Dev. 1998; 12: 1551-1570Crossref PubMed Scopus (1161) Google Scholar). In one, the so-called “intrinsic” pathway, various noxious stimuli cause the release of cytochrome c from the mitochondria into the cytosol. Once in the cytosol, cytochrome c forms a complex, known as the apoptosome, with Apaf-1 and procaspase-9 in the presence of ATP/dATP. This results in the processing and activation of this initiator caspase (7Wang X. Genes Dev. 2001; 15: 2922-2933Crossref PubMed Scopus (94) Google Scholar). The Bcl-2 family of proteins, which consists of both anti- and pro-apoptotic members, controls a critical intracellular checkpoint in the intrinsic pathway of apoptosis by regulating the release of apoptogenic factors from mitochondria (8Danial N.N. Korsmeyer S.J. Cell. 2004; 116: 205-219Abstract Full Text Full Text PDF PubMed Scopus (4040) Google Scholar). In contrast, the “extrinsic” pathway utilizes death receptors such as Fas, TNFR1, DR3, DR4, or DR5 for the activation of caspases. Binding of ligand to these cell surface receptors recruits adaptor proteins, such as FADD, to the cytoplasmic domain of the receptors, which in turn recruits the initiator procaspase-8 to form a death-inducing signaling complex that induces caspase-8 activation (9Ashkenazi A. Dixit V.M. Science. 1998; 281: 1305-1308Crossref PubMed Scopus (5154) Google Scholar). Once activated, the upstream initiator caspases cleave and activate downstream effector caspases such as caspase-3, -6, and -7, which in turn cleave death substrates and result in the morphological changes associated with apoptosis (10Earnshaw W.C. Martins L.M. Kaufmann S.H. Annu. Rev. Biochem. 1999; 68: 383-424Crossref PubMed Scopus (2451) Google Scholar). The extrinsic pathway can cross-talk with the intrinsic pathway through caspase-8 cleavage of the BH3-only protein Bid that activates the mitochondrial pathway to amplify the apoptotic signal (7Wang X. Genes Dev. 2001; 15: 2922-2933Crossref PubMed Scopus (94) Google Scholar). We have reported previously that thapsigargin (THG), which causes ER stress by inhibiting the ER Ca2+-ATPase, sarco-(endo)-plasmic reticulum ATPase, induces apoptosis of HCT116 cells through a Bax-dependent pathway (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar). A conformational change and mitochondrial translocation of Bax in HCT116 cells is regulated by caspase-8 in response to THG (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar). Furthermore, we and others (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar, 12He Q. Lee D.I. Rong R. Yu M. Luo X. Klein M. El-Deiry W.S. Huang Y. Hussain A. Sheikh M.S. Oncogene. 2002; 21: 2623-2633Crossref PubMed Scopus (89) Google Scholar) showed that DR5 is up-regulated in a variety of human cancer cells after THG treatment. Although these studies clearly indicated that ER stress could up-regulate DR5 expression, whether this event plays a key role in the initiation of apoptosis of human cancer cells in response to ER stress remains to be examined. In this study, therefore, we investigated the role of DR5 in ER stress-mediated apoptosis using RNA interference and found that DR5 is a critical mediator of THG-induced apoptosis in human cancer cells. Moreover, we provide evidence that CHOP is one of the potential regulators of DR5 induction in response to THG. Reagents—Anti-CHOP (F-168) polyclonal antibody and anti-p53 (DO-1) monoclonal antibody were purchased from Santa Cruz Biotechnology. THG, anti-Bax 6A7 and α-tubulin monoclonal antibodies, and anti-Bid, Bax (N-20), Bip, and DR5 polyclonal antibodies were described previously (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar). Anti-Puma antibody (13Yu J. Wang Z. Kinzler K.W. Vogelstein B. Zhang L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 1931-1936Crossref PubMed Scopus (518) Google Scholar) was kindly provided by Dr. Lin Zhang (University of Pittsburgh). Cell Culture and Transfection—HCT116 cells were maintained in McCoy's 5A medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. HeLa, MDA-MB-468, A2780S, and 293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. DU145 and LNCaP cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Cell transfection was performed using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions. Plasmids—The CHOP cDNA was amplified by PCR from a human brain cDNA library and cloned into pcDNA3 (Invitrogen) with EcoRI and XhoI sites. The DR5 expression plasmid pRSC-DR5 was described previously (14MacFarlane M. Ahmad M. Srinivasula S. Fernandes-Alnemri T. Cohen G. Alnemri E. J. Biol. Chem. 1997; 272: 25417-25420Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar). The 5′-flanking region of human DR5 genomic DNA was amplified by PCR from HCT116 