Inactivated pbp4 in Highly Glycopeptide-resistant Laboratory Mutants of Staphylococcus aureus

Both vancomycin- and teicoplanin-resistant laboratory mutants of Staphylococcus aureus produce peptidoglycans of altered composition in which the proportion of highly cross-linked muropeptide species is drastically reduced with a parallel increase in the representation of muropeptide monomers and dimers (Sieradzki, K., and Tomasz, A. (1997) J. Bacteriol. 179, 2557–2566; and Sieradzki, K., and Tomasz, A. (1998) Microb. Drug Resist. 4, 159–168). We now report that the distorted peptidoglycan composition is related to defects in penicillin-binding protein 4 (PBP4); no PBP4 was detectable by the fluorographic assay in membrane preparations from the mutants, and comparison of the sequence of pbp4 amplified from the mutants indicated disruption of the gene by two types of abnormalities, a 17-amino acid long duplication starting at position 305 of thepbp4 gene was detected in the vancomycin-resistant mutant, and a stop codon was found to be introduced into the pbp4 KTG motif at position 261 in the mutant selected for teicoplanin resistance. Additional common patterns of disturbances in the peptidoglycan metabolism of the mutants are indicated by the increased sensitivity of mutant cell walls to the M1 muramidase and decreased sensitivity to lysostaphin, which is a reversal of the susceptibility pattern of the parental cell walls. Furthermore, the results of high performance liquid chromatography analysis of lysostaphin digests of peptidoglycan suggest an increase in the average chain length of the glycan strands in the peptidoglycan of the glycopeptide-resistant mutants. The increased molar proportion of muropeptide monomers in the cell wall of the glycopeptide-resistant mutants should provide binding sites for the “capture” of vancomycin and teicoplanin molecules, which may be part of the mechanism of glycopeptide resistance inS. aureus. Both vancomycin- and teicoplanin-resistant laboratory mutants of Staphylococcus aureus produce peptidoglycans of altered composition in which the proportion of highly cross-linked muropeptide species is drastically reduced with a parallel increase in the representation of muropeptide monomers and dimers (Sieradzki, K., and Tomasz, A. (1997) J. Bacteriol. 179, 2557–2566; and Sieradzki, K., and Tomasz, A. (1998) Microb. Drug Resist. 4, 159–168). We now report that the distorted peptidoglycan composition is related to defects in penicillin-binding protein 4 (PBP4); no PBP4 was detectable by the fluorographic assay in membrane preparations from the mutants, and comparison of the sequence of pbp4 amplified from the mutants indicated disruption of the gene by two types of abnormalities, a 17-amino acid long duplication starting at position 305 of thepbp4 gene was detected in the vancomycin-resistant mutant, and a stop codon was found to be introduced into the pbp4 KTG motif at position 261 in the mutant selected for teicoplanin resistance. Additional common patterns of disturbances in the peptidoglycan metabolism of the mutants are indicated by the increased sensitivity of mutant cell walls to the M1 muramidase and decreased sensitivity to lysostaphin, which is a reversal of the susceptibility pattern of the parental cell walls. Furthermore, the results of high performance liquid chromatography analysis of lysostaphin digests of peptidoglycan suggest an increase in the average chain length of the glycan strands in the peptidoglycan of the glycopeptide-resistant mutants. The increased molar proportion of muropeptide monomers in the cell wall of the glycopeptide-resistant mutants should provide binding sites for the “capture” of vancomycin and teicoplanin molecules, which may be part of the mechanism of glycopeptide resistance inS. aureus. PBP, penicillin-binding protein polymerase chain reaction Interest in the mode of action of glycopeptide antibiotics was rekindled by the emergence of glycopeptide resistance among enterococci (1Leclercq R. Derlot E. Duval J. Courvalin P. N. Engl. J. Med. 1988; 319: 157-161Crossref PubMed Scopus (1174) Google Scholar) and, more recently, by reports on the appearance of clinical isolates of Staphylococcus aureus with reduced susceptibility to teicoplanin and vancomycin (2Kaatz G.W. Seo S.M. Dorman N.J. Lerner S.A. J. Infect. Dis. 1990; 162: 103-108Crossref PubMed Scopus (146) Google Scholar, 3Hiramatsu K. Hanaki H. Ino T. Yabuta K. Oguri T. Tenover F.C. J. Antimicrob. Chemother. 