Molecular Identification of Mammalian Phosphopentomutase and Glucose-1,6-bisphosphate Synthase, Two Members of the α-D-Phosphohexomutase Family

The molecular identity of mammalian phosphopentomutase has not yet been established unequivocally. That of glucose-1, 6-bisphosphate synthase, the enzyme that synthesizes a cofactor for phosphomutases and putative regulator of glycolysis, is completely unknown. In the present work, we have purified phosphopentomutase from human erythrocytes and found it to copurify with a 68-kDa polypeptide that was identified by mass spectrometry as phosphoglucomutase 2 (PGM2), a protein of the α-d-phosphohexomutase family and sharing about 20% identity with mammalian phosphoglucomutase 1. Data base searches indicated that vertebrate genomes contained, in addition to PGM2, a homologue (PGM2L1, for PGM2-like 1) sharing about 60% sequence identity with this protein. Both PGM2 and PGM2L1 were overexpressed in Escherichia coli, purified, and their properties were studied. Using catalytic efficiency as a criterion, PGM2 acted more than 10-fold better as a phosphopentomutase (both on deoxyribose 1-phosphate and on ribose 1-phosphate) than as a phosphoglucomutase. PGM2L1 showed only low (<5%) phosphopentomutase and phosphoglucomutase activities compared with PGM2, but was about 5–20-fold better than the latter enzyme in catalyzing the 1, 3-bisphosphoglycerate-dependent synthesis of glucose 1, 6-bisphosphate and other aldose-bisphosphates. Furthermore, quantitative real-time PCR analysis indicated that PGM2L1 was mainly expressed in brain where glucose-1, 6-bisphosphate synthase activity was previously shown to be particularly high. We conclude that mammalian phosphopentomutase and glucose-1, 6-bisphosphate synthase correspond to two closely related proteins, PGM2 and PGM2L1, encoded by two genes that separated early in vertebrate evolution. The molecular identity of mammalian phosphopentomutase has not yet been established unequivocally. That of glucose-1, 6-bisphosphate synthase, the enzyme that synthesizes a cofactor for phosphomutases and putative regulator of glycolysis, is completely unknown. In the present work, we have purified phosphopentomutase from human erythrocytes and found it to copurify with a 68-kDa polypeptide that was identified by mass spectrometry as phosphoglucomutase 2 (PGM2), a protein of the α-d-phosphohexomutase family and sharing about 20% identity with mammalian phosphoglucomutase 1. Data base searches indicated that vertebrate genomes contained, in addition to PGM2, a homologue (PGM2L1, for PGM2-like 1) sharing about 60% sequence identity with this protein. Both PGM2 and PGM2L1 were overexpressed in Escherichia coli, purified, and their properties were studied. Using catalytic efficiency as a criterion, PGM2 acted more than 10-fold better as a phosphopentomutase (both on deoxyribose 1-phosphate and on ribose 1-phosphate) than as a phosphoglucomutase. PGM2L1 showed only low (<5%) phosphopentomutase and phosphoglucomutase activities compared with PGM2, but was about 5–20-fold better than the latter enzyme in catalyzing the 1, 3-bisphosphoglycerate-dependent synthesis of glucose 1, 6-bisphosphate and other aldose-bisphosphates. Furthermore, quantitative real-time PCR analysis indicated that PGM2L1 was mainly expressed in brain where glucose-1, 6-bisphosphate synthase activity was previously shown to be particularly high. We conclude that mammalian phosphopentomutase and glucose-1, 6-bisphosphate synthase correspond to two closely related proteins, PGM2 and PGM2L1, encoded by two genes that separated early in vertebrate evolution. Phosphopentomutase catalyzes the conversion of the nucleoside breakdown products ribose 1-phosphate and deoxyribose 1-phosphate to the corresponding 5-phosphopentoses. Most bacterial phosphopentomutases characterized so far belong to the same protein family as alkaline phosphatases, sulfatases, and cofactor-independent bisphosphoglycerate mutases (1Galperin M. Y. Kim A. Koonin E. V. Protein Sci. 1998; 7: 1829-1835Crossref PubMed Scopus (138) Google Scholar), though the enzyme from Thermococcus kodakaraensis belongs to the same protein family as mammalian phosphoglucomutase 1 (PGM1), 5The abbreviations used are: PGM, phosphoglucomutase; DEAE, diethylaminoethyl; SP, sulfopropyl; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPRT, hypoxanthine phosphoribosyltransferase; MES, 4-morpholineethanesulfonic acid; DTT, dithiothreitol. the enzyme that catalyzes the interconversion of glucose 1-phosphate and glucose 6-phosphate (2Rashid N. Kim H. Fukui T. Atomi H. Imanaka T. J. Bacteriol. 