c-Fos Degradation by the Proteasome

c-Fos is a transcription factor that promotes cell growth, differentiation, and transformation. We found that c-Fos was degraded when WEHI7.2 mouse lymphoma cells were induced to undergo apoptosis with the calcium ATPase inhibitor, thapsigargin, or the glucocorticoid hormone, dexamethasone. The degradation of c-Fos preceded caspase-3 activation and apoptotic nuclear chromatin condensation and was inhibited by the proteasome inhibitors MG132,N-acetyl-leucyl-leucyl-norleucinal, and lactacystin. Stable transfection of WEHI7.2 cells with a mutant form of c-Fos that was not degraded by the proteasome inhibited apoptosis. Also, overexpression of Bcl-2 in WEHI7.2 cells blocked c-Fos degradation and inhibited apoptosis. The results indicate that proteasome-mediated degradation of c-Fos is an early, Bcl-2-regulated step in apoptosis induction by thapsigargin and dexamethasone. These findings suggest that c-Fos may have a protective action that is eliminated by proteasome-mediated degradation and preserved by Bcl-2. c-Fos is a transcription factor that promotes cell growth, differentiation, and transformation. We found that c-Fos was degraded when WEHI7.2 mouse lymphoma cells were induced to undergo apoptosis with the calcium ATPase inhibitor, thapsigargin, or the glucocorticoid hormone, dexamethasone. The degradation of c-Fos preceded caspase-3 activation and apoptotic nuclear chromatin condensation and was inhibited by the proteasome inhibitors MG132,N-acetyl-leucyl-leucyl-norleucinal, and lactacystin. Stable transfection of WEHI7.2 cells with a mutant form of c-Fos that was not degraded by the proteasome inhibited apoptosis. Also, overexpression of Bcl-2 in WEHI7.2 cells blocked c-Fos degradation and inhibited apoptosis. The results indicate that proteasome-mediated degradation of c-Fos is an early, Bcl-2-regulated step in apoptosis induction by thapsigargin and dexamethasone. These findings suggest that c-Fos may have a protective action that is eliminated by proteasome-mediated degradation and preserved by Bcl-2. thapsigargin dexamethasone N-acetyl-leucyl-leucyl-norleucinal N-acetyl-leucyl-leucyl-methional 3-(3-cholamidopropyl)dimethylammonio-1-propanesulfonic acid N-acetyl-Asp-Glu-Val-Asp-7-amino- 4-methylcoumarin. Apoptosis, or programmed cell death, is a genetically regulated process necessary for maintenance of normal tissue homeostasis (1Steller H. Science. 1995; 267: 1445-1449Crossref PubMed Scopus (2425) Google Scholar). In the nematode, Caenorhabditis elegans, apoptosis is regulated by the death effector gene, ced-3, and the death inhibitor gene, ced-9 (2Hengartner M.O. Ellis R.E. Horvitz H.R. Nature. 1992; 356: 494-499Crossref PubMed Scopus (712) Google Scholar, 3Yuan J. Shaham S. Ledoux S. Ellis H.M. Horvitz H.R. Cell. 1993; 75: 641-652Abstract Full Text PDF PubMed Scopus (2239) Google Scholar). The mammalian homologues of ced-3 constitute a family of genes encoding aspartate-specific cysteine proteases, or caspases, that cleave selected proteins, thereby contributing to cell death (reviewed in Ref.4Fraser A. Evan G. Cell. 1996; 85: 781-784Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar). The mammalian homologues of ced-9 constitute thebcl-2 family of genes encoding proteins that either enhance (e.g. Bax) or inhibit apoptosis (e.g. Bcl-2, Bcl-XL) by an unknown mechanism (5Cory S. Annu. Rev. Immunol. 1995; 13: 513-543Crossref PubMed Scopus (398) Google Scholar, 6Yang E. Korsmeyer S.J. Blood. 1996; 88: 386-401Crossref PubMed Google Scholar, 7Reed J.C. Nature. 1997; 387: 773-776Crossref PubMed Scopus (1386) Google Scholar). Bcl-2 and Bcl-XL, the best characterized members of the family, function upstream of caspase activation, inhibiting apoptosis induction by diverse death signals, including radiation, growth factor withdrawal, disruption of calcium homeostasis, and glucocorticosteroids (8Chinnaiyan A.M. Orth K. O'Rourke K. Duan H. Poirier G.G. Dixit V.M. J. Biol. Chem. 1996; 271: 4573-4576Abstract Full Text Full Text PDF PubMed Scopus (598) Google Scholar, 9Jacobson M.D. Weil M. Raff M.C. J. Cell Biol. 1996; 133: 1041-1051Crossref PubMed Scopus (365) Google Scholar, 10Shimizu S. Eguchi Y. Kamiike W. Matsuda H. Tsujimoto Y. Oncogene. 