Desensitization of G-protein-coupled Receptors

Agonist-induced phosphorylation of G-protein-coupled receptors has been shown to facilitate the desensitization processes, such as receptor internalization, decreased efficiency of coupling to G-proteins, or decreased ligand affinity. The lowered affinity may be an intrinsic property of the phosphorylated receptor or it may be the result of altered interactions between the modified receptor and downstream components such as G-proteins or arrestins. To address this issue, we purified cAR1, the major chemoattractant receptor of Dictyostelium discoideum by a strategy that is independent of the ligand binding capacity of the receptor. To our knowledge, this represents the first successful purification of a chemoattractant receptor. The hexyl-histidine-tagged receptor was solubilized from a highly enriched plasma membrane preparation and purified by Ni2+-chelating chromatography. The protocol offers a simple way to purify 100–500 μg of a G-protein coupled receptor that can be targeted to the plasma membrane ofD. discoideum. The K d value for the purified cAR1 was about 200 nm, consistent with that of receptors that are not coupled to G-proteins in intact cells. In contrast, the affinity of phosphorylated cAR1, purified from desensitized cells, was about three times lower. Treatment of the phosphorylated receptor with protein phosphatases caused dephosphorylation and parallel restoration of higher affinity. We propose that ligand-induced phosphorylation of G-protein-coupled receptors causes a decrease in intrinsic affinity and may be useful in maintaining the receptor's sensitivity at high agonist levels. This affinity decrease may precede other processes such as receptor internalization or uncoupling from G-proteins. Agonist-induced phosphorylation of G-protein-coupled receptors has been shown to facilitate the desensitization processes, such as receptor internalization, decreased efficiency of coupling to G-proteins, or decreased ligand affinity. The lowered affinity may be an intrinsic property of the phosphorylated receptor or it may be the result of altered interactions between the modified receptor and downstream components such as G-proteins or arrestins. To address this issue, we purified cAR1, the major chemoattractant receptor of Dictyostelium discoideum by a strategy that is independent of the ligand binding capacity of the receptor. To our knowledge, this represents the first successful purification of a chemoattractant receptor. The hexyl-histidine-tagged receptor was solubilized from a highly enriched plasma membrane preparation and purified by Ni2+-chelating chromatography. The protocol offers a simple way to purify 100–500 μg of a G-protein coupled receptor that can be targeted to the plasma membrane ofD. discoideum. The K d value for the purified cAR1 was about 200 nm, consistent with that of receptors that are not coupled to G-proteins in intact cells. In contrast, the affinity of phosphorylated cAR1, purified from desensitized cells, was about three times lower. Treatment of the phosphorylated receptor with protein phosphatases caused dephosphorylation and parallel restoration of higher affinity. We propose that ligand-induced phosphorylation of G-protein-coupled receptors causes a decrease in intrinsic affinity and may be useful in maintaining the receptor's sensitivity at high agonist levels. This affinity decrease may precede other processes such as receptor internalization or uncoupling from G-proteins. G-protein-coupled receptors (GPCRs) 1The abbreviations used are: GPCR, G-protein-coupled receptor; cAR1-H6, hexyl-histidine-tagged wild-type cAR1; cm1234-H6, hexyl-histidine-tagged non-phosphorylatable cAR1; PAGE, polyacrylamide gel electrophoresis; GFP, green fluorescent protein; CHAPS, 3-(3-cholamidopropyl)dimethylammonio-1-propanesulfonic acid. are involved in a wide variety of important biological processes including vision, olfaction, chemotaxis, and immune response. It is remarkable that the receptors for such diverse stimuli all share the same topological feature of seven-membrane spanning segments. It is believed that these segments cluster to form the binding pocket. Upon agonist binding, the receptors undergo conformational changes, activating intracellularly coupled G-proteins, which proceed to interact with the downstream effectors (1Strader C. Fong T. Graziano M. Tota M. FASEB J. 1995; 9: 745-754Crossref PubMed Scopus (330) Google Scholar). Despite extensive pharmacological studies on certain representative GPCRs, detailed biochemical and biophysical characterization of most of these receptors is still lacking. With the exception of rhodopsin, the extreme difficulties in purifying most GPCRs have hindered studies of the structures and functions of these proteins. A physiologically important property of GPCRs is their tendency to desensitize during exposure to agonist. Desensitization mechanisms include “down-regulation” or reduction of receptor number, “sequestration” or apparent shielding of the receptors from interacting ligands, and “uncoupling” from G-proteins. Agonist-induced receptor phosphorylation, usually carried out by G-protein-coupled receptor kinases, may contribute to each of these processes. In the case of the β-adrenergic receptor and rhodopsin, the two most extensively characterized GPCRs, phosphorylation is proposed to promote the association of arrestins and subsequent uncoupling from G-proteins and internalization (2Hausdorff W.P. Caron M.G. Lefkowitz R.J. FASEB J. 1990; 4: 2881-2889Crossref PubMed Scopus (1087) Google Scholar, 3Lohse M.J. Benovic J.L. Codina J. Caron M.G. Lefkowitz R.J. Science. 