Regulation of the angiopoietin-like protein 3 gene by LXR

Angiopoietins are members of the vascular endothelial growth factor family. One family member, angiopoietin-like protein 3 (Angpt1111111175), was recently shown to be predominantly expressed in the liver and to play an important role in regulating lipid metabolism. In this study, we show that the Angptl3 gene is a direct target of the liver X receptor (LXR). Mice fed a high cholesterol diet exhibited a significant increase in Angptl3 expression in the liver. Oral administration to mice of T0901317, a synthetic LXR-selective agonist, increases levels of plasma lipids and Angptl3 mRNA in the liver. Treatment of HepG2 cells with LXR selective agonists led to a dose-dependent increase of Angptl3 mRNA. Analysis of the DNA sequence just 5′ of the Angptl3 transcriptional start site revealed the presence of several potential transcription factor binding sites, including that for LXR. When transfected into HepG2 cells, the promoter activity of Angptl3 was significantly induced by LXR- or retinoid X receptor-selective agonists. Mutation of the predicted LXR binding site (DR4 element) completely abolished the LXR agonist-mediated activation of the promoter.Together, these studies show that Angptl3 is transcriptionally regulated by LXR, and reveals a novel mechanism by which LXR may regulate lipid metabolism. Angiopoietins are members of the vascular endothelial growth factor family. One family member, angiopoietin-like protein 3 (Angpt1111111175), was recently shown to be predominantly expressed in the liver and to play an important role in regulating lipid metabolism. In this study, we show that the Angptl3 gene is a direct target of the liver X receptor (LXR). Mice fed a high cholesterol diet exhibited a significant increase in Angptl3 expression in the liver. Oral administration to mice of T0901317, a synthetic LXR-selective agonist, increases levels of plasma lipids and Angptl3 mRNA in the liver. Treatment of HepG2 cells with LXR selective agonists led to a dose-dependent increase of Angptl3 mRNA. Analysis of the DNA sequence just 5′ of the Angptl3 transcriptional start site revealed the presence of several potential transcription factor binding sites, including that for LXR. When transfected into HepG2 cells, the promoter activity of Angptl3 was significantly induced by LXR- or retinoid X receptor-selective agonists. Mutation of the predicted LXR binding site (DR4 element) completely abolished the LXR agonist-mediated activation of the promoter. Together, these studies show that Angptl3 is transcriptionally regulated by LXR, and reveals a novel mechanism by which LXR may regulate lipid metabolism. The angiopoietins are a family of secreted growth factors. Together with their respective endothelium-specific surface receptors, such as the receptor tyrosine kinase Tie2, the angiopoietins play important roles in angiogenesis as reviewed in ref. (1Loughna S. Sato T.N. Angiopoietin and Tie signaling pathways in vascular development.Matrix Biol. 2001; 20: 319-325Google Scholar). One family member, Angiopoietin-like protein 3 (Angptl3), was previously found to be expressed in a liver specific manner (2Conklin D. Gilbertson D. Taft D.W. Maurer M.F. Whitmore T.E. Smith D.L. Walker K.M. Chen L.H. Wattler S. Nehls M. Lewis K.B. Identification of a mammalian angiopoietin-related protein expressed specifically in liver.Genomics. 1999; 62: 477-482Google Scholar), and more recently, it was found to play an important role in the regulation of lipid metabolism (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar). Mutation of Angptl3 results in low levels of plasma lipids in KK/San mice (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar). These hypolipidemic mice are derived from KK obese mice, which display a multigenic syndrome of moderate obesity and a diabetic phenotype including hyperinsulin-emia, hyperglycemia, and hyperlipidemia (4Kondo K. Nozawa K. Tomita T. Ezaki K. Inbred strains resulted from Japanese mice.Bull. Exp. Anim. 1957; 6: 107-112Google Scholar, 5Nakamura M. A diabetic strain of the mouse.Proc. Jpn. Acad. 1962; 38: 348-352Google Scholar, 6Nakamura M. Yamada K. Studies on a diabetic (KK) strain of mice.Diabetologia. 1967; 3: 212-221Google Scholar). Administration or overexpression of Angptl3 in mice elicited a rapid increase in circulating levels of plasma cholesterol, triglycerides (TG), and non-esterified fatty acids (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar). While these studies revealed a role of Angptl3 in lipid metabolism, they did not address the molecular mechanism by which a hyperlipidemic response was mediated by Angptl3. Understanding the regulation of Angptl3 expression is an important step toward a better comprehension of the physiological network that comprises lipid metabolism. Many genes involved in lipid metabolism are regulated by nuclear receptors. Liver X receptors (LXRs), including LXRα and LXRβ, are members of the nuclear receptor superfamily as reviewed in ref. (7Repa J.J. Mangelsdorf D.J. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar). LXRs heterodimerize with retinoid X receptors (RXRs) and can be activated by both RXR and LXR ligands. Upon activation, LXRs regulate the expression of target genes by binding to specific promoter response elements (termed LXREs) that contain a hexameric nucleotide direct repeat separated by four bases (DR4). Recent studies have shown that these ligand-activated transcription factors play important roles in the regulation of genes that govern cholesterol homeostasis in the liver and peripheral tissues (7Repa J.J. Mangelsdorf D.J. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar). In addition to cholesterol metabolism, accumulating evidence suggests that LXRs also play important roles in regulating fatty acid metabolism. For example, the expressions of sterol regulatory element-binding protein-1c (SREBP-1c), fatty acid synthase, and lipoprotein lipase were all shown to be strongly activated by LXR agonists (8Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta.Genes Dev. 2000; 14: 2819-2830Google Scholar, 9Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors.J. Biol. Chem. 2002; 277: 11019-11025Google Scholar, 10Zhang Y. Repa J.J. Gauthier K. Mangelsdorf D.J. Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta.J. Biol. Chem. 2001; 276: 43018-43024Google Scholar). It has been suggested that the regulation of SREBP-1c by LXR may contribute to increased levels of plasma TG when animals are treated with LXR agonists (11Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar, 12Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c.J. Biol. Chem. 2002; 277: 9520-9528Google Scholar). However, SREBP-1c cannot be solely responsible for the elevated TG because mice overexpressing SREBP-1c had a reduced level of circulating TG (13Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells.J. Clin. Invest. 1997; 99: 846-854Google Scholar). To determine if Angptl3 might be such a factor, we studied regulation of Angptl3. Here we report that the discovery that Angptl3 is indeed regulated by LXR. Given the profound effect of Angptl3 on circulating levels of cholesterol and TG, our findings may offer a novel mechanism for a role of LXR in regulating lipid metabolism. HepG2 cells, a human hepatocellular carcinoma cell line obtained from the American Type Culture Collection (Rockville, MD), were maintained in MEM medium with 10% heat inactivated fetal calf serum (FCS), non-essential amino acids, and sodium pyruvate in an atmosphere containing 5% CO2 and 95% air at 37°C. Before assay, cultured cells were trypsinized, washed once with PBS, and then resuspended in the assay medium (same as that of complete medium but with only 0.5% of FCS). All test compounds used in the experiments were diluted in the same assay medium. Total RNA was extracted from the cultured cells using TRIZOL reagent according to the protocol provided by the manufacturer (Life Technologies, Grand Island, NY). The RNA was treated with DNase (Ambion, Inc., Austin, TX) and was reverse transcribed using TaqMan reverse transcription reagents as described by the manufacturer (Applied Biosystems, Foster City, CA) before analysis by real-time quantitative RT-PCR. Oligonucleotide primers and TaqMan probes were designed using Primer Express software (Applied Biosystems) and were synthesized by Qiagen Operon (Alameda, CA). Sequences of probes and primers are listed in Table 1. Primers and probes for 18S rRNA were purchased from Applied Biosystems.TABLE 1Sequences of primers and probes for real time quantitative PCRGeneSpeciesForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Probe (5′ to 3′)Angptl3HumanACCATTTATAAC AGAGGTGAACAT ACAAGCCTGATATAACA TCACAGTAGACA TGAAAATGTATGCCATCAG ACCCAGCAACTCT CAAngptl3MouseGATTTGCTATGT TGGATGATGTCAACTTATGGACAAAA TCTTTAAGTCCA TGAATTTTAGCGAATG GCCTCCTGCAGCTCYP7AMouseCAAAACCTCCAA TCTGTCATGAGAGCGTTAGATATC CGGCTTCAAAAGGGATGTATGC CTTCTGCTACCGA GTGAT Open table in a new tab Real-time quantitative TaqMan PCR analysis was used to determine the relative levels of Angptl3 mRNA. TaqMan PCR reactions were performed according to the manufacturer's instructions (Applied Biosystems, TaqMan Universal PCR Master Mix). Target cDNA amplification was detected by the increased fluorescent signal of FAM (reporter dye) during the amplification cycles. Amplification of the 18S rRNA transcript was performed in the same reactions using a different reporter dye, VIC, as an internal control for variations in RNA amounts. Levels of the target mRNAs were subsequently normalized using 18S mRNA and are as the of treated cells to were performed to human and mouse Angptl3 J. D.J. and a new of protein 1997; Scholar). The of human and mouse Angptl3 were using I. M. L. of revealed by 2000; Scholar, M. J.R. A. I. DNA sequence of 2000; 16: and J.D. the of sequence sequence and Scholar). binding for transcription factors were by the Chen R. H. I. T. M. I. an for gene expression 2000; and the for transcription factors 5′ amplification of cDNA PCR was performed with the CA) using of RNA from mouse liver. The 5′ of the mRNA were and with the RNA The mRNA was then reverse transcribed using and a The 5′ of the cDNA was then then then using PCR the 5′ and the A PCR was then 3 by using of the PCR PCR the 5′ and a The PCR was on a and the was using a and into The was using the and by All reagents listed were provided by A reporter was with of the promoter of human Angptl3 and of the 5′ human DNA CA) was with Angptl3 specific primers and a site from the 5′ of the and a site from the 5′ of the reverse with and this was into a Inc., and by the and to the human Angptl3 A with a of the element of the human Angptl3 promoter was by site of the 5′ of the The was performed using the and according