Key points are not available for this paper at this time.
NIPP1 is a ubiquitous nuclear protein that is required for spliceosome assembly. We report here that the phosphothreonine-binding Forkhead-associated domain of NIPP1 interacts with the cell cycle-regulated protein Ser/Thr kinase MELK (maternal embryonic leucine zipper kinase). The NIPP1-MELK interaction was critically dependent on the phosphorylaton of Thr-478 of MELK and was increased in lysates from mitotically arrested cells. Recombinant MELK was a potent inhibitor of an early step of spliceosome assembly in nuclear extracts. This splicing defect was also seen with a kinase-dead mutant but was absent after mutation (T478A) of the NIPP1 binding site of MELK, indicating a mediatory role for NIPP1. Our data suggest that MELK has a role in the cell cycle-regulated control of pre-mRNA splicing. NIPP1 is a ubiquitous nuclear protein that is required for spliceosome assembly. We report here that the phosphothreonine-binding Forkhead-associated domain of NIPP1 interacts with the cell cycle-regulated protein Ser/Thr kinase MELK (maternal embryonic leucine zipper kinase). The NIPP1-MELK interaction was critically dependent on the phosphorylaton of Thr-478 of MELK and was increased in lysates from mitotically arrested cells. Recombinant MELK was a potent inhibitor of an early step of spliceosome assembly in nuclear extracts. This splicing defect was also seen with a kinase-dead mutant but was absent after mutation (T478A) of the NIPP1 binding site of MELK, indicating a mediatory role for NIPP1. Our data suggest that MELK has a role in the cell cycle-regulated control of pre-mRNA splicing. The nuclear protein NIPP1 1The abbreviations used are: NIPP1, nuclear inhibitor of PP1; PP1, protein phosphatase-1; GST, glutathione S-transferase; FHA domain, Forkhead-associated domain; HA, hemagglutinin; MELK, maternal embryonic leucine zipper kinase; Tricine, N-2-hydroxy-1,1-bis (hydroxymethyl)ethylglycine. (39 kDa) was originally discovered as a potent and specific inhibitor of protein Ser/Thr phosphatase-1 (PP1), hence its name, nuclear inhibitor of PP1 (1Beullens M. Van Eynde A. Stalmans W. Bollen M. J. Biol. Chem. 1992; 267: 16538-16544Abstract Full Text PDF PubMed Google Scholar, 2Beullens M. Van Eynde A. Bollen M. Stalmans W. J. Biol. Chem. 1993; 268: 13172-13177Abstract Full Text PDF PubMed Google Scholar, 3Van Eynde A. Beullens M. Stalmans W. Bollen M. Biochem. J. 1994; 297: 447-449Crossref PubMed Scopus (34) Google Scholar, 4Van Eynde A. Wera S. Beullens M. Torrekens S. Van Leuven F. Stalmans W. Bollen M. J. Biol. Chem. 1995; 270: 28068-28074Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 5Vulsteke V. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 1997; 272: 32972-32978Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 6Beullens M. Van Eynde A. Vulsteke V. Connor J. Shenolikar S. Stalmans W. Bollen M. J. Biol. Chem. 1999; 274: 14053-14061Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 7Beullens M. Vulsteke V. Van Eynde A. Jagiello I. Stalmans W. Bollen M. Biochem. J. 2000; 352: 651-658Crossref PubMed Scopus (57) Google Scholar). More recently, we have demonstrated that NIPP1 is also implicated in transcription as well as in pre-mRNA splicing by mechanisms that do not involve PP1 (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 9Jin Q. Van Eynde A. Beullens M. Roy N. Thiel G. Stalmans W. Bollen M. J. Biol. Chem. 2003; 278: 30677-30685Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). In transient transfection experiments, NIPP1 acted as a transcriptional repressor, which may be accounted for by the binding of the central and C-terminal domains of NIPP1 to the Polycomb protein, EED (embryonic ectoderm development) (9Jin Q. Van Eynde A. Beullens M. Roy N. Thiel G. Stalmans W. Bollen M. J. Biol. Chem. 2003; 278: 30677-30685Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). The latter promotes transcriptional repression by the recruitment of a histone methyltransferase and histone deacetylases. NIPP1 also appears to be required for the assembly of spliceosomes, the protein-RNA complexes that catalyze pre-mRNA splicing (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). The spliceosomal function of NIPP1 requires its C-terminal domain as well as its N-terminal Forkhead-associated (FHA) domain, an established phosphothreonine-binding module. The FHA domain of NIPP1 mediates targeting to both the spliceosomes and the nuclear storage sites for splicing factors, known as “speckles” (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 10Jagiello I. Van Eynde A. Vulsteke V. Beullens M. Boudrez A. Keppens S. Stalmans W. Bollen M. J. Cell Sci. 2000; 113: 3761-3764Crossref PubMed Google Scholar). The targeting function of the FHA domain of NIPP1 is likely explained by its ability to bind to phosphorylated forms of the essential splicing factors CDC5L (11Boudrez A. Beullens M. Groenen P. Van Eynde A. Vulsteke V. Jagiello I. Murray M. Krainer A.R. Stalmans W. Bollen M. J. Biol. Chem. 2000; 275: 25411-25417Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar) and SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Here we show that the protein kinase MELK, which is structurally related to the AMP-activated protein kinases, also interacts in a phosphorylation-dependent manner with the FHA domain of NIPP1 and that this interaction is increased during mitosis. Furthermore, we demonstrate that recombinant MELK blocks spliceosome assembly by a mechanism that involves NIPP1. Our data suggest a novel link between pre-mRNA processing and cell cycle progression. Yeast Two-hybrid Screening—NIPP1-(1–142), cloned into the pEG202 vector in-frame with the LexA DNA-binding domain, was used as bait for the screening of a HeLa cell cDNA library (11Boudrez A. Beullens M. Groenen P. Van Eynde A. Vulsteke V. Jagiello I. Murray M. Krainer A.R. Stalmans W. Bollen M. J. Biol. Chem. 2000; 275: 25411-25417Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). In this library, the cDNAs are subcloned behind a galactose-inducible promoter in the pJG4–5 vector in-frame with the B42 activation domain. Interacting proteins were identified by growth of the yeast strain EGY188 in a –leucine/+ galactose medium. The use of a plasmid-borne LacZ reporter gene (pSH18–34) with upstream LexA operators enabled a second, independent screening involving the expression of β-galactosidase in the presence of galactose. For the mapping of the NIPP1-MELK interaction site, MELK-(1–651), MELK-(1–291/590–651), and 10 different Thr to Ala mutants of MELK-(326–651) were subcloned in the pJG4–5 plasmid. MELK-(1–651), kindly provided as clone KIAA0175 by Dr. Nagase (Kazusa DNA Research Institute, Chiba, Japan), was subcloned by PCR with primers CTGGAATTCATGAAAGATTATGATGAACTTCTCA and TCTGCTCGAGTTATACCTTGCAGCTAGATAGGAT into the EcoRI/XhoI sites of pJG4–5. MELK-(1–291/590–651) was obtained by cutting pJG4–5-MELK-(1–651) with Bsp1407I and religation. All constructs were verified by DNA sequence analysis. The interaction between NIPP1-(1–142) and the MELK variants was quantified by measuring β-galactosidase activity in a liquid culture assay using 2-nitrophenyl-β-d-galactopyranoside as substrate (Clontech yeast protocols handbook). Antibodies—Bacterially expressed polyhistidine-tagged MELK was used to raise antibodies in rabbits. The MELK antibodies were affinity-purified on His-MELK linked to CNBr-activated Sepharose 4B (Amersham Biosciences). Anti-GST antibodies (sc-459), Anti-His antibodies (sc-803), and Anti-LexA antibodies (Sc-7544) were obtained from Santa Cruz Biotechnology. Swine anti-rabbit and rabbit anti-mouse antibodies were purchased from Dako. Anti-FLAG antibodies were obtained from Stratagene. Mouse monoclonal anti-HA antibodies (12CA5) were delivered by Roche Diagnostics. Preparation of Recombinant MELK (Mutants)—Wild-type MELK and MELK-(326–651) were cloned into the pET16b vector in-frame with a polyhistidine tag. The His-tagged proteins were purified by chromatography on Ni2+-pentadentate-chelator-Sepharose (Affiland). For the expression of FLAG-tagged MELK (mutants) in COS-1 cells the cDNAs of human MELK-wild-type, MELK-T478A, MELK-D150A, and MELK-1–266 were cloned as BamHI fragments into the pSG5-Flag vector. The first three cDNAs were also cloned as XhoI-EcoRI fragments into the baculovirus transfer vector pBleubac4.5. Recombinant viruses expressing MELK variants were generated using the Bac-N-Blue™ transfection kit (Invitrogen). For the production of recombinant MELK proteins, BT1-TN-5B1–4 (High Five™) Trichoplusia ni cells were grown as monolayer cultures at 27 °C in Express Five serum-free medium (Invitrogen). The cells were infected with the recombinant viruses at a multiplicity of infection of 10 and harvested after 48 h by low-speed centrifugation. As most of MELK and its mutants were expressed in insoluble inclusion bodies, we followed the procedure described by Berndt and Cohen (13Berndt N. Cohen P T.W. Eur. J. Biochem. 1990; 190: 291-297Crossref PubMed Scopus (38) Google Scholar) to dissolve and renature the insoluble species. Cell Cultures—COS-1 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 units/ml of both penicillin and streptomycin. Cells were blocked in mitosis by the addition of colcemid (0.14 μg/ml) 20–24 h before lysis. 