genomic DNA and cloned into pGL3 firefly luciferase reporter vector (Promega) with SacI and XhoI sites. The deletion mutants and point mutations in the Elk-1-, CHOP-, and NFκB-like sites were generated by a two-step PCR method. All constructs were confirmed by DNA sequencing. Small Interfering RNA (siRNA)—The 21-nucleotide siRNA duplexes were purchased from Dharmacon Research. The siRNA sequences used here were as follows: DR5, AAGUUGCAGCCGUAGUCUUGA; Bid, AAGAAGACAUCAUCCGGAAUA; CHOP, AAGAACCAGCAGAGGUCACAA; GFP, AAGACCCGCGCCGAGGUGAAG. The transfection of siRNA oligonucleotides was performed with LipofectAMINE 2000 according to the manufacturer's recommendations. Briefly, 16 μl of LipofectAMINE 2000 reagent was mixed with 400 μl of Opti-MEM (Invitrogen) at room temperature for 5 min and then incubated with a mixture of 12 μlof20 μm siRNA duplex and 400 μl of Opti-MEM for an additional 20 min at room temperature. The complexes were then applied to cultured cells at ∼70% confluence on a 60-mm plate containing 4 ml of Dulbecco's modified Eagle's medium. After 12 h incubation, the medium was replaced with fresh Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. Caspase-3 Activity Assay—The caspase-3-like activity was measured by using a caspase-3 fluorometric assay kit (Sigma) according to the manufacturer's protocol. In brief, cellular extracts containing 50 μg of total proteins were incubated in 200 μl of assay buffer containing the synthetic fluorescent substrate Ac-DEVD-AMC at room temperature for 1 h. Fluorescence resulting from cleavage of the substrate was measured using a fluorometer with excitation at 380 nm and emission at 460 nm. Luciferase Assay—Cells were cultured in 24-well plates and co-transfected with 20 ng of the Renilla luciferase plasmid pRL-SV40 as a normalization control and 200 ng of firefly luciferase constructs containing the DR5 promoter region using LipofectAMINE 2000. After 12 h, the cells were spread onto 96-well plates and further cultured for 12 h. Then, the cells were treated with 1 μm THG or Me2SO for an additional 24 h. Luciferase activity was measured by using the Dual-Glo™ luciferase assay system (Promega) according to the manufacturer's instructions. Firefly luciferase activity was normalized by Renilla luciferase activity. Electrophoretic Mobility Shift Assay—Nuclear extracts were prepared from HCT116 cells treated with 1 μm THG or control Me2SO for 12 h as described previously (15Yamaguchi H. Ikeda Y. Moreno J.I. Katsumura M. Miyazawa T. Takahashi E. Imakawa K. Sakai S. Christenson R.K. Biochem. J. 1999; 340: 767-773Crossref PubMed Scopus (37) Google Scholar). Double-stranded oligonucleotide probes were end-labeled with γ-32PATP using T4 polynucleotide kinase (Promega). The probes used for the electrophoretic mobility shift assay were as follows: DR5-CHOP, TTGCGGAGGATTGCGTTGACGA; DR5-CHOP-mutant, TTGCGGAGGACATAGTTGACGA; CHOP-consensus, ATCCAGATGCAATCCCCCCTCG; and SP-1 consensus, ATTCGATCGGGGCGGGGCGAG. The position of the mutated CHOP site is underlined. 5 μg of nuclear extracts and the 32P-labeled DR5-CHOP probe were incubated in 10 μl of binding buffer (0.1 mg/ml poly(dI-dC), 4% glycerol, 2 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 50 mm NaCl, 10 mm Tris-HCl, pH8.0, 300 μg/ml bovine serum albumin) in the presence or absence of 100-fold cold competitors at room temperature for 20 min. The reaction mixtures were then electrophoresed on a 6% polyacrylamide gel, dried, and subjected to autoradiography. ER Stress Induces DR5 Expression—Because p53 has been shown to induce Bax and DR5 expression in response to DNA damage and because Bax is essential for THG-induced apoptosis of HCT116 cells (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar, 16Wu G.S. R. G. R. S. G. W.S. 1997; PubMed Scopus Google Scholar, R. El-Deiry W.S. Oncogene. PubMed Scopus Google Scholar, T. S. M. Wang H.G. Lin B. D. Oncogene. Google we treated HCT116 cells in Bax or p53 with THG to whether p53 is for ER stress-mediated apoptosis in this human colon cancer cell HCT116 cells were to THG-induced cell but cells cell death the as control cells results that THG induces cell death through a Bax-dependent but pathway in HCT116 cells. showed that the protein of DR5 were Bax and Bcl-2 and Bid of caspase-8 (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar) in HCT116 cells of the of p53 after THG In contrast, the BH3-only protein was induced by THG in a The clearly that THG induces DR5 expression and apoptosis through a in HCT116 cells. further whether DR5 expression is induced by ER stress in this cell we a variety of in HCT116 cells. shown in cells with THG or both of which are known to cause ER induced protein of DR5 and the ER protein In