1996; 12: 2251-2257PubMed Google Scholar). Apoptosis also involves the proteasome, a multicatalytic protease complex located in both cytoplasm and nucleus that degrades proteins targeted for destruction by polyubiquitination (11Goldberg A.L. Rock K.L. Nature. 1992; 357: 375-379Crossref PubMed Scopus (503) Google Scholar, 12Rechsteiner M. Hoffman L. Dubiel W. J. Biol. Chem. 1993; 268: 6065-6068Abstract Full Text PDF PubMed Google Scholar, 13Ciechanover A. Cell. 1994; 79: 13-21Abstract Full Text PDF PubMed Scopus (1591) Google Scholar). In the hawkmoth, Manduca sexta, apoptosis of intersegmental muscles is associated with elevated ubiquitin gene expression and proteasome activity (14Schwartz L.M. Myer A. Kosz L. Engelstein M. Maier C. Neuron. 1990; 5: 411-419Abstract Full Text PDF PubMed Scopus (184) Google Scholar, 15Jones M.E.E. Haire M.F. Kloetzel P.M. Mykles D.L. Schwartz L.M. Dev. Biol. 1995; 169: 436-447Crossref PubMed Scopus (81) Google Scholar, 16Dawson S.P. Arnold J.E. Mayer N.J. Reynolds S.E. Billett M.A. Gordon C. Colleaux L. Kloetzel P.M. Tanaka K. Mayer R.J. J. Biol. Chem. 1995; 270: 1850-1858Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). In mammalian cells, apoptosis can be repressed by antisense oligonucleotides that diminish the level of ubiquitinated nuclear proteins or by specific inhibitors of the proteasome (17Delic J. Morange M. Magdelenat H. Mol. Cell. Biol. 1993; 13: 4875-4883Crossref PubMed Google Scholar, 18Grimm L.M. Goldberg A.L. Poirier G.G. Schwartz L.M. Osborne B.A. EMBO J. 1996; 15: 3835-3844Crossref PubMed Scopus (300) Google Scholar, 19Sadooul R. Fernandez P.-A. Quiquerez A.-L. Martinou I. Maki M. Schroter M. Becherer J.D. Irmler M. Tschopp J. Martinou J.-C. EMBO J. 1996; 15: 3845-3852Crossref PubMed Scopus (253) Google Scholar). Recently, proteasome-mediated degradation of topoisomerase IIα and IκBβ have been linked to adenovirus E1A-induced apoptosis and activation-induced T cell death, respectively (20Nakajima T. Morita K. Ohi N. Arai T. Nozaki N. Kikuchi A. Osaka F. Yamao F. Oda K. J. Biol. Chem. 1996; 271: 24842-24849Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 21Cui H. Matsui K. Omura S. Schauer S.L. Matulka R.A. Sonenshein G.E. Ju S.-T. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7515-7520Crossref PubMed Scopus (76) Google Scholar). The proteasome is responsible for the rapid turnover of key regulatory proteins, including the transcription factor c-Fos (22Stancovski I. Gonen H. Orian A. Schwartz A.L. Ciechanover A. Mol. Cell. Biol. 1995; 15: 7106-7116Crossref PubMed Scopus (158) Google Scholar, 23Tsurumi C. Ishida N. Tamura T. Kakizuka A. Nishida E. Okumura E. Kishimoto T. Inagaki M. Okazaki K. Sagata N. Ichihara A. Tanaka K. Mol. Cell. Biol. 1995; 15: 5682-5687Crossref PubMed Scopus (127) Google Scholar). c-Fos, the product of the c-fos proto-oncogene, is a major component of the activator protein-1 transcription factor complex, a master switch that regulates expression of genes involved in cell growth, differentiation, and transformation (24Miller A.D. Curran T. Verma I.M. Cell. 1984; 36: 51-60Abstract Full Text PDF PubMed Scopus (430) Google Scholar, 25Meijlink F. Curran T. Miller A.D. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4987-4991Crossref PubMed Scopus (150) Google Scholar, 26Schonthal A. Herrlich P. Rahmsdorf H.J. Ponta H. Cell. 1988; 54: 325-334Abstract Full Text PDF PubMed Scopus (424) Google Scholar, 27Curran T. Vogt P.K. McKnight S.L. Yamamoto K.R. Transcriptional Regulation. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1992: 797-831Google Scholar, 28Grigoriadis A.E. Schellander K. Wang Z.