2004; 186: 4185-4191Crossref PubMed Scopus (48) Google Scholar). The molecular identity of the mammalian phosphopentomutase is still not ascertained. Biochemical characterization of phosphoglucomutase (PGM) isozymes indicated that one of them, designated PGM2 in man (PGM1 in mouse) was more active as a phosphopentomutase than as a phosphoglucomutase, whereas mammalian PGM1 (equivalent to PGM2 in mouse) has a phosphopentomutase activity representing only about 0. 2% of its phosphoglucomutase activity (3Quick C. B. Kim R. A. Harris H. Ann. Hum. Genet. 1972; 35: 445-454Crossref PubMed Scopus (31) Google Scholar). Phosphopentomutase has been purified from rat liver to near homogeneity and shown to coelute with a polypeptide of 32. 5 kDa (4Barsky D. L. Kim P. A. Biochim. Biophys. Acta. 1983; 743: 162-171Crossref PubMed Scopus (14) Google Scholar), the sequence of which was not determined. Analysis of cell hybrids indicated that the PGM2 locus is on human chromosome 4p14-q12 (5Wijnen L. M. Kim K. H. Pearson P. L. Meera Khan P. Hum. Genet. 1977; 37: 271-278Crossref PubMed Scopus (38) Google Scholar). A putative protein sharing ≈20% identity with PGM1 is encoded by a gene present on human chromosome 4p14. It is designated PGM2 in the databases presumably because its chromosomal localization fits with the PGM2 locus but it has never been shown to act as a phosphopentomutase. Furthermore, its size (612 amino acid residues) is about twice that reported for rat liver phosphopentomutase (4Barsky D. L. Kim P. A. Biochim. Biophys. Acta. 1983; 743: 162-171Crossref PubMed Scopus (14) Google Scholar). In view of these contradictory findings, we decided to reinvestigate the identity of human phosphopentomutase, which we formally identify in this report as the protein designated PGM2 in the data bases. We also show that a closely related protein, PGM2-like 1 (PGM2L1), which shares ≈ 60% sequence identity with PGM2, actually corresponds to glucose-1, 6-bisphosphate synthase. This enzyme, which had not yet been molecularly identified, catalyzes the 1, 3-bisphosphoglycerate-dependent synthesis of glucose 1, 6-bisphosphate and other aldose-bisphosphates that serve as cofactors for several sugar phosphomutases and possibly also as regulators of glycolytic enzymes. Materials—Reagents, of analytical grade whenever possible, were from Sigma, Acros (Geel, Belgium), Roche Applied Sciences (Mannheim, Germany), or Merck (Darmstadt, Germany). DEAE-Sepharose, SP-Sepharose, Q-Sepharose, Superdex-200 10/300 GL, HisTrap, and PD-10 column were purchased from GE Healthcare (Diegem, Belgium). Vivaspin-2 centrifugal concentrator was from Vivascience (Göttingen, Germany). Enzymes and restriction enzymes were purchased from Sigma, Roche Applied Sciences, or Fermentas (St Leon-Rot, Germany). TriPure reagent was from Roche Applied Sciences and the cDNA synthesis kit was from Fermentas. Purification of Phosphopentomutase—Phosphopentomutase was purified from human erythrocytes. 80 ml of packed erythrocytes were washed three times with 150 mm NaCl and diluted in 400 ml of a buffer containing 10 mm Tris, pH 8, 1 mm dithiothreitol (DTT), 1 μg/ml leupeptin, and 1 μg/ml antipain. The hemolysate was centrifuged for 20 min at 11, 000 × g. The supernatant (300 ml) was diluted twice in buffer A (20 mm Tris, pH 8, 1 mm DTT, 1 μg/ml leupeptin, and 1 μg/ml antipain) and applied to a DEAE-Sepharose column (200 cm3) equilibrated with the same buffer. The column was washed with 400 ml of buffer A, and protein was eluted with a 0–0. 