1990; 248: 4962Crossref Scopus (909) Google Scholar, 4Benovic J.L. Pike L.J. Cerione R.A. Staniszewski C. Yoshimasa T. Codina J. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1985; 260: 7094-7101Abstract Full Text PDF PubMed Google Scholar). Desensitization may also be accompanied by a lowered affinity of the phosphorylated receptor as in the cases of cAR1, angiotensin II receptor, D2 dopamine receptor (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar, 6Boulay G. Chreiten L. Richard D.E. Guillemette G. Endocrinology. 1994; 135: 2130-2136Crossref PubMed Scopus (43) Google Scholar, 7Boundy V.A. Pacheo M.A. Guan W. Molinoff P.B. Mol. Pharmacol. 1995; 48: 956-964PubMed Google Scholar), and possibly the yeast phermone receptor (21Reneke J.E. Blumer K.J. Courchesne W.E. Thorner J. Cell. 1988; 55: 221-234Abstract Full Text PDF PubMed Scopus (239) Google Scholar). It has been speculated that the lowered affinity is due to receptor uncoupling from G-proteins and consequent coupling to arrestins, but recent evidence suggests that receptor-arrestin complexes also display high affinity (8Gurevich V.V. Pals-Rylaarsdam R. Benovic J.L. Hosey M.M. Onorato J.J. J. Biol. Chem. 1997; 272: 28849-28852Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar). It is possible that agonist-induced phosphorylation may lower the intrinsic affinity of the receptor. To investigate the intrinsic properties of a phosphorylated GPCR, we purified cAR1, the major chemoattractant receptor of the social amebae,Dictyostelium discoideum. cAR1 is coupled to the heterotrimeric G-protein G2, which transmits the activation signal downstream to mediate actin polymerization, chemotaxis, calcium uptake, cell-cell signaling, and differentiation (9Devreotes P.N. Neuron. 1994; 12: 235-241Abstract Full Text PDF PubMed Scopus (135) Google Scholar). We developed a purification protocol which, unlike previous GPCR purification schemes, does not rely on the ligand binding capacity of the receptor. In this procedure, a specialized plasma membrane subdomain highly enriched in receptor was isolated (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). After detergent extraction, the solubilized receptor was applied to a Ni2+ column and purified in a single step. Tens of micrograms of purified, active cAR1 are obtained from a liter of cell culture. The agonist affinity of the final purified receptor is similar to that of the binding sites on cells lacking G-proteins. To our knowledge, this represents the first successful attempt to purify a chemoattractant receptor to near homogeneity. In principle, this protocol can be extended to the purification of any GPCR that can be targeted to the plasma membrane ofD. discoideum cells. Using this purification procedure, we have found that the lower affinity displayed by phosphorylated receptors after agonist pretreatment in vivo is an intrinsic property of the modified proteins. When this phosphorylation was blocked by substituting serines 303 and 304, the major phosphorylation sites of cAR1, with alanine and glycine, the mutant receptor failed to display lowered affinity after similar agonist pretreatment (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar). Additionally, protein phosphatase treatment of the phosphorylated receptor led to its dephosphorylation and a corresponding enhanced ligand affinity. This suggests that receptor phosphorylation itself, independent of other interacting components or downstream processes, may directly contribute to the desensitization. C-terminal hexyl-histidine-tagged cAR1 constructs were created by polymerase chain reaction. The N-terminal primer, GCCGGAAGATCT TATTAAAAA ATGGGTCTTTTAGATGGAAATC, contains a BglII site (first underline) at the 5′ end, followed by the Dictyostelium consensus ribosomal binding site (italicized) and the N-terminal residues of cAR1 (second underline). The C-terminal primer, CGAGGCGTAGCTAGCTGGTGGATTATT TCCTTGACCATTTGTTGCA, contains the last six residues of cAR1 sequence (italicized), followed by two prolines (underlined) and a NheI site. Two constructs were made to create the hexyl-histidine-tagged wild-type cAR1 (abbreviated as cAR1-H6), the wild-type cDNA sequence of cAR1 was used as template. To create hexyl-histidine-tagged non-phosphorylatable form of cAR1 (abbreviated as cm1234-H6), a mutant cAR1 sequence in which all C-terminal serine and threonine residues were substituted (cm1234, Ref. 12Kim J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google was A modified a was created as the site was with a BglII site. After with BglII and a and NheI sites followed by a