-Q. Wagner E.F. J. Cell Biol. 1993; 122: 685-701Crossref PubMed Scopus (283) Google Scholar, 29Miao G. Curran T. Mol. Cell. Biol. 1994; 14: 4295-4310Crossref PubMed Scopus (94) Google Scholar, 30Hennigan R.F. Hawker K.L. Ozanne B.W. Oncogene. 1994; 9: 3591-3600PubMed Google Scholar). We have investigated the involvement of c-Fos in apoptosis in the murine cell line WEHI7.2, a tissue culture model of glucocorticoid-induced apoptosis in immature thymocytes (31Flomerfelt R.A. Miesfeld R.L. J. Cell Biol. 1994; 127: 1729-1742Crossref PubMed Scopus (25) Google Scholar). WEHI7.2 cells do not express detectable levels of Bcl-2 and undergo apoptosis in response to thapsigargin (TG),1 a selective inhibitor of the endoplasmic reticulum-associated calcium-ATPase, and dexamethasone (DX), a synthetic glucocorticosteroid hormone (32Lam M. Dubyak G. Chen L. Nuñez G. Miesfeld R.L. Distelhorst C.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6569-6573Crossref PubMed Scopus (609) Google Scholar). Here we report that (i) both TG and DX induce rapid degradation of c-Fos by the proteasome, (ii) proteasome-mediated c-Fos degradation precedes caspase activation and apoptotic nuclear chromatin condensation, (iii) Bcl-2 overexpression inhibits c-Fos degradation by the proteasome and increases the level of c-Fos expression, and (iv) a C-terminal truncated version of c-Fos that evades degradation by the proteasome inhibits apoptosis induction by TG and DX. The anti-c-Fos antibody was purchased from Upstate Biotechnology Inc. The anti-CPP32 p17 subunit antibody (SK398) was raised to amino acids 85–94 of caspase-3 (VRNKNDLTRE) and provided by Kristy Kikly (SmithKline Beecham Pharmaceuticals). MG132 (Z-Leu-Leu-Leu-H aldehyde) was purchased from Peptides International, Inc. Lactacystin was purchased from E. J. Corey (Harvard University). N-Acetyl-leucyl-leucyl-norleucinal (ALLN) and N-acetyl-leucyl-leucyl-methional (ALLM) were purchased from Boehringer Mannheim. Benzyloxycarbonyl-Val-Ala-Asp(O-methyl)-fluoromethylketone was purchased from Enzyme Systems Products. E64d ((2s,3s)-trans-epoxy succinyl-l-leucylamido-3-methylL-butaneethyl-estero) was purchased from Sigma. Stock solutions of these reagents were prepared in dimethyl sulfoxide and stored in aliquots at −80 °C, except for lactacystin, which was dissolved in water. DX was purchased from Sigma, and TG was purchased from LC Laboratories. Cells were cultured in Dulbecco's modified Eagle's medium (BioWhittaker) supplemented with 2 mm glutamine, 50 units/ml penicillin, 50 μg/ml streptomycin, 0.4 mm nonessential amino acids, and 10% (v/v) heat-inactivated horse serum (Hyclone) at 37 °C in a 7% CO2 atmosphere. l-Glutamine, antibiotics, and nonessential amino acids were from Life Technologies, Inc. TG was added to cells from a stock solution in Me2SO to give a final concentration of 100 nm. DX was added to cells from a stock solution in ethanol to give a final concentration of 1 μm. Viable cells, defined as cells that exclude trypan blue dye, were counted using a hemocytometer. The percentage of cells with an apoptotic nuclear morphology was assessed by fluorescence microscopy after staining with eithidium bromide and acridine orange (33Distelhorst C.W. McCormick T.S. Cell Calcium. 1996; 19: 473-483Crossref PubMed Scopus (52) Google Scholar). The c-fos cDNA was removed from the pEMSV-fos plasmid (provided by Michael Simonson, Case Western Reserve University) by digestion withEcoRI and ligated in sense orientation into the pcDNA-3 expression vector (Invitrogen) downstream of the cytomegalovirus promotor, producing a pcDNA-3-sense-fos vector. The orientation of inserts was confirmed by analysis with four groups of restriction enzymes. The c-fosΔC cDNA was cloned by polymerase chain reaction using the 5′ primer sequence AAAGGGGAATTCATGTACCCATACGACGTCCCAGACTACGCTATGTTCTCGGGTTTCAACGCGGAC and the 3′ primer sequence ACAGTGGAATTCTTATTATTTCGGTGGGCAGCTGCGCAGCTA. The c-fosΔC cDNA was cloned into the pcDNA-3 expression vector in the sense orientation, confirmed by DNA sequencing. The empty pcDNA-3 vector and the