contrast, the the and and the kinase cause ER stress measured by Bip and to up-regulate DR5 expression results ER stress to DR5 In addition to HCT116 cells, THG could induce DR5 in other human cancer cell including LNCaP and but or in 293 cells that DR5 up-regulation is a response of human carcinoma cells to ER of DR5 for THG-induced ER stress clearly DR5, is whether this induction is for the initiation of apoptosis. this we DR5 expression by a siRNA duplex DR5 and on Bax caspase and cell death in response to THG treatment. In we prepared siRNA for Bid as well because Bid has been shown to be for death Bax activation and apoptosis Y. Lin Y. X. Genes Dev. 2002; PubMed Scopus Google Scholar). HCT116 cells with the indicated were treated with 1 μm THG or Me2SO for 16 h and subjected to shown in transfection of siRNA DR5 in a of DR5 expression induced by THG in HCT116 cells, with cells with the control Bid siRNA Bid protein in HCT116 cells Apoptosis was by and activity. Bax conformational change was by with anti-Bax 6A7 antibody (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar). both cell death and caspase-3-like activity induced by THG were in cells with or with cells. Moreover, of DR5 or Bid Bax conformational a critical step for release of apoptogenic proteins from in response to THG with our (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google suggest that the DR5 caspase-8 Bid Bax pathway is essential for ER stress-induced apoptosis of HCT116 cells. DR5 induction is a critical step for apoptosis. CHOP an of CHOP is a of the protein family that is induced by ER stress and in apoptosis S. Mori M. Cell Death Differ. 2004; 11: 381-389Crossref PubMed Scopus (2241) Google we whether CHOP is involved in THG-induced DR5 up-regulation by CHOP siRNA shown in the induction of CHOP in HCT116 cells after THG treatment. with CHOP THG-induced DR5 expression was in cells with control cells In attenuated caspase-3 activation and cell death induced by THG in HCT116 cells. CHOP controls apoptosis through of DR5, we that for the of DR5 in cells by a DR5 expression plasmid the cell sensitivity to THG-induced apoptosis. ectopic expression of DR5 HCT116 cells to apoptosis induced by THG with a of DR5 and of cell death and results suggest that CHOP is involved in THG-induced apoptosis as an upstream of DR5 in HCT116 cells. the role of DR5 up-regulation in THG-induced apoptosis to other types of cancer cells, we LNCaP, A2780S, and DU145 with siDR5, siCHOP, or control After with THG, the protein of DR5 and CHOP A and and cell were by and respectively. shown in A and THG induced both DR5 and CHOP expression in control cells. In to siGFP, and the induction of DR5 and CHOP, in cell lines treated with THG, were in cells. Moreover, knockdown of CHOP DR5 induction by THG In with to DR5 and CHOP and attenuated THG-induced cell death in LNCaP and DU145 cells but to a in cells results further the that DR5 induction is an step in the apoptotic pathway by ER stress in human cancer regulates DR5 promoter cells were with the indicated reporter and the were as described cells were with luciferase plasmid containing point mutations in in the indicated sites and subjected to luciferase cells were co-transfected with luciferase and CHOP expression plasmid or vector and subjected to luciferase 32P-labeled DR5 probe containing the CHOP-binding site was incubated or with nuclear from HCT116 cells treated with Me2SO or THG in the presence or absence of the indicated cold The was by electrophoretic mobility shift and the results were and CHOP a for showed that THG the of DR5 and ligand Q. Lee D.I. Rong R. Yu M. Luo X. Klein M. El-Deiry W.S. Huang Y. Hussain A. Sheikh M.S. Oncogene. 2002; 21: 2623-2633Crossref PubMed Scopus (89) Google Scholar). We also confirmed this result in HCT116 cells by CHOP is a we whether CHOP regulates DR5 We to the for ER stress in the DR5 5′-flanking sequences by reporter We prepared luciferase with the 5′-flanking region of the DR5 and the and a of deletion mutants were into cells because reporter activity and the DR5 induction as in HCT116 cells in response to THG After 24 h of the cells were treated with or THG for 24 h and subjected to luciferase shown in the to DR5 reporter an enhanced luciferase activity in cells treated with 1 μm THG with control and the 5′-flanking region response to THG. However, to and the could to THG that the for ER stress and of the DR5 gene. In the luciferase activity of the reporter was the as that of the indicating that the activity is regulated and as reported previously T. A. Sakai T. 2001; PubMed Scopus Google Scholar). We the sequences of the 5′-flanking region to of the DR5 and found a potential CHOP-binding site whether the CHOP-binding