1997; 40: 135-136Crossref PubMed Scopus (1664) Google Scholar, 4Centers for Disease Control Morbid. Mortal. Wkly. Rep. 1997; 46: 765-766PubMed Google Scholar, 5Centers for Disease Control Morbid. Mortal. Wkly. Rep. 1997; 46: 813-815PubMed Google Scholar). Vancomycin has been the antibiotic of choice in the therapy of infections by methicillin-resistant strains of S. aureus, and it has become the last effective antibiotic left against multidrug-resistant strains of S. aureus. In an attempt to obtain some insights into the mechanism of staphylococcal glycopeptide resistance, we isolated laboratory step mutants using either vancomycin (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar) or teicoplanin (7Sieradzki K. Tomasz A. Microb. Drug Resist. 1998; 4: 159-168Crossref PubMed Scopus (39) Google Scholar) as the primary selective agent. Despite several differences in the properties of mutants selected by vancomycin as compared with those selected by teicoplanin, both types of highly glycopeptide-resistant mutants showed decreased cross-linking of muropeptides and several other properties, suggesting extensive perturbation of cell wall metabolism. In this communication we use a combination of biochemical and genetic techniques to further explore the mechanism that has led to the striking changes in cell wall structure and metabolism of these mutants. The parental strain for both of the independently isolated glycopeptide-resistant mutants was the methicillin-resistant S. aureus strain COL (8Murakami K. Tomasz A. J. Bacteriol. 1989; 171: 874-879Crossref PubMed Scopus (176) Google Scholar). Mutant VM was isolated by serial selection with vancomycin (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar) and mutant TNM by selection for bacteria capable of growing on tryptic soy agar containing increasing concentrations of teicoplanin (final concentration, 100 μg/ml) (7Sieradzki K. Tomasz A. Microb. Drug Resist. 1998; 4: 159-168Crossref PubMed Scopus (39) Google Scholar). A third mutant, TM, was derived from mutant VM as a spontaneous, single step teicoplanin-resistant derivative, capable of growing on agar containing 800 μg/ml teicoplanin (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar). The methicillin-susceptible strain RN450 (9Novick R. Virology. 1967; 33: 155-166Crossref PubMed Scopus (527) Google Scholar) was also used in some of the experiments. The antibiotic susceptibility profiles of these strains are shown in Table I. All strains were grown in tryptic soy broth (Difco, Detroit, MI) at 37 °C with aeration. For each experiment, overnight cultures were diluted 10,000-fold into prewarmed tryptic soy broth and growth was followed by monitoring optical density (620 nm, using an LKB Spectrophotometer, Amersham Pharmacia Biotech, Sweden) and by plating on tryptic soy agar to determine viable titers of the cultures. Antibiotic resistance levels were determined by plating diluted cultures on tryptic soy agar for population analysis, as described previously (10Sieradzki K. Villari P. Tomasz A. Antimicrob. Agents Chemother. 1998; 42: 100-107Crossref PubMed Google Scholar).Table IAntibiotic susceptibility profiles of Staphylococcus aureus strains used in the studyStrainMinimal inhibitory concentrationMethicillinVancomycinTeicoplaninμg/mlCOL8001.53.0VM1.510050TM0.75100>3,200TNM2006.0200RN4500.750.40.4 Open table in a new tab Cell wall peptidoglycan was prepared and enzymatic cell wall hydrolysates were analyzed with reversed-phase HPLC as described previously (11de Jonge B.L.M. Chang Y.-S. Gage D. Tomasz A. J. Biol. Chem. 1992; 267: 11248-11254Abstract Full Text PDF PubMed Google Scholar), except that the alkaline phosphatase step was omitted. Peptidoglycan prepared from the parental strain and from the three resistant mutants was analyzed after digestion with three different types of enzymes. In the first type of enzymatic hydrolysis, digestion by the M1 muramidase was used. In the second type of digestion, M1 was replaced by lysostaphin, and in the third type of digestion lysostaphin treatment was followed by a second digestion with the M1 muramidase. Purified cell walls were suspended in appropriate buffer (for lysostaphin, 50 mm Tris-Cl, pH 7.5; for muramidase, 25 mm phosphate buffer, pH 5.5) to initialA 620 = 1.0. Lysis was measured as a decrease inA 620 during incubation of the wall samples at 37 °C. Membranes were