pcDNA-3-fosΔC vectors were transfected into WEHI7.2 cells by electroporation and selected with G418 (1 mg/ml). Findings were confirmed in experiments in which the c-fos cDNA was cloned in sense orientation in the pSFFV-neo expression vector. To recover c-Fos, cells were washed twice with cold phosphate-buffered saline, resuspended in a 5-fold volume of modified RIPA buffer (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% Triton X-100, 0.1% SDS, 1 mm 1 mm mm mm 1 mm 1 1 and for To recover cells were in a buffer pH 7.4, 2 mm 0.1% 1 mm 1 and 1 The cell were at for The concentration of was by the of was by and and to of was confirmed by staining with or staining with after were in in mm Tris-HCl, pH mm NaCl, 0.1% at for 2 and with the at or at at °C were for 1 at with Technologies, at a were with the Western to the by to Cells were in of buffer mm 10% 0.1% 1 mm 100 100 1 mm at pH by a was by was removed by and the was stored at of the was by the to the of and 50 Laboratory, were in a volume of in 100 mm 10% 0.1% pH for an at 37 were with buffer to a final volume of 1 of fluorescence by of were to the of were the of the serum (50 as Cells were with inhibitors for in the at the lactacystin, 50 50 50 μm. The level of c-Fos was by Western in WEHI7.2 cells, which Bcl-2, and in which were from WEHI7.2 cells and express a level of Bcl-2 (32Lam M. Dubyak G. Chen L. Nuñez G. Miesfeld R.L. Distelhorst C.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6569-6573Crossref PubMed Scopus (609) Google Scholar). Findings were confirmed in experiments using vector and that a level of Bcl-2, The level of c-Fos, with either TG or was in cells in WEHI7.2 cells 1 100 TG to WEHI7.2 cells, the level of c-Fos to a 1 which in experiments was degraded to In the level of c-Fos was TG in cells 1 in c-Fos level was also induced when WEHI7.2 cells were with 1 the of the was in cells, to the of cell death 2 In c-Fos was when cells were with DX 2 In the of both and WEHI7.2 cells, the in c-Fos preceded caspase-3 and activation, both by of a p17 caspase-3 activation 1 and 2 and by of a synthetic 1 and 2 the in c-Fos preceded apoptotic nuclear chromatin condensation by fluorescence microscopy 1 and 2 with Bcl-2 inhibited both caspase-3 activation and and and and nuclear chromatin condensation 1 and 2 both TG and DX induced a in the level of c-Fos, the of apoptosis and inhibited by of c-Fos in Western of c-Fos in from cell were prepared from WEHI7.2 cells and cells at after 1 DX and Western analysis was with anti-c-Fos Western of caspase-3 activation in from cells with DX. cell were prepared from WEHI7.2 cells and cells at after 1 DX and Western analysis was with an antibody that the activation of caspase-3 not the of the synthetic were prepared from WEHI7.2 cells and cells at after 1 DX. The the S.E. of of for apoptosis in WEHI7.2 cells and cells were with acridine orange and bromide at after 1 DX. The percentage of cells apoptotic nuclear chromatin condensation is as the S.E. of To that the in c-Fos induced by TG was to degradation and to the responsible WEHI7.2 cells were with protease inhibitors TG The in c-Fos and the of the c-Fos were inhibited by cells with the specific proteasome and MG132 Goldberg A.L. T. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar, G. R.F. S. Corey S.L. Science. 1995; 268: PubMed Scopus Google and also by the specific proteasome inhibitor, K.L. C. L. K. R. L. Goldberg A.L. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar). also activity for the cysteine protease K.L. C. L. K. R. L. Goldberg A.L. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar). c-Fos is to degradation by S. M. P. M. T. M. Oncogene. 