25 m NaCl gradient in 1000 ml of buffer A. The most active fractions were pooled (75 ml), brought to 300 ml with buffer B (25 mm MES, pH 6, 1 mm DTT, 25 mm KCl, 5 μg/ml leupeptin, and 5 μg/ml antipain), and applied to a SP-Sepharose column (25 cm3) equilibrated with buffer B. The column was washed with 100 ml of equilibration buffer. Phosphopentomutase was recovered in the flow-through and washing fractions, which were concentrated to 37. 5 ml by ultrafiltration in a 200-ml Amicon cell equipped with a PM-10 membrane. This sample was brought to 180 ml with buffer C (25 mm glycine, pH 9, 1 mm DTT, 25 mm KCl, 5 μg/ml leupeptin, and 5 μg/ml antipain) and applied to a Q-Sepharose column (20 cm3) equilibrated with the same buffer. The column was washed with 80 ml of buffer C, and the retained proteins were eluted with a 0–0. 75 m NaCl gradient in 300 ml of buffer C. The most active fractions (6. 6 ml) were concentrated to 0. 5 ml (with Vivaspin-2) and gel-filtered on a Superdex-200 10/300 GL column equilibrated with buffer D (25 mm Hepes, pH 7. 4, 1 mm DTT, 5 μg/ml leupeptin, 5 μg/ml antipain, and 100 mm NaCl). Fractions of 0. 5 ml were collected. Protein was assayed as described (6Bradford M. M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216428) Google Scholar) using bovine serum albumin as a standard. The bands co-eluting with the phosphopentomutase activity were cut out from a 12% (w/v) polyacrylamide-SDS gel and digested with trypsin. Peptides were analyzed by nanoelectrospray-ionization tandem mass spectrometry (7Achouri Y. Kim G. Vertommen D. Rider M. H. Veiga-Da-Cunha M. Van Schaftingen E. Biochem. J. 2004; 381: 35-42Crossref PubMed Scopus (97) Google Scholar) in a LCQ Deca XP Plus ion trap mass spectrometer (ThermoFinnigan, San Jose, CA) fitted with a nanoelectrospray probe. The data were analyzed with the X-calibur software (ThermoFinnigan), and the proteins were identified with TurboSEQUEST in the BioWorks software suite (ThermoFinnigan). Overexpression and Purification of Human PGM2 and PGM2L1—The open reading frame of human PGM2 and PGM2L1 (GenBank™ accession numbers NP₀60760 and NP₇75853) were PCR-amplified using a mixture of Taq and Pfu DNA polymerases and human white blood cells cDNA as a template. For PGM2, a 5′ primer containing the initiator codon (CAAGCTCACATATGGCGGCTCCAGAAGGCAG) in an NdeI site (in bold) and a 3′-primer containing the putative stop codon (GGCTGGAGATCTTTAGTCTGCTTTTGGCTGCAGAT) flanked by a BglII site (in bold) were used. The 1840-bp PCR-product was digested with NdeI-BglII and cloned into pET-15b expression vector. The insert was checked by sequencing. This expression vector was used to transform E. coli BL21 (DE3). For PGM2L1, a 5′ primer containing the initiator codon (CCATATGGCTGAAAACACAGAGGGGG) in an NdeI site (in bold) and a 3′ primer containing the putative stop codon (TGGATCCCTAAACAGAACGCCAGATCA) flanked by a BamHI site (in bold) were used. A 1870-bp product was obtained, which was subcloned in pBlueScript and checked by sequencing. A NdeI-BamHI fragment was removed from the pBlueScript plasmid and ligated in pET-15b expression vector. This vector was used to transform E. coli BL21 (DE3) pLysS. Protein expression and preparation of bacterial extracts were performed as described previously (8Fortpied J. Kim R. Stroobant V. Van Schaftingen E. Biochem. J. 2005; 388: 795-802Crossref PubMed Scopus (30) Google Scholar). Both His-tagged proteins were purified on HisTrap columns (Ni2+ form) as previously described (9Gemayel R. Kim J. Rzem R. Vertommen D. Veiga-da-Cunha M. Van Schaftingen E. FEBS J. 2007; 274: 4360-4374Crossref PubMed Scopus (30) Google Scholar). Both proteins were eluted with ≈150 mm imidazole (as indicated by SDS-PAGE analysis). Both proteins were desalted on PD-10 columns equilibrated with 25 mm Hepes pH 7. 4 and 50 mm KCl. Protein concentration was estimated by measuring A280 assuming extinction coefficients of 83, 810 and 97, 260 m–1 cm–1 for PGM2 and PGM2L1, respectively; 22 mg of pure PGM2 and 3 mg of pure PGM2L1 were obtained per liter of culture. The purified proteins were supplemented with 10% (w/v) glycerol and stored at –70 °C. Measurement of Enzymatic Activities—The enzymatic activities were assayed spectrophotometrically at 30 °C. All assay media (reaction mixture of 600 μl) contained 25 mm Hepes pH 7. 