prepared from cells grown to the late exponential stage in the following way: harvested cells were washed once in 50 mm Tris, 150 mm NaCl, 5 mm MgCl2 buffer, pH 7.5, resuspended in the same buffer supplemented with phenylmethylsulfonyl fluoride (0.5 mm) and β-mercaptoethanol (10 mm). Lysostaphin, DNase, and RNase were added to the final concentration of 100, 20, and 10 μg/ml, respectively, and the suspensions were incubated on ice for 30 min, followed by sonication for 5 min with 2 min intervals on ice-water batch after each 1 min cycle. Partially lysed/broken cells were harvested by ultracentrifugation at 110,000 × g for 40 min at 4 °C, washed twice in 50 mm phosphate buffer, pH 7.0, and membranes were solubilized by 2% Triton X-100. Protein concentrations were determined using the BCA protein assay kit (Pierce) with bovine serum albumin as a standard. Membranes (80 μg/sample) were labeled with 3Hbenzylpenicillin NEP salt (87.4 mCi/mg) (Merck) for 10 min at 30 °C. The reaction was stopped by addition of an access of unlabeled benzylpenicillin. Separation of proteins was carried out by the technique of Laemmli (12Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207002) Google Scholar) on 8% acrylamide gels at constant current of −20 mA until the blue dye reached the bottom of the separation gel. PBPs were visualized by fluorography (13Laskey R.A. Mills A.D. Eur. J. Biochem. 1975; 56: 335-341Crossref PubMed Scopus (3036) Google Scholar). DNA fragments including thepbp4 gene and its promoter region (2,076 base pairs) were amplified by PCR from chromosomal DNAs isolated from the parental strain COL and its mutants VM, TM and TNM. GeneAmp PCR reagent kit (Perkin Elmer) was used with 20 pmol of primers ATAAGACCCACTGGCCATGATAG and CTGGGGACAAAAAGAAGACGATG. The following conditions were used for amplification: 94 °C for 2 min; 30 cycles of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 3 min; and one final extension step of 72 °C for 5 min. The PCR product was purified with Wizard PCR Preps (Promega), and DNA sequencing was done at the Rockefeller University Protein/DNA Technology Center with Taqfluorescent dye terminator sequencing method by using a PE/ABI 377 automated sequencer. Fig. 1 shows the HPLC elution profiles of muropeptide species generated from the peptidoglycans of the parental strain COL and its vancomycin-resistant (VM) and teicoplanin-resistant (TNM) derivatives, and a third mutant, TM, selected from mutant VM as a highly teicoplanin-resistant derivative (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar). The HPLC profiles in panels A show muropeptide species obtained after treatment of the peptidoglycans with the M1 muramidase, an enzyme that breaks glycosidic bonds between the disaccharide units in the peptidoglycan (14Lichenstein H.S. Hastings A.E. Langley K.E. Mendiaz E.A. Rohde M.F. Elmore R. Zukowski M.M. Gene. 1990; 88: 81-86Crossref PubMed Scopus (27) Google Scholar). Drastic reduction in the proportion of highly cross-linked muropeptide oligomers (i.e. muropeptide species eluting from the HPLC column with the retention time of muropeptide 17 and with retention times longer) is apparent in each one of the mutant cell walls (see Fig. 1). Fig. 2 documents in quantitative terms the altered cell wall muropeptide composition in the glycopeptide-resistant mutants. Panels B in Fig. 1 show HPLC profiles obtained after hydrolysis of parental and mutant peptidoglycan with lysostaphin, an enzyme that hydrolyzes the oligoglycine cross-bridges in the peptidoglycan (15Browder H.P. Zygmunt W.A. Young J.R. Tavormina P.A. Biochem. Biophys. Res. Commun. 1965; 19: 2-8Crossref Scopus (114) Google Scholar, 16Xu N. Huang Z.-H. de Jonge B.L.M. Gage D.A. Anal. Biochem. 1997; 248: 7-14Crossref PubMed Scopus (33) Google Scholar). A large increase in the proportion of muropeptide species eluting with long retention times from the reverse phase column is apparent in each one of the resistant mutants. If one assumed that the lysostaphin digestion resulted in a quantitative breakage of all oligoglycine cross-bridges in the peptidoglycan, then the muropeptide species with the long retention time most likely represented muropeptide monomers attached to glycan chains of increased length as compared with glycan chains in the parental peptidoglycan. This interpretation was confirmed by the results of double digestion shown in panels C of Fig. 1. It may be seen that a subsequent treatment of the lysostaphin hydrolysates with the M1 muramidase generated a virtually identical set of muropeptides from both parental as well as from the mutant peptidoglycans, and these were identified on the basis of their elution patterns as a group of muropeptide monomers expected to be produced if the lysostaphin digestion preceding the treatment with M1 was complete (11de Jonge B.L.M. Chang Y.