48 h after transfection, the cells were washed twice with ice-cold phosphate-buffered saline and lysed in 50 mm Tris/HCl, pH 7.5, 0.3 m NaCl, 0.5% Triton X-100, 0.5 mm dithiothreitol, 0.5 mm phenylmethanesulfonyl fluoride, 0.5 mm benzamidine, and 5 μm leupeptin. After sonication, the lysates were cleared by centrifugation (10 min at 16,000 × g), and the supernatants were used for GST pull-down assays. GST Pull-down Assays—For the expression of NIPP1 as a GST fusion in mammalian cells, the cDNA of wild-type NIPP1 was cloned into the EcoRV-NotI sites of the pGMEX-T1 vector. Glutathione-agarose beads were pre-blocked with Tris-buffered saline plus bovine serum albumin (1 mg/ml) and 0.5% Triton X-100. After washing with Tris-buffered saline plus 0.1% Nonidet P-40, the beads were incubated with COS-1 cell lysates (Fig. 6) for 2 h at 10 °C. Subsequently, the beads were sedimented (30 s at 1000 × g) and washed twice with Tris-buffered saline plus 0.1% Nonidet P-40 and twice with Tris-buffered saline, and finally the associated proteins were analyzed by Tricine-SDS-polyacrylamide gel electrophoresis and immunoblotting. GST pull-down experiments with recombinant proteins and HeLa cell nuclear extracts were performed as described previously (11Boudrez A. Beullens M. Groenen P. Van Eynde A. Vulsteke V. Jagiello I. Murray M. Krainer A.R. Stalmans W. Bollen M. J. Biol. Chem. 2000; 275: 25411-25417Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Pre-mRNA Splicing in Nuclear Extracts—A capped β-globin pre-mRNA fragment, comprising exon 1 through the BamHI site in exon 2, was synthesized in the presence of α-32PGTP. This primary transcript was used as a substrate for splicing in HeLa cell nuclear extracts (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Spliceosomal complexes were separated by native gel electrophoresis as described previously (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). MELK Is a Novel Interactor of NIPP1—A yeast two-hybrid screening of a HeLa cell library with the N-terminal third of NIPP1 (residues 1–142) as bait yielded, in addition to clones encoding CDC5L (11Boudrez A. Beullens M. Groenen P. Van Eynde A. Vulsteke V. Jagiello I. Murray M. Krainer A.R. Stalmans W. Bollen M. J. Biol. Chem. 2000; 275: 25411-25417Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar) and SAP155 fragments (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar), 16 prey clones that all encoded the C-terminal half of the poorly characterized protein kinase MELK (for maternal embryonic leucine zipper kinase) (14Heyer B.S. Kochanowski H. Solter D. Dev. Dyn. 1999; 215: 344-351Crossref PubMed Scopus (48) Google Scholar) (Fig. 1). Compared with this MELK fragment, the full-length protein was a much better interactor with NIPP1 in two-hybrid assays (Fig. 1B). However, a deletion mutant of MELK, lacking the TP-rich domain, did not interact with NIPP1-(1–142). The MELK-NIPP1 interaction was lost by mutation (S68A/R69A/V70A/H71A) of the phosphate-binding loop of the FHA domain of NIPP1 (Fig. 1B), indicating that MELK interacted with the FHA domain of NIPP1 via a phosphorylated residue(s). Fig. 1C shows that all bait and prey proteins were well expressed, further validating the two-hybrid data. We have previously demonstrated that CDC5L (11Boudrez A. Beullens M. Groenen P. Van Eynde A. Vulsteke V. Jagiello I. Murray M. Krainer A.R. Stalmans W. Bollen M. J. Biol. Chem. 2000; 275: 25411-25417Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar) and SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) bind to the FHA domain of NIPP1 via threonine-phosphorylated TP dipeptide motifs. The fragment of MELK that binds to NIPP1 also contains numerous TP motifs (Fig. 1A). To examine whether one or several of these TP motifs are involved in the interaction with NIPP1 we performed two-hybrid assays after mutation (Thr to Ala) of each of the 10 TP motifs in the NIPP1-interaction domain of MELK (Fig. 2). All mutants were expressed well (Fig. 2B). However, four mutants showed a significantly reduced interaction with NIPP1 in the two-hybrid assays. The T478A mutant in particular was severely impaired in binding NIPP1. These data implicate some TP motifs of MELK, in particular the TP motif comprising Thr-478 and Pro-479, in the interaction with NIPP1. Interaction of Purified Components—To further explore whether MELK and NIPP1 interact directly and in a phosphorylation-dependent manner, we expressed