sequence and an and a site was with BglII and and the modified and BglII The sequence for the of the 5′ to is as The polymerase chain were and and sites of the The final the cAR1 followed by a and was by and a D. discoideum or by and an the sequence is downstream of the D. discoideum actin and the and The cAR1 were cells J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google Scholar). were and characterized by binding The the binding was are in a in J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google are the and by at 200 at to a of binding of intact cells in or in was carried out as J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google Scholar). for in of cells at were with of at for and at for to cells were in and was with was carried binding was obtained by was as (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). cells were and in (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). The cell was in to and at at for were and with were in to was at After the cells were on for and were to final were a and at for The was and to cell in the with and at was and solubilized in for with at at a cell of After at for the was and were at final of 200 and of this was first with of with to the After the was and a The was the column by about After the column with of 200 and the column was with 200 and to the This was found to be our result that receptor binding cAR1 was in of of and of column of The was as (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar). cells in were at 200 for with or to cAR1 the or desensitized The efficiency of this treatment was by the on and of the cAR1 on the gel by to a the phosphorylated to a The cells were and for cAR1 purification as detailed The major cAR1 of Ni2+ column were and characterized for binding PubMed Scopus Google Scholar). The binding 200 of and was to of the the between the two was as the binding, detergent was and was to the was after of as this was to be for in the of were used to the binding was to the binding and the of affinity and value of binding such as column and a also the of the receptor these were not for The to be the most We the of the by its was in the purified of receptor. from desensitized cells were in at a cell of of phosphatase was and dephosphorylation carried out at for that this treatment was to of The membrane was by and in for binding of evidence that the C-terminal not with the properties of the receptor. To any receptor caused by of phosphorylation, we used a hexyl-histidine-tagged cAR1 in which all serines and in the C-terminal were substituted After cells, that higher sites developed wild-type cells were shown in in most of the receptors displayed an affinity of d and in the of binding in to binding at has been shown to the receptors a single high affinity d obtained at in the binding of cells. the affinity about d are the same as for receptors D. R. Borleis J. Devreotes P.N. J. Biol. Chem. 1994; Full Text PDF PubMed Google Scholar). To the properties of the receptor, we the on and the properties of the cells. the D. discoideum cells a cells cells The cells in to cells. of of cells to form a The receptor are the cell receptors for the of and activating downstream cAR1 is the major during the of In its cells to shown in the cells as as the that the C-terminal does not with the functions of receptor. the cells We have shown that wild-type cAR1 is to a specialized plasma membrane (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). strategy was to as an purification a and to and purify the hexyl-histidine-tagged receptor by affinity column chromatography. We first that the receptor was also enriched in and its that displayed the same in as wild-type cAR1 not that the does not with the of receptor to the specialized plasma membrane The ligand binding of was characterized by that a single affinity form was with a K d of This value was to d of the receptor at the cell d nm, and that the agonist binding sites during the preparation cAR1 was solubilized and purified to near by on a Ni2+-chelating We have shown that can be by the detergent (9Devreotes P.N. Neuron. 1994; 12: 235-241Abstract Full Text PDF PubMed Scopus (135) Google Scholar). We the to a of cell and It is to out at this at higher to these of the receptor was The solubilized was with and to and the Ni2+ After extensive the receptor was with of and cAR1 from the column in two about at the at This between The purified receptor displayed two major to gel corresponding to a by and a form by The from the column at was enriched in the from the three of the purification were by followed by of protein between intact and final purified a that in from the column the of receptor was that the be enhanced by the not we the receptor binding We the binding of each column by were obtained from these between this and the previous cAR1 protein a between the of binding and receptor that the purified is for the that the purified receptor is still we characterized its affinity by these we cAR1, of the receptors binding at were The was by a single affinity with a of This value is similar to that of cAR1 on and on the of cells lacking