-S. Gage D. Tomasz A. J. Biol. Chem. 1992; 267: 11248-11254Abstract Full Text PDF PubMed Google Scholar). These observations suggest that the radically decreased peptide cross-linking of the peptidoglycan of the glycopeptide-resistant mutants was accompanied by increase in the average length of the glycan strands. Plasma membrane preparations isolated from the glycopeptide-resistant mutants were tested with the fluorographic assay using 3Hpenicillin for the presence of staphylococcal penicillin-binding proteins in the membrane preparations. No PBP4 could be detected in any one of the three highly resistant bacterial mutants (Fig.3). The pbp4 gene from the parental strain COL and from mutants VM, TM, and TNM was amplified and sequenced. The sequence of the pbp4 gene revealed that mutants VM and TM both carried a 17-amino acid duplication at position 305 of the parental gene. In the third mutant TNM, the alteration in the pbp4 gene involved introduction of a stop codon into the KTG motif at position 261 in the sequence (Fig.4). The decreased peptide cross-linkage and the apparent increase in the average glycan chain length in the peptidoglycan of the resistant mutants suggested that these alterations may have also caused an alteration in the relative susceptibilities of the mutant cell walls to lysostaphin and the M1 muramidase. This was in fact confirmed. Susceptibility of mutant cell walls to degradation by the M1 muramidase increased, whereas susceptibility to lysostaphin decreased, as compared with the properties of the parental cell wall (Fig.5). Such a shift in sensitivity would be consistent with the documented decrease in the peptide cross-linking and with the proposed increase in the average glycan chain length in the mutants, because the structural integrity of the mutant cell walls would depend less on the peptide cross-linking network than on the glycan chains. The observations described in this study confirm and extend our findings reported earlier (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar, 7Sieradzki K. Tomasz A. Microb. Drug Resist. 1998; 4: 159-168Crossref PubMed Scopus (39) Google Scholar). The drastically reduced level of peptidoglycan cross-linking, both in the vancomycin-resistant and also in the independently selected teicoplanin-resistant mutants, strongly suggests that this change in peptidoglycan composition is related, directly or indirectly, to the mechanism of antibiotic resistance. Highly cross-linked muropeptides, representing nearly 60% of all muropeptide species in the parental strain, were reduced to about 30, 15, and 17% in mutants VM, TM, and TNM, respectively. Results described in this study strongly suggest that these cell wall alterations are caused by the disruption of pbp4 in the mutants, resulting in the inactivation or greatly reduced production of PBP4, as evidenced by the negative results of the fluorographic assay. PBP4 has been shown to have both transpeptidase and D,D-carboxypeptidase activities (17Kozarich J.W. Strominger J.L. J. Biol. Chem. 1978; 253: 1272-1278Abstract Full Text PDF PubMed Google Scholar), and this protein was postulated to act in vivo as a secondary transpeptidase required for the extensive cross-linking of peptidoglycan (18Wyke A.W. Ward J.B. Hayes M.V. Curtis N.A.C. Eur. J. Biochem. 1981; 119: 389-393Crossref PubMed Scopus (90) Google Scholar). A mutant of S. aureus lacking pbp4 (19Curtis N.A.C. Hayes M.V. Wyke A.W. Ward J.B. FEMS Microbiol. Lett. 1980; 9: 263-266Crossref Scopus (38) Google Scholar) was reported to have a hypo-cross-linked peptidoglycan layer (18Wyke A.W. Ward J.B. Hayes M.V. Curtis N.A.C. Eur. J. Biochem. 1981; 119: 389-393Crossref PubMed Scopus (90) Google Scholar), as well as a slight increase in susceptibility to β-lactam antibiotics. Other studies (20Henze U.U. Berger-Bachi B. Antimicrob. Agents Chemother. 1996; 40: 2121-2125Crossref PubMed Google Scholar, 21Domanski T.L. de Jonge B.L.M. Bayles K.W. J. Bacteriol. 