Key points are not available for this paper at this time.
Abstract Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis ‐acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR , which encodes a transcriptional activator protein. The rightward operon contains luxl , which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE , which are required for the bioluminescence activity. Transcription of luxR from P L is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP‐ dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxl gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N ‐(3‐oxo‐hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of P R to stimulate transcription of the rightward operon. Increased transcription from P R should yield increased levels of Luxl and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both P L and P R is repressed by sequences within the luxR coding region. Hence there appear to be at least two effects resulting from the interaction between LuxR: autoinducer and the control region DNA. One effect is to relieve the repression afforded by the sequences within luxR and the second is to stimulate transcription from P R . Recent analysis of the rightward promotor by site‐directed mutagenesis has suggested a different location for P R than that which was implicated in earlier studies. Our results suggest that the −35 sequence is located at a position which overlaps the 3′ edge of the LuxR binding site by one base pair.
Shadel et al. (Sun,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: