Key points are not available for this paper at this time.
An abundant integral membrane protein, Hmp35, has been isolated from hydrogenosomes of Trichomonas vaginalis. This protein has no known homologue and exists as a stable 300-kDa complex, termed HMP35, in membranes of the hydrogenosome. By using blue native gel electrophoresis, we found the HMP35 complex to be stable in 2 m NaCl and up to 5 m urea. The endogenous Hmp35 protein was largely protease-resistant. The protein has a predominantly β-sheet structure and predicted transmembrane domains that may form a pore. Interestingly, the protein has a high number of cysteine residues, some of which are arranged in motifs that resemble the RING finger, suggesting that they could be coordinating zinc or another divalent cation. Our data show that Hmp35 forms one intramolecular but no intermolecular disulfide bonds. We have isolated the HMP35 complex by expressing a His-tagged Hmp35 protein in vivo followed by purification with nickel-agarose beads. The purified 300-kDa complex consists of mostly Hmp35 with lesser amounts of 12-, 25–27-, and 32-kDa proteins. The stoichiometry of proteins in the complex indicates that Hmp35 exists as an oligomer. Hmp35 can be targeted heterologously into yeast mitochondria, despite the lack of homology with any yeast protein, demonstrating the compatibility of mitochondrial and hydrogenosomal protein translocation machineries. An abundant integral membrane protein, Hmp35, has been isolated from hydrogenosomes of Trichomonas vaginalis. This protein has no known homologue and exists as a stable 300-kDa complex, termed HMP35, in membranes of the hydrogenosome. By using blue native gel electrophoresis, we found the HMP35 complex to be stable in 2 m NaCl and up to 5 m urea. The endogenous Hmp35 protein was largely protease-resistant. The protein has a predominantly β-sheet structure and predicted transmembrane domains that may form a pore. Interestingly, the protein has a high number of cysteine residues, some of which are arranged in motifs that resemble the RING finger, suggesting that they could be coordinating zinc or another divalent cation. Our data show that Hmp35 forms one intramolecular but no intermolecular disulfide bonds. We have isolated the HMP35 complex by expressing a His-tagged Hmp35 protein in vivo followed by purification with nickel-agarose beads. The purified 300-kDa complex consists of mostly Hmp35 with lesser amounts of 12-, 25–27-, and 32-kDa proteins. The stoichiometry of proteins in the complex indicates that Hmp35 exists as an oligomer. Hmp35 can be targeted heterologously into yeast mitochondria, despite the lack of homology with any yeast protein, demonstrating the compatibility of mitochondrial and hydrogenosomal protein translocation machineries. Trichomonas vaginalis is a deep-branching protist that lacks archetypal eukaryotic "aerobic" organelles, specifically mitochondria and peroxisomes. This microaerophilic human-infective parasite carries out fermentative carbohydrate metabolism within hydrogenosomes. Hydrogenosomes are bounded by double membranes and produce ATP by substrate level phosphorylation (1Muller M. J. Gen. Microbiol. 1993; 139: 2879-2889Crossref PubMed Scopus (336) Google Scholar). Hydrogenosomes are also found in certain chytrids, ciliates, and fungi, in lineages that are phylogenetically distant to the Parabasalian lineage to which trichomonads belong (1Muller M. J. Gen. Microbiol. 1993; 139: 2879-2889Crossref PubMed Scopus (336) Google Scholar, 2Fenchel T. Finlay B.J. Ecology and Evolution in Anoxic Worlds. Oxford University Press, Oxford, UK1995Google Scholar, 3Martin W. Müller M. Nature. 