G-proteins L. R. Devreotes P.N. J. Biol. 1995; PubMed Scopus Google Scholar). that the purified preparation of a of receptors not coupled to G-proteins. The from a representative purification were to the of binding and in in this which purifying from cells, of the receptor protein and of binding the contains of the the of receptors during this step. the purification of receptors from solubilized of receptor protein and binding The for the were about for the protein and for binding The of purification was about The of the final purified was about corresponding to The of cAR1 is to be binding site cAR1 that the purified receptors in detergent are these were on which all have of We purify about μg of active receptor from cells, which to liter of culture. We can and of cells, which to about a of purified The in the is the of a to purify from each of purification of cAR1 of intact cells was from the of We binding site receptor This was by the receptor in cells with of purified cAR1 of was by The gel was and The receptor in is usually in the of The final purified was were by When the final purified receptor, we used and purified protein as similar This purification used cells liter ligand binding of cells was obtained by binding at times d for and cAR1 were by at and the binding by The cAR1 of intact cells was from the of We binding site receptor This was by the receptor in cells with of purified The cAR1 of was by The gel was and The receptor in is usually in the of The final purified was in a were by When the final purified receptor, we used and purified protein as similar This purification used cells liter ligand binding of cells was obtained by binding at times d for and cAR1 were by at and the binding by To for the of the binding we receptors were three the first was not the was for and the was with at for The three were in parallel for shown in the first displayed binding The other two that the binding was due to a We carried out a to that the binding was due to the receptor. We used parallel of cells, two of cAR1 which or not the were from cell and were solubilized and on receptors with but the hexyl-histidine-tagged receptor be and purified by the each binding was by the and cell displayed at the purified and the receptor preparation displayed The that from cell cAR1 and but the hexyl-histidine-tagged receptor was purified and that binding was due to purified receptor. We also carried out an to the from to purified receptor. We from cells and it two The first was the was to and purification of each were for binding by and by to the of binding and receptor a of of were applied to the shown in the of binding and receptor protein were about and This that was of the receptor during the and purification To address the lowered affinity of phosphorylated receptors on the cell (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google was intrinsic to the modified protein or due to interactions with other we purified the and phosphorylated of receptors in We used the cell hexyl-histidine-tagged wild-type receptor The cells were with to phosphorylation or with to dephosphorylation of the receptor were on these two of cells to their shown in consistent with previous the displayed a decreased affinity with the d for K The of binding sites was the same for of cells. also that not with the desensitization properties of receptor. It has been shown that detergent cAR1 from cells was in its phosphorylated and phosphorylation not the of receptor to the (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). we were to to purify of were obtained for and cells and for ligand binding by The two of the same as in intact cells. The in between the two the preparation from or cells d of and nm, We have shown that G-proteins are from (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). This that the lowered affinity of phosphorylated receptors not be due to their uncoupling from G-proteins. the two of receptors were from and purified in parallel Ni2+ were obtained for and were the same as for the receptors that the form was The were by and The phosphorylated form displayed a lower consistent with previous J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google Scholar), that the of phosphorylation was during the The ligand binding properties of these were characterized by a single site for The K d were the same as in intact cells and The purified phosphorylated receptors displayed a K d of nm, three times higher the receptors which a K d of d for of purified receptors their cell that the decreased ligand affinity of phosphorylated cAR1 is an intrinsic property of the receptor and does not proteins. The receptor during the purification are in of affinity of receptor at of shown are of at two were by in a shown are of at two were by To that phosphorylation, not other possible directly for the lowered affinity of the phosphorylated receptor, we the receptor with protein phosphatases and of to enhanced receptor affinity. including protein phosphatase and phosphatase cAR1 phosphatase displayed the efficiency a led to about dephosphorylation to the protein phosphatase and to the