4, 25 mm KCl, 1 mm MgCl2, 1 mm DTT, and 100 μm EGTA (assay buffer). Phosphoribomutase was assayed in assay buffer containing 1 mm MnCl2, 50 μm CTP-Mg, 0. 15 mm NADPH, 0. 5 μm glucose 1, 6-bisphosphate, different concentrations of ribose 1-phosphate, ribose-5-phosphate isomerase from spinach (1. 7 units/ml), Haemophilus influenzae ribulose-5-phosphate reductase (0. 3 units/ml) (10Follens A. Kim M. Merckx R. van Schaftingen E. van Eldere J. J. Bacteriol. 1999; 181: 2001-2007Crossref PubMed Google Scholar) and PGM2 (0. 03 μg/ml) or PGM2L1 (2 μg/ml). One unit of enzyme is the amount that converts 1 μmol of substrate per min under these conditions. Phosphodeoxyribomutase was assayed in assay buffer containing 0. 15 mm NADH, 5 μm glucose 1, 6-bisphosphate, different concentrations of deoxyribose 1-phosphate, deoxyribose-5-phosphate aldolase (6 μg/ml, from Thermus thermophilus, overexpressed in E. coli and purified to homogeneity), 6T. Sokolova and M. Veiga-da-Cunha, unpublished results. rabbit muscle triose phosphate isomerase (3. 5 units/ml) and glycerol-3-phosphate dehydrogenase (1 units/ml), as well as PGM2 (0. 03 μg/ml) or PGM2L1 (5 μg/ml). Phosphoglucomutase was assayed in assay buffer containing 0. 25 mm NADP, 5 μm glucose 1, 6-bisphosphate, different concentrations of glucose 1-phosphate, yeast glucose-6-phosphate dehydrogenase (3 units/ml) and PGM2 (0. 15 μg/ml) or PGM2L1 (2. 4 μg/ml). The glucose-1, 6-bisphosphate synthase and aldose-bisphosphate synthase activities were determined in assay buffer containing 500 μm inorganic phosphate, 20 μm glyceraldehyde 3-phosphate, 500 μm NAD, 100 μg/ml bovine serum albumin, different concentrations of aldose monophosphate, rabbit muscle glyceraldehyde-3-phosphate dehydrogenase (1 and PGM2 μg/ml) or PGM2L1 to μg/ml). and PCR was from from 3 with TriPure reagent to the was by a gel and the and and its was by 1 of from sample was to cDNA by using and 1) were to PCR products of about 150 from PGM2, PGM2L1 and two and were to by gel that of DNA not PCR was performed using an The of of DNA was by of for PGM2, PGM2L1, and in a sequence of of human PGM2 and PGM2L1, identified with the Kim J. PubMed Scopus Google Scholar), were using with the Kim PubMed Scopus Google Scholar). A was using the of of with and with for For the 1000 were Purification of Human its phosphopentomutase was assayed by measuring the conversion of ribose 1-phosphate to ribose with a assay using ribose-5-phosphate isomerase and ribulose-5-phosphate Phosphopentomutase was purified from human erythrocytes about by on DEAE-Sepharose, SP-Sepharose, Q-Sepharose and with an of This low was to the that only the most purified fractions were used for the SDS-PAGE analysis of the fractions of the showed that the enzymatic activity with a 68-kDa which was cut out from the gel and digested with trypsin. spectrometry analysis indicated that the 68-kDa protein × in the to a protein designated PGM2 (GenBank™ accession in the in were which amino a report had that phosphopentomutase to a polypeptide we also analyzed the polypeptide that with phosphopentomutase activity than the 68-kDa This protein, which was identified × as triose phosphate isomerase (GenBank™ accession is to of human PGM2 and indicated by an the The from the α-d-phosphohexomutase family is in The identified by mass spectrometry in the protein purified from human erythrocytes in the PGM2 The human PGM2 (GenBank™ accession and PGM2L1 (GenBank™ accession of PGM2 searches with human PGM2 indicated that of this protein were found in identity with the human and (both and was in genomes also a closely related protein, designated PGM2-like 1 (PGM2L1), which shares about 60% sequence identity with shown in the sequence of a of the PGM2L1 proteins was that not a but an in the that the in the phosphoglucomutase family Kim C. J. 1983; PubMed Google Kim Protein Sci. 2004; PubMed Scopus Google Scholar). The in 3 that PGM2L1 and PGM2 separated early on vertebrate as indicated by the of of PGM2 and PGM2L1 in PGM2 and PGM2L1 related to sharing only about 20% sequence identity with this enzyme also to in a that the that is Analysis