1998; 392: 37-41Crossref PubMed Scopus (881) Google Scholar, 4Biagini G.A. Finlay B.J. Lloyd D. FEMS Microbiol. Lett. 1997; 155: 133-140Crossref PubMed Google Scholar). Currently, several lines of evidence support a common endosymbiotic ancestry for hydrogenosomes and mitochondria, despite their distinct metabolic pathways (3Martin W. Müller M. Nature. 1998; 392: 37-41Crossref PubMed Scopus (881) Google Scholar, 5Dyall S.D. Johnson P.J. Curr. Opin. Microbiol. 2000; 3: 404-411Crossref PubMed Scopus (107) Google Scholar, 6Embley T.M. Van Der Giezen M. Horner D.S. Dyal P.L. Foster P. Philos. Trans. R. Soc. Lond-Biol. Sci. 2003; 358: 191-203Crossref PubMed Scopus (114) Google Scholar). Although the origin of hydrogenosomes within ciliate and fungi lineages is debated, these lineages branch with mitochondria-containing groups and the hydrogenosomes confined therein exhibit strong similarity to ciliate and fungal mitochondria (7Akhmanova A. Voncken F. van Alen T. van Hoek A. Boxma B. Vogels G. Veenhuiss M. Hackstein J.H.P. Nature. 1998; 396: 527-528Crossref PubMed Scopus (159) Google Scholar, 8van der Giezen M. Slotboom D.J. Horner D.S. Dyal P.L. Harding M. Xue G.P. Embley T.M. Kunji E.R. EMBO J. 2002; 21: 572-579Crossref PubMed Scopus (78) Google Scholar). Trichomonad hydrogenosomes, on the other hand, are markedly less similar to mitochondria. These organelles lack a genome (9Clemens D.L. Johnson P.J. Mol. Biochem. Parasitol. 2000; 106: 307-313Crossref PubMed Scopus (46) Google Scholar) which would have provided a means to investigate their endosymbiotic origin as has been elegantly and convincingly done for mitochondria (10Gray M.W. Burger G. Lang B.F. Science. 1999; 283: 1476-1481Crossref PubMed Scopus (1332) Google Scholar). In lieu of this, we and others have attempted to define the relationship between trichomonad hydrogenosomes and mitochondria by examining the origin of their chaperonins, metabolic enzymes, and membrane proteins. Chaperonin genes, specifically heat shock protein (Hsp) 1The abbreviations used are: Hsp, heat shock protein; MOPS, 4-morpholinepropanesulfonic acid; Tricine, N-2-hydroxy-1,1-bis(hydroxymethyl)ethylglycine; TLCK, N α-p-tosyl-l-lysine chloromethyl ketone; DTT, dithiothreitol; TCEP, Tris2-carboxyethyl phosphine hydrochloride; AMS, 4-acetamide-4-maleimidylstilbene-2,2-disulfonic acid; PMSF, phenylmethylsulfonyl fluoride; BN-PAGE, blue native polyacrylamide gel electrophoresis; IMS, intermembrane space.1The abbreviations used are: Hsp, heat shock protein; MOPS, 4-morpholinepropanesulfonic acid; Tricine, N-2-hydroxy-1,1-bis(hydroxymethyl)ethylglycine; TLCK, N α-p-tosyl-l-lysine chloromethyl ketone; DTT, dithiothreitol; TCEP, Tris2-carboxyethyl phosphine hydrochloride; AMS, 4-acetamide-4-maleimidylstilbene-2,2-disulfonic acid; PMSF, phenylmethylsulfonyl fluoride; BN-PAGE, blue native polyacrylamide gel electrophoresis; IMS, intermembrane space. 70, cpn60, and Hsp10 (11Bui E.T.N. Bradley P.J. Johnson P.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9651-9656Crossref PubMed Scopus (227) Google Scholar, 12Germot A. Philippe H. Le Guyader H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14614-14617Crossref PubMed Scopus (162) Google Scholar, 13Horner D.S. Hirt R.P. Kilvington S. Lloyd D. Embley T.M. Philos. Trans. R. Soc. Lond-Biol. Sci. 1996; 263: 1053-1059Google Scholar, 14Roger A.J. Clark C.G. Doolittle W.