9: is that a c-Fos degradation was not by the and E64d K.L. C. L. K. R. L. Goldberg A.L. Cell. 1994; Full Text PDF PubMed Scopus Google with a cell inhibitor of the caspase family of cysteine H. 1995; PubMed Scopus Google not inhibit c-Fos degradation that proteasome-mediated degradation of c-Fos is not to caspase The in c-Fos in WEHI7.2 cells was also to proteasome-mediated that c-Fos was by with the proteasome inhibitors lactacystin, and and not by E64d In WEHI7.2 cells, with proteasome inhibitors degradation as as c-Fos Also, were in cells in the of proteasome inhibitors The of both degradation and in the of proteasome inhibitors been in the of proteasome proteins Omura S. Cell. 1995; Full Text PDF PubMed Scopus Google Scholar, L. M. H.J. Cell. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). In of the findings a proteasome-mediated c-Fos degradation and apoptosis in WEHI7.2 cells, we to c-Fos degradation by the proteasome to apoptosis was not to with the of proteasome of WEHI7.2 cells with and MG132 apoptosis. and C. W. as an WEHI7.2 cells were transfected with either a cDNA encoding c-Fos or a cDNA encoding a truncated version of c-Fos, C-terminal amino was that of the C-terminal sequence c-Fos by proteasome-mediated degradation C. Ishida N. Tamura T. Kakizuka A. Nishida E. Okumura E. Kishimoto T. Inagaki M. Okazaki K. Sagata N. Ichihara A. Tanaka K. Mol. Cell. Biol. 1995; 15: 5682-5687Crossref PubMed Scopus (127) Google Scholar). c-Fos was degraded TG when at levels the level and not apoptosis In was for after TG or DX In both expression inhibited the induction of both caspase-3 activation and and apoptotic nuclear chromatin condensation and The protective of is not associated with in the level of expression of Bcl-2 not In a mutant form of c-Fos that evades degradation by the proteasome inhibits apoptosis induction by both TG and DX. that inhibiting the degradation of c-Fos that degradation of c-Fos to the of apoptotic cell death in WEHI7.2 of apoptosis by a mutant of Western of the C-terminal mutant of c-Fos, in from WEHI7.2 cells were transfected with either empty vector or a vector encoding and were selected for to cell were prepared at after 1 DX. Western analysis was with anti-c-Fos Western analysis of caspase-3 activation in from WEHI7.2 cells transfected with vector encoding either or Cells were with 1 DX. Western analysis was with an antibody that the activation of caspase-3 not the of for apoptosis in and were with acridine orange and bromide at after after 1 DX. The percentage of cells apoptotic nuclear chromatin condensation is as the S.E. of findings indicate for the that c-Fos degradation by the proteasome to the of the apoptotic death that c-Fos may and apoptosis that is by proteasome-mediated degradation and preserved either by a C-terminal truncated version of c-Fos that is not degraded by the proteasome or by Bcl-2, which inhibits c-Fos degradation by the The that c-Fos an action is with that c-Fos expression of genes that apoptosis M. M. P. Wagner E.F. EMBO J. 1995; 14: PubMed Scopus Google Scholar, S. H. 1997; Google Scholar, J. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Google and with that cells from c-fos to apoptosis induction S. H. 1997; Google Scholar). that c-fos may be a of a that increases in cells apoptosis R. R. Mol. 1988; PubMed Scopus Google Scholar, F. N. M. A. J. Biol. Chem. 1992; 267: Full Text PDF PubMed Google Scholar, R.J. M. M. S.J. G.G. K. L.M. Curran T. Nature. 1993; PubMed Scopus Google and overexpression of a apoptosis in cells Y. J.E. G. L. J.C. Mol. Cell. Biol. 1996; PubMed Scopus Google Scholar). findings in mouse indicate that is not for apoptosis S. E. J. D.L. M. 1996; 122: PubMed Google Scholar). the findings indicate that apoptosis is in the c-fos mouse F. A. K. Wang Z.-Q. Wagner E.F. A. 1997; PubMed Scopus Google Scholar). as by is is to a for c-Fos in the cell death process or a of c-Fos the expression of genes for apoptosis. The findings of the suggest that the induction of c-fos transcription in cells apoptosis may be a response that is by proteasome-mediated degradation of c-Fos to be the in cells TG M. Distelhorst C.W. Oncogene. 