with P. Kim Google Scholar) and Kim H. G. J. PubMed Scopus Google Scholar) indicated that the of human PGM2 and PGM2L1 not a a or a localization that proteins of PGM2 and PGM2L1—The of PGM2 and PGM2L1 was determined in by quantitative real-time PCR using glyceraldehyde-3-phosphate dehydrogenase and hypoxanthine as that for PGM2, the expression were in and contained at 20% of the found in or was used as a The in muscle and was used as a presumably because of the expression of this glycolytic enzyme in for PGM2L1 the of expression were in brain and were found in and and the of the were in and Overexpression and of Human PGM2 and proteins were overexpressed in E. coli as proteins with a at their and purified on to near The of the two enzymes to ribose 1-phosphate, deoxyribose 1-phosphate, and glucose 1-phosphate to the corresponding aldose or was determined with shown in PGM2 activity on three In of catalytic efficiency the were deoxyribose 1-phosphate and ribose 1-phosphate, which were and times better than glucose 1-phosphate, The was with ribose 1-phosphate and the with deoxyribose PGM2L1 showed activity on three the in than of that with All activities were by glucose In the of the phosphoglucomutase activity of PGM2, was at and μm glucose 1, 6-bisphosphate in the of 100 and 500 μm glucose 1-phosphate, In the of PGM2L1, was at glucose 1, 6-bisphosphate concentrations μm in the of 20 and μm glucose activities of PGM2 and efficiency in a low phosphopentomutase and phosphoglucomutase activities of PGM2L1 that it a different a to identify that serve as for PGM2L1, we the of a of phosphate to the activity of this we found that glycerol and were of PGM2L1 though not of a concentration of glycerol and the activity of PGM2L1 with 20 μm ribose 1-phosphate) by and but that of PGM2 by only This that the phosphate of a be a substrate for has the of a glucose-1, 6-bisphosphate synthase, which the to glucose 1-phosphate or glucose 6-phosphate to glucose 1, 6-bisphosphate Kim G. J. PubMed Google Kim J. 1976; PubMed Google Scholar). This enzyme was shown to be particularly active in It was purified from this and identified as a protein, which acted also with low as a phosphoglucomutase, properties that to of the of the latter to glucose 1, 6-bisphosphate from and glucose or we a assay in which the activity of glyceraldehyde-3-phosphate dehydrogenase by the of is to the of by the synthase. This is by the that the by glyceraldehyde-3-phosphate dehydrogenase its in the of an enzyme that as in the of the be to by a and also that addition of glucose 1-phosphate and PGM2L1 not of is not which that PGM2L1 to the of glucose The of in this was to the concentration of Using this we found that PGM2L1 showed an aldose synthase activity with glucose 1-phosphate, deoxyribose 1-phosphate, ribose 1-phosphate, glucose and 1-phosphate as but or activity on ribose and deoxyribose in with obtained with glucose-1, 6-bisphosphate synthase purified from brain Kim G. J. PubMed Google Kim Biochem. Biophys. PubMed Scopus Google Scholar). The enzyme PGM2 showed to aldose but was about 5–20-fold active than PGM2L1 in this The synthase activity was more by glucose 1, 6-bisphosphate, the product of the in the of PGM2 than of with 1 mm glucose 1-phosphate, was with 10 μm glucose 1, 6-bisphosphate in the of PGM2 as compared with 50 μm in the of 1, 6-bisphosphate synthase and other aldose-bisphosphate synthase activities of PGM2 and at 1 mm or activity at 1 mm not not not not not not not determined. in a of Phosphopentomutase as that phosphopentomutase activity in human and presumably also in other is by the protein designated PGM2 in the protein data in where PGM2 is the of human This is on the that human phosphopentomutase with Furthermore, PGM2 a phosphopentomutase activity than its phosphoglucomutase properties to of the phosphopentomutase previously characterized in mammalian Kim R. J. PubMed Google A. Kim E. A. Biochem. Google Scholar). at with the of and (4Barsky D. L. Kim P. A. Biochim. Biophys. Acta. 1983; 743: 162-171Crossref PubMed Scopus (14) Google Scholar), purified phosphopentomutase from rat liver to near homogeneity and that it was a of two of 32. 