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14618-14622Crossref PubMed Scopus (136) Google Scholar), and the IscS enzyme, involved in FeS cluster formation (15Tachezy J. Sanchez L.B. Muller M. Mol. Biol. Evol. 2001; 18: 1919-1928Crossref PubMed Scopus (139) Google Scholar) appear to have a mitochondrial origin. However, analyses of metabolic enzymes such as hydrogenase (16Bui E.T. Johnson P.J. Mol. Biochem. Parasitol. 1996; 76: 305-310Crossref PubMed Scopus (85) Google Scholar, 17Horner D.S. Heil B. Happe T. Embley T.M. Trends Biochem. Sci. 2002; 27: 148-153Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar), which is typically found in anaerobic bacteria, present a far more ambiguous picture. Phylogenetic analyses of another metabolic enzyme, pyruvate:ferredoxin oxidoreductase, revealed a clustering of all eukaryotic sequences known to date but failed to reveal a relationship to any particular eubacterial group (6Embley T.M. Van Der Giezen M. Horner D.S. Dyal P.L. Foster P. Philos. Trans. R. Soc. Lond-Biol. Sci. 2003; 358: 191-203Crossref PubMed Scopus (114) Google Scholar). Only one trichomonad hydrogenosomal membrane protein, Hmp31, has been analyzed to date, and it was shown to be a distant homologue of the ADP/ATP carrier, a member of the mitochondrial carrier family (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar). We have continued to study hydrogenosomal membrane proteins to gain further information on the nature of the endosymbiont that gave rise to the trichomonad hydrogenosome, and to further examine the possibility that the same endosymbiont gave rise to both mitochondrion and trichomonad hydrogenosomes. Organellar membrane proteins may originate from pre-existing proteins from the endosymbiont that evolve to fulfill new functions in the emerging proto-organelle. For instance, the Toc75 protein pore translocase in chloroplasts has a homologue of unknown function in cyanobacteria that shows similar pore characteristics (19McFadden G.I. Curr. Opin. Plant Biol. 1999; 2: 513-519Crossref PubMed Scopus (117) Google Scholar). Alternatively, "new" protein families may have emerged such as the mitochondrial carrier family proteins that translocate ATP and various solutes across the organellar membrane in mitochondria (20Kuan J. Saier Jr., M.H. Crit. Rev. Biochem. Mol. Biol. 1993; 28: 209-233Crossref PubMed Scopus (153) Google Scholar). Likewise, most of the protein translocases in mitochondria have no distinguishable homologues in prokaryotes and appear to have evolved with organelles (21Herrmann J.M. Trends Microbiol. 2003; 11: 74-79Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Here we describe a novel hydrogenosomal membrane protein, Hmp35, that has no known homologue in prokaryotes or eukaryotes to date. It is a relatively abundant membrane protein that exists as an integral membrane complex. The exceptional stability of the complex under stringent salt, urea, and protease treatment is similar to that of bacterial and organellar outer membrane protein pores. Although it has no primary sequence homology to those proteins, Hmp35 has a predominant predicted β-sheet structure similar to that found in the outer membrane proteins of Gram-negative bacteria, mitochondria, and plastids (22Gabriel K. Buchanan S.K. Lithgow T. Trends Biochem. Sci. 2001; 26: 36-40Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Taken together, these data suggest a similar function for Hmp35. Finally, we demonstrate that despite the absence of a homologue in yeast or of a recognizable mitochondrial targeting sequence, the Hmp35 can be heterologously expressed in yeast and is targeted to yeast mitochondrial membranes in vivo. Organisms and Strains—T. vaginalis T1 (gift from J. F. Alderete) and C1 (ATCC 