site is critical for DR5 activation in response to THG, we mutated the potential CHOP site in luciferase plasmid and performed a reporter we two additional mutants with point mutations in the or of the luciferase assay clearly showed that the potential CHOP-binding site but the and sites is essential for activation of the luciferase plasmid Furthermore, co-transfected with a CHOP expression the activity of the luciferase was we performed an electrophoretic mobility shift assay with a probe containing the potential CHOP-binding site extracts were prepared from HCT116 cells treated with THG or control Me2SO and incubated with the 32P-labeled DR5-CHOP We that a complex was and this was enhanced with cell this complex was by the addition of excess cold competitors containing the CHOP-binding DR5-CHOP, and CHOP M. Wang H. I. Ron D. Cell. Biol. PubMed Google Scholar) but the SP-1 or mutated results further the that CHOP is involved in DR5 has been that apoptotic cell death is in response to excess ER stress R.V. Ellerby H.M. Bredesen D.E. Cell Death Differ. 2004; 11: 372-380Crossref PubMed Scopus (819) Google Scholar, G. Cell Biol. 2001; PubMed Scopus Google Scholar). Although potential regulators that control apoptosis induced by ER stress have been the mechanisms underlying the cell which and cell are from the is in the ER and by ER stress T. H. E. J. Yuan J. PubMed Scopus Google Scholar, T. K. K. D. F. T. M. J. Biol. Chem. 2001; Full Text Full Text PDF PubMed Scopus Google but human has been reported to be involved in and ER stress-induced apoptosis M. J.P. R.K. M. Srinivasula Alnemri V. S. 2004; PubMed Scopus Google Scholar). It has been reported that the BH3-only protein in the induction of ER stress-mediated apoptosis in human cells D. A. T. J. Cell Biol. 2003; PubMed Scopus Google Scholar). In was up-regulated in response to THG in HCT116 cells Although this induction was by of the p53 cells the as cells after THG that to THG-induced cell death but is Moreover, has been shown that the ER can activate by and in response to ER stress in F. Wang X. A. Zhang Y. H.P. Ron D. Science. PubMed Scopus Google Scholar). However, we treated HCT116 cells with THG in the presence of on DR5 expression or apoptosis could be results that the pathway be involved in apoptosis induced by ER stress in HCT116 cells. In this we that DR5 is a critical for ER stress-induced apoptosis of human carcinoma cells. DR5 was induced by THG in human cancer cell lines and and knockdown of DR5 by siRNA attenuated THG-induced cell death and We have previously a that in response to THG DR5 activates which the BH3-only protein Bid to which in turn induces Bax activation to apoptotic cell death in HCT116 cells (11Yamaguchi H. Bhalla K. Wang H.G. Cancer Res. 2003; 63: 1483-1489PubMed Google Scholar). the HCT116 cells were to THG and knockdown of DR5 or Bid Bax conformational change and apoptosis of HCT116 cells in response to ER stress However, the human cancer cell DU145, which the Bax well to THG that DU145 has Bcl-2 and but expression with cells the of Bax and these results suggest that the pro-apoptotic and and Bcl-2 family proteins the sensitivity of cancer cells to ER CHOP is up-regulated by ER stress and involved in apoptosis. Although regulated by CHOP have been of is involved in ER stress-induced apoptosis S. Mori M. Cell Death Differ. 2004; 11: 381-389Crossref PubMed Scopus (2241) Google Scholar). It also has been reported that CHOP Bcl-2 expression and the cells to ER stress Cell. Biol. 2001; 21: PubMed Scopus Google Scholar). However, we could Bcl-2 in HCT116 cells treated with THG In contrast, we showed here that CHOP is for the induction of DR5 by ER Moreover, the indicated that DR5 is regulated by CHOP, the results also that other factors with CHOP in ER stress-mediated DR5 further studies are to additional regulators DR5 up-regulation in response to ER ER stress-mediated DR5 induction is This has a for because that cause ER stress could be used for a with human with p53 In a that THG with a has been S. H. J. Natl. Cancer 2003; PubMed Scopus Google Scholar). Moreover, other such as and also are known to ER stress H. A. K. K. S. A. H. Genes Dev. 2002; PubMed Scopus Google Scholar, S. T. S. T. H. T. Mori M. T. Cell Death Differ. 2004; PubMed Google Scholar) and induce DR5 expression Q. Lee D.I. Rong R. Yu M. Luo X. Klein M. El-Deiry W.S. Huang Y. Hussain A. Sheikh M.S. Oncogene. 2002; 21: 2623-2633Crossref PubMed Scopus (89) Google Scholar, Q. Luo X. Huang Y. Sheikh M.S. Oncogene. 2002; 21: PubMed Scopus Google Scholar, Q. Huang Y. Sheikh M.S. Oncogene. 2004; PubMed Scopus Google Scholar). We Dr. Alnemri for Dr. Vogelstein and Dr. Lin Zhang for the HCT116 cell lines and polyclonal and for the