the NIPP1-interacting C-terminal domain of MELK (residues 326–651) as a His-tagged protein in bacteria. Purified recombinant MELK-(326–651) did not with NIPP1-(1–142) (Fig. However, we that a of MELK-(326–651) with a HeLa cell nuclear in the presence of enabled its interaction with a with was not seen after a of the T478A mutant with nuclear extracts (Fig. The data showed that MELK interacts directly with the FHA domain of NIPP1 and that this interaction is by phosphorylated In further with this we that the be used as a to the interaction between and its FHA in nuclear extracts (Fig. the MELK did not have this MELK Is an of explore the role of the NIPP1-MELK we purified expressed NIPP1 and In addition to wild-type MELK we generated a mutant as well as a kinase-dead mutant The latter is in the in kinase which is required for the binding of J. 1995; PubMed Scopus Google Scholar). All three proteins were expressed in cells as insoluble inclusion and were However, the inclusion be in m and MELK be by and with a as described previously for the of PP1 (13Berndt N. Cohen P T.W. Eur. J. Biochem. 1990; 190: 291-297Crossref PubMed Scopus (38) Google Scholar). The wild-type MELK was of as protein (Fig. as well as and In of MELK was (Fig. As the mutant was but at protein the T478A mutant was much the wild-type Recombinant NIPP1 did not the ability of MELK to or to protein NIPP1 is an established pre-mRNA splicing we whether the interactor MELK also has a role in pre-mRNA splicing. Fig. shows that the addition of 1 μm wild-type MELK blocked the splicing of a fragment of β-globin pre-mRNA by HeLa cell nuclear extracts. the kinase-dead mutant of MELK the indicating that the splicing was independent of by the splicing was seen with the indicating a mediatory role for NIPP1. splicing were in the presence of MELK or MELK-D150A, that MELK with spliceosome assembly with splicing In further with this we that MELK did not pre-mRNA splicing after spliceosome after a of the splicing extracts for min assembly and involves the recruitment of nuclear and splicing factors as well as Cell Biol. 2000; PubMed Scopus Google Scholar). gel electrophoresis that MELK (Fig. and blocked an early step of spliceosome a step before the assembly of the This that MELK the assembly of the or the from the to the The MELK-NIPP1 Interaction Is during The data that the MELK-NIPP1 interaction in an of pre-mRNA splicing. of the associated with a of pre-mRNA splicing is mitosis. MELK appears to be phosphorylated during mitosis J. I. M. Dev. Biol. 2002; PubMed Scopus (57) Google Scholar, N. V. J. 2002; PubMed Scopus Google Scholar) and interacts with NIPP1 phosphorylated we that the MELK-NIPP1 interaction be increased during mitosis. To explore this we NIPP1 and FLAG-tagged MELK in COS-1 cells. The of MELK that with from the cell lysates was increased the cells were blocked in mitosis by the addition of colcemid (Fig. or at 20–24 h before cell this not be explained by different expression of the or (Fig. and The were obtained with the kinase-dead mutant MELK-D150A, that MELK kinase activity is not required for the of MELK on a that mediates its interaction with NIPP1. was a interactor of NIPP1 in cell lysates from both and mitotically arrested cells, in with two-hybrid (Fig. and GST pull-down experiments (Fig. which the NIPP1 interaction site but contains the kinase domain (Fig. did not bind to NIPP1 in The demonstrated that NIPP1 and MELK interact with each in and that interaction is increased during pre-mRNA splicing is The MELK-NIPP1 have here that MELK is an interactor of the FHA domain of NIPP1 and that this interaction involves the binding of a threonine-phosphorylated TP motif to the binding loop of the FHA domain. The TP motif of MELK that appears to be most for the interaction with NIPP1 in yeast (Fig. in COS-1 cells (Fig. and in with recombinant proteins (Fig. Thr-478 and However, as we have previously demonstrated for SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar), is that TP motifs of MELK, also binding to NIPP1. be to the protein that the TP motifs of MELK and to examine whether the activation of this in an increased interaction with NIPP1. all three established of the FHA domain of NIPP1, CDC5L J. Biol. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar), SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar), and MELK J. I. M. Dev. Biol. 2002; PubMed Scopus (57) Google Scholar, N. V. J. 2002; PubMed Scopus Google Scholar), are during and at in the of SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) and MELK this that bind directly to the FHA domain of NIPP1. one or the interaction between the splicing NIPP1 and its FHA a novel link between cell cycle and pre-mRNA for a link from that the of the splicing CDC5L the J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), the of MELK is associated with an of cells in N. V. J. 2002; PubMed Scopus Google Scholar). be to the of NIPP1 to these of CDC5L and Our data suggest that the of also a indicating that this of MELK not on the recruitment of NIPP1. the be to whether the increased and MELK-NIPP1 to the splicing during mitosis or are implicated in the of splicing in the early be that splicing factors have also implicated in splicing with cell cycle Biol. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar). For has demonstrated that the protein is required for splicing repression during mitosis 2003; Full Text Full Text PDF Scopus Google Scholar). The kinase that MELK on Thr-478 is to be MELK a kinase-dead mutant showed an increased interaction with NIPP1 during mitosis (Fig. We also that recombinant MELK is not an in substrate for indicating that Thr-478 is phosphorylated by a also be that the increased of MELK on Thr-478 during mitosis is not the of an increased kinase kinase activity but also be accounted for by a reduced MELK NIPP1 and Pre-mRNA of spliceosome assembly by MELK not a site but on Thr-478 (Fig. which is essential for the binding of NIPP1. for this of spliceosome assembly is that MELK with splicing factors for binding to the FHA domain and the recruitment of NIPP1 to the We have previously demonstrated that the C-terminal third of NIPP1 is required for a step of spliceosome assembly and that the of the in the presence of NIPP1-(1–142) (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Our that wild-type MELK, but not the blocks an early step of spliceosome assembly (Fig. suggest that NIPP1-(1–142) is for an early step of spliceosome assembly. of spliceosome assembly by MELK in splicing extracts did not a domain. However, this not the that MELK also pre-mRNA processing in by protein For we have that CDC5L and as well as NIPP1, are in for by MELK, which to the of splicing by The interaction of the FHA domain of NIPP1 with its is with both splicing and splicing the one a FHA domain is required for spliceosome assembly (8Beullens M. Bollen M. J. Biol. Chem. 2002; 277: 19855-19860Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar), and of the FHA domain, as MELK, spliceosome assembly (Fig. the the FHA domain of NIPP1 is also required for the targeting of NIPP1 to the nuclear storage sites of splicing factors I. Van Eynde A. Vulsteke V. Beullens M. Boudrez A. Keppens S. Stalmans W. Bollen M. J. Cell Sci. 2000; 113: 3761-3764Crossref PubMed Google Scholar), and NIPP1 shows an increased interaction with SAP155 (12Boudrez A. Beullens M. Waelkens E. Stalmans W. Bollen M. J. Biol. Chem. 2002; 277: 31834-31841Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) and MELK (Fig. 6) during splicing is for these is that the binding of NIPP1 to some FHA is associated with splicing the with promotes spliceosome assembly. the targeting of NIPP1 to the nuclear during and to the storage sites of splicing factors as a mechanism that a of pre-mRNA splicing by the recruitment of complexes of splicing factors during spliceosome assembly. the of the interaction between NIPP1 and its by and the that NIPP1 is associated with both a protein kinase and a protein suggest a function for NIPP1 in to splicing. of on the of its domain G. S. 2002; Scopus Google Scholar), MELK to the of protein that also protein G. A. E. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar), J. Sci. S. A. PubMed Scopus Google Scholar), as well as the AMP-activated protein D. M. Biochem. PubMed Scopus Google Scholar). is not known the activity of MELK is but this is likely to be MELK is of (Fig. but is not whether this also its of MELK to a Thr the activation loop of related protein D. M. Biochem. PubMed Scopus Google Scholar, J. J. Biol. 2003; PubMed Google Scholar). For activation of the AMP-activated kinase requires of this Thr in the activation loop by the J. J. Biol. 2003; PubMed Google Scholar). also likely that the C-terminal domain of MELK, which the TP-rich domain, has a Our data that this domain is the T478A mutant is wild-type MELK (Fig. and the recombinant C-terminal half of MELK is a inhibitor of the kinase activity of M. A. S. A. Van W. and M. data. further of the mechanisms that control the activity of MELK be essential to the that on MELK and its interactor NIPP1. We and for
Vulsteke et al. (Fri,) studied this question.