30001) strains were used where indicated in this study. Saccharomyces cerevisiae MB2-22 wild-type strain (23Maarse A.C. Blom J. Grivell L.A. Meijer M. EMBO J. 1992; 11: 3619-3628Crossref PubMed Scopus (138) Google Scholar) was used throughout in this study. Isolation of Hydrogenosomes and Subfractionation—Hydrogenosomes were isolated from T. vaginalis as described previously (24Bradley P.J. Lahti C.J. Plümper E. Johnson P.J. EMBO J. 1997; 16: 3484-3493Crossref PubMed Scopus (96) Google Scholar). Isolated hydrogenosomes were stored at –80 °C in freezing buffer (250 mm sucrose, 10 mm MOPS-KOH, 8% glycerol, 0.5% bovine serum albumin, 10 μg/ml leupeptin, 50 μg/ml N α-p-tosyl-l-lysine chloromethyl ketone (TLCK), pH 8). Hydrogenosomes were washed in 250 mm sucrose, 10 mm MOPS-KOH, pH 8 (SM) prior to any manipulation. Hydrogenosomes were subfractionated into integral membrane and soluble proteins by sodium carbonate extraction as described before (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar). Sequencing of MP40 Proteins—Hydrogenosomal membrane proteins were size-separated by 15% SDS-PAGE and stained with Coomassie Blue dye R-250, and a gel slice containing 5 μg of the 35–40-kDa proteins was excised, washed with 50% acetonitrile, and subjected to tryptic digest and peptide sequencing at the Harvard University Microchemistry Facility (Cambridge, MA). Generation of Antisera against Endogenous Membrane Proteins and Recombinant Hmp35—Polyclonal antisera against 35–40-kDa hydrogenosomal membrane proteins (MP40) were raised in rabbits by 4 injections of 100 μg each. Polyclonal rabbit anti-Hmp35 antisera were raised against purified recombinant His-tagged Hmp35 protein. Screening of cDNA Library with anti-MP40 Antisera—105 phage from a previously described (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar) T. vaginalis λZAP II unidirectional cDNA library were plated for induced expression screening as per manufacturer's instructions (Stratagene). Briefly, XL1-MRF′ bacteria infected with 105 phage were grown in top agar at 42 °C until plaques started appearing. Protein expression was induced by placing nitrocellulose membranes saturated with 10 mm isopropyl-1-thio-β-d-galactopyranoside on the plates and further incubating at 37 °C for 3 h. Duplicate membranes were applied for a further 5 h at 37 °C. Nitrocellulose membranes with induced proteins were screened with anti-MP40 antisera, and the bound antibodies were detected by 125I-labeled protein A. Positive phage were excised and sequenced to select those that matched the peptides obtained from sequencing endogenous MP40 proteins. A positive cDNA clone, CD40.31, with a 1.1-kb insert was selected for further analyses. Construction and Screening of an EcoRI T. vaginalis C1 Genomic Library—A genomic library was constructed in the λZAP II vector (Stratagene) from T. vaginalis C1 genomic DNA completely digested with EcoRI. The library was screened with a 640-bp EcoRI/HindIII probe from the cDNA clone CD40.31, yielding a positive clone, MP40.1, with a 2-kb EcoRI fragment bearing the complete hmp35 open reading frame. Plasmid Construction—A 969-bp fragment was generated by PCR from the genomic clone MP40.1 using the primers MP40F and MP40R (Table I) to introduce a 5′ BamHI and a 3′ SalI restriction enzyme site, respectively, for subsequent ligation into the vector pQE30 (Qiagen) to yield the expression construct pEP40.17 with an in-frame hexahistidine tag situated at the N terminus of the hmp35 open reading frame.Table IPrimers used in this