1997; 15: PubMed Scopus Google c-Fos is degraded by the proteasome, an c-Fos The that both TG and DX induce c-Fos degradation that apoptotic with diverse of action c-Fos for degradation by the is that proteasome-mediated degradation of c-Fos may for the in activator protein-1 activity associated with apoptosis in thymocytes C. Rahmsdorf H.J. S. Ponta H. Herrlich P. Cell. 1990; Full Text PDF PubMed Scopus Google Scholar, Curran T. Mol. Cell. Biol. 1993; 13: PubMed Scopus Google Scholar, A. N. C. M. EMBO J. 1995; 14: PubMed Scopus Google Scholar). degradation of c-Fos been in cell death, the of the proteasome in c-Fos degradation in not been A. E. A. H. T. M. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar). The mechanism by which apoptotic c-Fos for degradation by the proteasome is proteins for degradation by the proteasome (11Goldberg A.L. Rock K.L. Nature. 1992; 357: 375-379Crossref PubMed Scopus (503) Google Scholar, 12Rechsteiner M. Hoffman L. Dubiel W. J. Biol. Chem. 1993; 268: 6065-6068Abstract Full Text PDF PubMed Google Scholar, 13Ciechanover A. Cell. 1994; 79: 13-21Abstract Full Text PDF PubMed Scopus (1591) Google Scholar). of c-Fos been both in and in (22Stancovski I. Gonen H. Orian A. Schwartz A.L. Ciechanover A. Mol. Cell. Biol. 1995; 15: 7106-7116Crossref PubMed Scopus (158) Google Scholar, 23Tsurumi C. Ishida N. Tamura T. Kakizuka A. Nishida E. Okumura E. Kishimoto T. Inagaki M. Okazaki K. Sagata N. Ichihara A. Tanaka K. Mol. Cell. Biol. 1995; 15: 5682-5687Crossref PubMed Scopus (127) Google Curran T. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar). In experiments not c-Fos from WEHI7.2 cells were for of by Western using an c-Fos was at levels in cell from and WEHI7.2 cells and or not Bcl-2 was at for these TG may have the of c-Fos, rapid degradation of the ubiquitinated c-Fos may have in is that c-Fos may be degraded by the proteasome of I. C. M. C. M. Mol. Biol. 1997; PubMed Google TG may have induced degradation of c-Fos by the may calcium either by the of calcium or by calcium from is in the of calcium in and as as apoptosis (32Lam M. Dubyak G. Chen L. Nuñez G. Miesfeld R.L. Distelhorst C.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6569-6573Crossref PubMed Scopus (609) Google Scholar, A. E. A. H. T. M. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar, Miesfeld R.L. Mol. 1992; PubMed Scopus Google Scholar, M. Dubyak G. Distelhorst C.W. Mol. 1993; PubMed Scopus Google Scholar, G. Science. 1996; PubMed Scopus Google Scholar). or that in the of c-Fos, thereby c-Fos for destruction by the calcium may the proteasome, a that is that calcium of the proteasome from the proteasome H. H. Dev. Biol. 1994; PubMed Scopus Google Scholar, H. H. Tanaka K. H. 1996; PubMed Scopus Google and regulates proteasome activity in C. M. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). c-Fos a an that c-Fos to be c-Fos expression to transformation (24Miller A.D. Curran T. Verma I.M. Cell. 1984; 36: 51-60Abstract Full Text PDF PubMed Scopus (430) Google Scholar, 25Meijlink F. Curran T. Miller A.D. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4987-4991Crossref PubMed Scopus (150) Google A.E. Schellander K. Wang Z.-Q. Wagner E.F. J. Cell Biol. 1993; 122: 685-701Crossref PubMed Scopus (283) Google Scholar, 29Miao G. Curran T. Mol. Cell. Biol. 1994; 14: 4295-4310Crossref PubMed Scopus (94) Google Scholar, K. Sagata N. EMBO J. 1995; 14: PubMed Scopus Google Scholar, Curran T. J. Oncogene. 1996; 12: Google and is associated with expression of genes involved in and A. Herrlich P. Rahmsdorf H.J. Ponta H. Cell. 1988; 54: 325-334Abstract Full Text PDF PubMed Scopus (424) Google Scholar, 29Miao G. Curran T. Mol. Cell. Biol. 1994; 14: 4295-4310Crossref PubMed Scopus (94) Google Scholar, 30Hennigan R.F. Hawker K.L. Ozanne B.W. Oncogene. 1994; 9: 3591-3600PubMed Google Scholar). In the we that Bcl-2 c-Fos proteasome-mediated degradation and that cells Bcl-2 have a level of c-Fos the to be in that by inhibiting proteasome-mediated c-Fos Bcl-2 may to transformation and We Michael for and Kristy Kikly for to and for and to We also Distelhorst for