5 the SDS-PAGE gel shown by these that their most purified fractions also contained a in addition to the is that the than the corresponds to rat phosphopentomutase. the rat also a PGM2 sharing sequence identity with human that PGM2 the to of the α-d-phosphohexomutase which bacterial and and bacterial Kim Protein Sci. 2004; PubMed Scopus Google Scholar). The of phosphoglucomutase has been Kim Protein Sci. 2004; PubMed Scopus Google Kim Y. M. J. PubMed Google C. Kim J. PubMed Scopus Google Scholar). be phosphoglucomutase to be on the present in the and this is by one of the of glucose the conversion of glucose 1-phosphate to glucose the enzyme with glucose 1-phosphate, glucose The latter the catalytic site and the enzyme by its glucose of the of the in PGM2 and of the that this enzyme also glucose 1, 6-bisphosphate as a it is that the also as a phosphate The of phosphopentomutase is to ribose 1-phosphate and deoxyribose 1-phosphate, which by nucleoside and The molecular of phosphopentomutase to of Both and nucleoside to be of Kim B. 1972; PubMed Scopus Google Ann. N. Y. Sci. PubMed Scopus Google Scholar). The of phosphopentomutase in the of ribose 1-phosphate and deoxyribose 1-phosphate and in a of nucleoside of PGM2L1 as of a human protein sharing about 60% sequence identity with human PGM2 was was that this enzyme was a of with different this enzyme to have a low activity on the three 1-phosphate, ribose 1-phosphate, and deoxyribose The that PGM2L1 is expressed at a in its molecular mass of kDa and its activity properties that PGM2L1 shares with glucose-1, 6-bisphosphate synthase Kim G. J. PubMed Google Kim J. 1976; PubMed Google H. Kim C. T. J. PubMed Scopus Google Scholar), an enzyme molecular identity had not yet been That PGM2L1 corresponds to glucose 1, 6-bisphosphate synthase is indicated by the that PGM2L1 used as a phosphate and a of as for brain glucose-1, 6-bisphosphate synthase Kim G. J. PubMed Google Kim Biochem. Biophys. PubMed Scopus Google Scholar), 1-phosphate, 1-phosphate, ribose 1-phosphate, and deoxyribose 1-phosphate) were whereas 5 or the of glucose were This substrate that PGM2L1 is to cofactors for The that PGM2L1 also a in a as found in enzymes with that glucose-1, 6-bisphosphate synthase is on a by of the of Kim J. 1976; PubMed Google Scholar). previously this is the of aldose-bisphosphate The is the of the phosphate from the a Kim J. 1976; PubMed Google H. Kim C. T. J. PubMed Scopus Google Scholar). previously reported by for the enzyme purified from human erythrocytes A. Kim E. A. Biochem. Google Scholar), PGM2 also glucose-1, 6-bisphosphate synthase as shown in the present the synthase activity of PGM2 is than that of PGM2L1 and it is more by glucose This that PGM2L1 is more to concentrations of glucose 1, 6-bisphosphate than This with the that the glucose 1, 6-bisphosphate concentration is particularly in where of the of have been reported Kim J. PubMed Google V. Kim J. J. PubMed Scopus Google Scholar). concentrations far the to phosphomutases ≈ and it is that glucose 1, 6-bisphosphate possibly a 1, 6-bisphosphate at in an of low Kim A. J. PubMed Google G. Kim H. R. J. Biochem. PubMed Scopus Google Scholar), of dehydrogenase R. Kim J. Biochim. Biophys. Acta. PubMed Scopus Google Scholar) and of J. 1976; PubMed Google Scholar), and a of Kim Biochem. Biophys. PubMed Scopus (48) Google Scholar), though a one than Schaftingen E. Kim Sci. A. PubMed Scopus Google Scholar), and of liver Kim van Biochim. Biophys. Acta. 1972; PubMed Scopus Google Scholar). The that glucose 1, 6-bisphosphate a is by the that brain is also in the enzyme that glucose The activity of this enzyme is on a that in Kim J. PubMed Google Scholar) and this at for the that the glucose 1, 6-bisphosphate concentration in brain The in the concentration of glucose 1, 6-bisphosphate is to low and A is presumably by ribose which is also by PGM2L1 and is a of E. Kim T. J. PubMed Google Scholar). The concentration of ribose was shown to in T. Kim J. PubMed Scopus Google Scholar). The molecular of the enzyme that synthesizes glucose 1, 6-bisphosphate and ribose at the of these in