studyPrimerSequenceMP40F5′-CGCGGATCCGAACCAAAGACATTCGAAACTGT-3′MP40R5′-ACGCGTCGACGTTCAACTCAACGAGGAATGAGT-3′MP40B5′-CGCGGATCCATGGAACCAAAGACATTCG-3′MP40S5′-ACGCGTCGACTTAGTTCAACTCAACGAGG-3′Nhmp35H5′-GTTCCATATGGAACCAAAGACATTCGAAAC-3′BAhmp35H5′-CGCGGATCCTTAGTGATGGTGATGGTGATGGGTACCGTTCAACTCAACGAGGAATG Open table in a new tab For construction of the yeast transformation plasmid pRS313-hmp35, the genomic DNA clone MP40.1 was amplified with the PCR primers MP40B and MP40S (Table I) to generate the open reading frame of hmp35 with a 5′ BamHI and a 3′ SalI site, respectively, to allow cloning into the pRS313 vector. For generation of the pHmp35H plasmid, we used the previously described (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar) plasmid construct pHmp31-(HA)2 which carries a neomycin phosphotransferase (neo) cassette that allows selection of transformants in T. vaginalis (25Delgadillo M.G. Liston D.R. Niazi K. Johnson P.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4716-4720Crossref PubMed Scopus (74) Google Scholar). The hmp35 open reading frame was amplified from the genomic clone MP40.1 using the forward primer Nhmp35H (Table I) to introduce an NdeI restriction site at the 5′ end of the PCR product and the reverse primer BAhmp35H (Table I) to introduce a hexahistidine codon at the 3′ end, followed by a BamHI restriction site. Following restriction digest with NdeI and BamHI, the purified PCR product was introduced into the corresponding sites in the restricted pHmp31-(HA)2 plasmid. Expression and Purification of His 6 -Hmp35—The pEP40.17 plasmid was transformed into E. coli M15 (pREP4) cells and selected with 100 μg/ml ampicillin, 30 μg/ml kanamycin in LB media. A 500-ml culture was grown at 37 °C to A 600 = 0.8 before induction with 1 mm isopropyl-1-thio-β-d-galactopyranoside for 4 h at 37 °C. Harvested cells were solubilized in 6 m guanidine hydrochloride, 1% Triton X-100, 0.1 m NaH2PO4, 10 mm Tris, pH 8, for 1 h at room temperature. The insoluble material was pelleted at 10,000 × g for 30 min at 4 °C, and the resulting lysate applied to a nickel-nitrilotriacetic acid-agarose column. The column was washed four times with 8 m urea, 0.1 m NaH2PO4, 20 mm imidazole, 10 mm Tris, pH 6.3. Specifically bound proteins were eluted with 8 m urea, 0.1 m NaH2PO4, 0.25 m imidazole, 10 mm Tris, pH 4.5, and neutralized. Modification of Cysteine Residues with AMS—200 μg of isolated hydrogenosomes were initially boiled for 5 min in SM, 50 mm NaCl, 0.5% SDS and cooled to 37 °C. Controls with His-tagged Hmp35 recombinant protein (3 μg per assay) were processed in parallel. Each sample was then incubated for 1 h at 37 °C with or without 5 mm EDTA or 10 mm Tris2-carboxyethyl phosphine hydrochloride (TCEP), or 5 mm H2O2, or a mixture of these reagents as indicated. All samples were precipitated with 10% trichloroacetic acid, resuspended in 100 μl of alkylating solution (100 mm iodoacetamide, 100 mm Tris, 100 mm Tris, 10 mm EDTA, pH 9.5), and incubated for 5 min at 37 °C. The reaction was stopped by trichloroacetic acid precipitation, and all samples were resuspended in 50 μl of 10 mm TCEP, 100 mm Tris, 0.5% SDS, 10 mm EDTA, pH 9.5, and incubated for 1 h at 44 °C. Some samples were further treated with 4-acetamide-4-maleimidylstilbene-2,2-disulfonic acid (AMS) at a final concentration of 25 mm, and all samples were incubated for 90 min at 25 °C. Finally, all samples were trichloroacetic acid-precipitated and resuspended in reducing Laemmli sample buffer for 12% SDS-PAGE separation and Western analysis. Blue Native Gel Electrophoresis of Organelles—Hydrogenosomes were solubilized at a protein concentration of 1 mg/ml for 30 min on