same with at for and binding were on the in with In a ligand binding of the lowered binding at that of at for to reduction in The with phosphatase displayed an enhanced binding of higher the The may be higher to reduction of receptor ligand that lowered affinity of receptor by agonist pretreatment is an intrinsic property of the phosphorylated receptor. phosphorylation the C-terminal of the receptor serines 303 and a lower affinity. of these caused a in binding This in is consistent with the affinity between and phosphorylated receptor. that phosphorylation, other directly causes the decreased affinity. This suggests that phosphorylation directly to receptor desensitization ligand It has been proposed for other GPCRs that the site a by the segments (1Strader C. Fong T. Graziano M. Tota M. FASEB J. 1995; 9: 745-754Crossref PubMed Scopus (330) Google Scholar). To the higher affinity of the form of receptor and the lower affinity of the phosphorylated receptor, we propose that is between the C-terminal and of the receptor the ligand binding After agonist binding and phosphorylation, the C-terminal may undergo a conformational and interact with the the lowered affinity. other are two of this of the C-terminal a receptor with high affinity that is to agonist-induced affinity reduction J.-Y. R. Borleis J.A. Devreotes P.N. Hereld D. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar), that the higher affinity of receptor does not the C-terminal the that purified phosphorylated receptors display the lowered out the for interacting in this affinity displayed by phosphorylated GPCRs has not been as a major of desensitization. In in studies with or phosphorylated the phosphorylated receptors were found to have coupling to G-protein Cerione R.A. Caron M.G. Lefkowitz R.J. Science. PubMed Scopus Google Scholar), but between the of two of receptors were not carried In in vivo receptor internalization, or during or after receptor phosphorylation, of receptor affinity after phosphorylation the processes such as internalization or are usually the major to desensitization altered affinity is in receptor affinity can be in is or does not the phosphorylated and receptors can be purified their can be directly We propose that such affinity may be a of GPCR phosphorylation and directly contribute to receptor desensitization. The purification we have developed is in to any GPCR or membrane protein that can be in D. discoideum as as that protein is enriched in the plasma membrane The purification a which the the subsequent on the Ni2+ column of cell on the column purification not for other GPCRs have ligand affinity as a major 1985; Google Scholar, PubMed Scopus Google Scholar, M.G. J. Biol. Chem. Full Text PDF PubMed Google Scholar). In contrast, our is independent of ligand We such a we to purify of including with decreased binding In the we have used it to purify the phosphorylated and of cAR1 have we have mutant of cAR1 which are in ligand binding, G-protein signal or desensitization and have been in vivo J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: PubMed Scopus Google Scholar). This purification which is to wild-type receptor and all the mutant to the between these and the for each property of the receptor. It has been that certain GPCRs display and higher solubilized in and on C. M. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). We cAR1 on in cell and plasma membrane The are not are to treatment not the may be to we that the apparent on a of the in of evidence the of cAR1 in cAR1 solubilized in as two on not The form a higher of apparent on unlike the which at and the apparent at the in the Ni2+ column consistent with the binding two we the to the of receptor not A Ref. Z. Devreotes P.N. J. Biol. 1997; PubMed Scopus Google was wild-type cells such that the cells wild-type cAR1 and proteins. from these cells were and with cAR1 as as was found in the final the of It is to the of from biochemical that the and not in ligand affinity affinity form was for the a purification of each of the two In D. and their that of receptor the of these processes the dephosphorylation of cAR1 J.-Y. R. Borleis J.A. Devreotes P.N. Hereld D. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar). This suggests that receptor phosphorylation is the in desensitization. we have shown that receptor phosphorylation for of the non-phosphorylatable form of cAR1, display the in of and other This that a other receptor phosphorylation to the cells from after of the that and independent mechanisms are in and the phosphorylated receptors have a lower affinity for are not the we that this affinity decrease may be important for the that chemoattractant receptors cells a of the is the higher affinity of the receptors is the cells the a higher ligand be the cells receptors that be modified and a lower affinity be to the of the cells with receptors affinity can be by phosphorylation be to a of chemoattractant In the agonist-induced phosphorylation of the chemoattractant receptor which affinity may be useful in maintaining the receptor's sensitivity at high agonist levels. We for the and cell and Hereld for