1997; 179: 2651-2657Crossref PubMed Google Scholar) demonstrated that overproduction or modification of PBP4 leads to increase in peptidoglycan cross-linking and to increased resistance to methicillin. Results described in this study indicate that a defect in PBP4 is also associated with the extensive reduction of peptidoglycan cross-linkage in glycopeptide-resistant S. aureus. That this abnormality may be related to the mechanism of resistance is suggested by disruption of pbp4 by two distinct modes of inactivation: the insertion of a 51-nucleotide sequence near the active site in the mutants with the primary selection for vancomycin resistance; and the introduction of a stop codon at the KTG motif in the mutant selected for by teicoplanin. The drastic reduction in peptidoglycan cross-linking in the resistant mutants was accompanied by an increased representation of monomeric muropeptides carrying intact carboxyl-terminald-alanyl-d-alanine residues (Fig. 2), which are known to be the recognition sites for glycopeptide antibiotics (22Nieto M. Perkins H.R. Biochem. J. 1971; 123: 789-803Crossref PubMed Scopus (232) Google Scholar). It was also demonstrated earlier that during the growth of cultures of the glycopeptide-resistant staphylococcal mutants, the bacteria can remove teicoplanin and vancomycin from the medium, and subsequently the sequestered antibiotic can be recovered in biologically active form from the cell walls (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar, 7Sieradzki K. Tomasz A. Microb. Drug Resist. 1998; 4: 159-168Crossref PubMed Scopus (39) Google Scholar). In the resistant staphylococci, the antibiotic molecules captured by the monomer-rich peptidoglycan may sterically block the porous channels in the cell wall through which incoming drug molecules normally reach sites of cell wall biosynthesis at the plasma membrane (Fig.6). In this model the diffusion barrier by the captured antibiotic molecules is assumed to become part of the mechanism of resistance. Although the correlation between the structural abnormality of peptidoglycan and glycopeptide resistance is striking, genetic and biochemical experiments clearly indicate that this cell wall abnormality alone cannot be fully responsible for the mechanism of resistance (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar). For instance, whereas cell walls purified from glycopeptide-resistant mutants have clearly increased (2–4-fold) drug binding capacities over that of the cell walls of the parental strain, this increase in binding capacity is much less than what would be expected for the disproportionately large increase in glycopeptide minimal inhibitory concentration value (6,7). Alterations in the secondary structure of the cell walls and/or changes in other cell surface polymers may also accompany acquisition of glycopeptide resistance (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar, 7Sieradzki K. Tomasz A. Microb. Drug Resist. 1998; 4: 159-168Crossref PubMed Scopus (39) Google Scholar). Glycopeptide-resistant laboratory mutants carry multistep mutations and show extensive and diverse abnormalities in cell wall metabolism, and the relationship of these to the mechanism of antibiotic resistance remains to be elucidated. One of these is the decrease in the resistance level of mutant VM (6Sieradzki K. Tomasz A. J. Bacteriol. 1997; 179: 2557-2566Crossref PubMed Scopus (234) Google Scholar). The mechanism of this is a relationship between the and vancomycin resistance level was also detected in a set of clinical isolates of methicillin-resistant S. aureus strain with reduced vancomycin susceptibilities K. Tomasz A. N. Engl. J. Med. 1998; Scopus Google Scholar). abnormality of wall metabolism was detected by in of the susceptibility of mutant cell walls to degradation by lysostaphin and by the M1 muramidase, as described in this The showed that was a reversal in the relative of the cell walls to these as compared with the susceptibility of the parental cell walls. Cell walls from the mutants an increased sensitivity to the M1 muramidase and a decreased sensitivity to lysostaphin, suggesting that the structural integrity of the mutant cell walls has become more on the glycan strands as compared with the peptide The responsible for a structural change is this is consistent with the results of the experiments B and C of Fig. which we as an apparent increase in the average glycan chain length in the peptidoglycan of the resistant mutants, for the decrease in peptide