ice in n-dodecyl maltoside or Triton X-100 at indicated concentrations in the presence of 20 mm MOPS, 0.2 m or 0.5 m NaCl, 1 mm MgCl2, 10% glycerol, 2 mm phenylmethylsulfonyl fluoride (PMSF), pH 8.0. Sodium carbonate-extracted hydrogenosomal membranes were solubilized at a protein concentration of 0.1 mg/ml for 30 min on ice in 0.5% n-dodecyl maltoside or 0.5% Triton X-100 in the presence of 20 mm MOPS, 0.5 m NaCl, 1 mm MgCl2, 10% glycerol, 2 mm PMSF, pH 8.0. Insoluble material was removed by centrifugation at 100,000 × g for 15 min at 4 °C. Denatured samples were generated by heating hydrogenosomes (1 mg/ml protein concentration) at 95 °C for 5 min in 0.5% SDS, 20 mm MOPS, 1 mm MgCl2, 10% glycerol, 2 mm PMSF, pH 8.0. The solubilized proteins were analyzed by blue native electrophoresis on a 6–16% linear polyacrylamide gradient (26Schagger H. Cramer W.A. von Jagow G. Anal. Biochem. 1994; 217: 220-230Crossref PubMed Scopus (1026) Google Scholar). Solubilization of mitochondria (2.5 mg/ml protein concentration) was in 0.5% as described previously Leuenberger D. E. Koehler C.M. J. Cell Biol. 2002; PubMed Scopus Google Scholar). of μg of were incubated in buffer for 30 min at 37 °C in the presence of 10 mm EDTA as indicated and treated with 0.25 mg/ml for 30 min at °C. The was with 2 mm phenylmethylsulfonyl fluoride for 10 min on were trichloroacetic acid-precipitated and resuspended in Laemmli sample buffer for A similar protease treatment was on hydrogenosomes initially solubilized at 1 mg/ml protein concentration in 1% Triton X-100, 0.1 m NaCl, 20 mm MOPS, 10% glycerol, mm MgCl2, pH and samples were processed for Sodium carbonate-extracted hydrogenosomal membranes were resuspended at 0.1 mg/ml protein concentration in and treated with 0.1 mg/ml or 0.25 mg/ml for 20 min on Following with 2 mm PMSF, the membranes were by centrifugation at 100,000 × g and resuspended in for trichloroacetic acid before in Laemmli sample buffer for of S. cerevisiae wild-type strain MB2-22 was transformed with the plasmid under the of the were used for and for transformation of yeast strains to and Press, Scholar). of T. vaginalis T1 cells were with 50 μg of pHmp35H as described previously (25Delgadillo M.G. Liston D.R. Niazi K. Johnson P.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4716-4720Crossref PubMed Scopus (74) Google Scholar), and transformants the plasmid were selected with μg/ml of T. vaginalis from of the transformants were in a and by centrifugation at × g into a and a organellar as described previously (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar). of and Isolation of from yeast cells and from the wild-type MB2-22 strain were grown in the presence of The cells were to by in m 20 mm pH with at a concentration of 3 and subjected to a to the an × g to a organellar was from the by the sample at 10,000 × For further purified mitochondria were obtained by the gradient L.A. PubMed Scopus Google Scholar). of μg of protein of mitochondria were used for of the mitochondria were treated with 0.1 mg/ml for 30 min at 4 °C. were at 250 μg/ml in 20 mm pH for 30 min at 4 °C to generate in the presence or absence of 0.1 mg/ml K. Following the protease or samples were treated with 2 mm for 10 min on ice to and at × g to the from the were trichloroacetic acid-precipitated and resuspended in of Laemmli sample were into integral membrane protein and soluble by for 30 min on ice at 250 μg/ml in 0.1 m pH followed by at 100,000 × were resuspended in of Laemmli sample and proteins were by 10% Isolation of the 6 from hydrogenosomes (1 of were resuspended in 0.5 of 20 mm MOPS, 1 m NaCl, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml and as described previously (24Bradley P.J. Lahti C.J. Plümper E. Johnson P.J. EMBO J. 1997; 16: 3484-3493Crossref PubMed Scopus (96) Google Scholar). The membrane was by centrifugation at × g for 20 min at 4 °C and solubilized for 30 min at 4 °C in 1 of solution A n-dodecyl 1 m NaCl, 20 mm MOPS, 10% glycerol, 1 mm MgCl2, 20 mm imidazole, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml leupeptin, pH Following a centrifugation at × the lysate was incubated with 100 μl of nickel-nitrilotriacetic acid for 1 h at 4 °C. The were washed times in 1 of solution n-dodecyl 1 m NaCl, 2 m urea, 20 mm MOPS, 10% glycerol, 1 mm MgCl2, 20 mm imidazole, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml leupeptin, pH and in 1 of solution n-dodecyl 0.5 m NaCl, 4 m urea, 20 mm MOPS, 10% glycerol, 1 mm MgCl2, 20 mm imidazole, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml leupeptin, pH The washed were into 2 one of which was eluted in 0.2 of solution n-dodecyl 0.2 m NaCl, 4 m urea, 20 mm MOPS, 10% glycerol, 1 mm MgCl2, 0.25 m imidazole, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml leupeptin, pH The was incubated for 30 min at room in 0.2 of solution n-dodecyl 0.2 m NaCl, 6 m urea, 20 mm MOPS, 10% glycerol, 1 mm MgCl2, 2 mm PMSF, 50 μg/ml TLCK, 10 μg/ml leupeptin, pH and the resulting was by The were into 2 that were subjected to blue native gel electrophoresis or trichloroacetic acid-precipitated and processed for separation by proteins were membranes for Western analysis. were detected with tag of bound primary antibodies was out by using antibodies raised against or rabbit followed by with the DNA and protein sequences were and analyzed using the Isolation and of Hmp35, a Membrane the of hydrogenosomal membrane proteins from T. we targeted a number of proteins in the 35–40-kDa that are of The MP40 proteins were on a and isolated on a to rabbit A positive cDNA clone, CD40.31, was isolated by screening an expression T. vaginalis cDNA of the peptide sequences obtained from the MP40 proteins matched in the sequence, that a one of the MP40 proteins been This was for hydrogenosomal membrane protein and analyses with the insert the hmp35 to be A probe from the clone was used to a T. vaginalis genomic DNA library to a clone, MP40.1, that the complete hmp35 The is by a double sequence of the of the predicted protein, which is within the for T. vaginalis D.R. Johnson P.J. Mol. Cell Biol. 1999; PubMed Scopus Google Scholar). The of the hmp35 a protein of of analyses of Hmp35. predicted acid sequence of Hmp35. The sequence of the hmp35 open reading frame is acid peptide sequence obtained from sequencing the endogenous Hmp35 protein are Cysteine are by an and by a and transmembrane of investigate the of the Hmp35 protein, we raised rabbit antibodies against purified recombinant His-tagged Hmp35. Western of sodium carbonate-extracted hydrogenosomes with these antibodies that the Hmp35 protein is found in the membrane and in the soluble that Hmp35 is present in the as an integral membrane protein 2 and The protein, with a of at an of on SDS-PAGE of the Hmp35 Protein acid of Hmp35 is shown in The predicted sequence of Hmp35 no homology to the that been found previously (18Dyall S.D. Koehler C.M. Delgadillo-Correa M.G. Bradley P.J. Plumper E. Leuenberger D. Turck C.W. Johnson P.J. Mol. Cell Biol. 2000; 20: 2488-2497Crossref PubMed Scopus (86) Google Scholar) in the other hydrogenosomal membrane protein The Hmp35 protein has an high of with a high of
Dyall et al. (Fri,) studied this question.