to the manufacturer's The was designed to an site into the 5′ of the Angptl3 A with (Life Technologies, Inc., was used to for and the were to the of in the Angptl3 of HepG2 cells were performed in with reagent according to the manufacturer's instructions to cells were and the complete was by assay medium to a of One of cells were of the The or were with at a of of reporter DNA and of the internal control to a to DNA of test compounds in assay medium were and the cells were using and for and with the purchased from All and were performed in mice were purchased from NY). were maintained in and were provided with Mice were fed with diet with or of mice were once a with of or of of by of or mice were and were Liver were for RNA cholesterol, cholesterol and were with assay from All were by the and at To determine if expression of Angptl3 mRNA may be to regulation in response to of cholesterol mice were fed for with a diet or with the same with of PCR analysis as that mice fed a diet had an increased expression of which cholesterol the in acid D.J. B.A. Lobaccaro J.M. Hammer R.E. Mangelsdorf D.J. and acid metabolism are in mice the nuclear oxysterol receptor LXR Scholar). The diet also resulted in a expression of Angptl3 in the liver with mice fed a diet liver Angptl3 expression is to in cholesterol Recent studies that mice with a diet or cells with cholesterol may in activation of the nuclear receptor LXR or increased expression of target genes including (8Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta.Genes Dev. 2000; 14: 2819-2830Google Scholar, D.J. B.A. Lobaccaro J.M. Hammer R.E. Mangelsdorf D.J. and acid metabolism are in mice the nuclear oxysterol receptor LXR Scholar, A. Repa J.J. Lobaccaro J.M. A. Mangelsdorf D.J. mRNA levels are induced in A transcriptional role for specific Biol. Chem. 2000; Scholar). if LXR play a role in regulating the expression of Angptl3 by mice with T0901317, a synthetic LXR-selective (11Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar). with a report (11Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar), of mice with resulted in significant of plasma cholesterol, and triglycerides Analysis of liver mRNA levels revealed a significant increase of Angptl3 mRNA Oral of mice with of for resulted in a increase of Angptl3 mRNA in the liver liver Angptl3 expression is to the activation of LXR in To determine if the of Angptl3 in mice be mediated by direct on we studied the of LXR agonists on Angptl3 expression in HepG2 HepG2 cells were for with and shown in and of HepG2 cells with or T0901317, both of which LXR (7Repa J.J. Mangelsdorf D.J. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar, J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar), resulted in a dose-dependent increase of Angptl3 mRNA. results were when cells were treated with which also LXR not In addition of which not LXR (7Repa J.J. Mangelsdorf D.J. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar), to significantly the expression of Angptl3. Together, these results that LXR can Angptl3 transcription in To determine if the induced in HepG2 cells be to direct of LXR on the Angptl3 we studied the Angptl3 promoter. the transcriptional start site by the 5′ by 5′ PCR using RNA from mouse liver as the The a PCR and sequence analysis the transcription start site as of the for mouse Angptl3. of the 5′ from the mouse with the human Angptl3 sequence suggests that the human transcription start site is of the we the sequence 5′ of the mouse and human Angptl3 The revealed that the and a the are with sequence These may play a role in the regulation of the Angptl3 we for binding of transcription factors in these the binding in the to the transcription start binding for transcription including LXR, and are human and which binding for and were also predicted in the of the transcription start site not of the promoter of human and mouse Angptl3. The sequence the 5′ is shown in and 5′ is by as the transcription start in the The start is also by an A of binding of transcription factors are predicted in this human and mouse are and found in only are To the of the Angptl3 we transfected HepG2 cells with a human Angptl3 of the promoter and of 5′ to the To test if such a promoter is and to LXR activation, cells were treated for with acid or shown in of cells with the LXR or resulted in a and increase in promoter activity of In addition of an oxysterol that not LXR, to significantly the In a RXR agonist, increased the promoter activity by When and were for a was a of the Angptl3 promoter but more profound were when cells were treated with T0901317, a synthetic LXR-selective Treatment of cells with of increased the Angptl3 promoter activity by of of with of increased the Angptl3 promoter activity by These results that transcriptional regulation of Angptl3 is transcriptionally regulated by LXR and studies have shown that transcriptional regulation of several genes including K. gene expression and cholesterol are regulated by 2000; Scholar, P. Y. Wang of the promoter by the liver X X Biol. Chem. 2000; Scholar), SREBP-1c (8Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta.Genes Dev. 2000; 14: 2819-2830Google Scholar), and Y. Repa J.J. Gauthier K. Mangelsdorf D.J. Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta.J. Biol. Chem. 2001; 276: 43018-43024Google by LXR the presence of the Analysis of the Angptl3 promoter a element of the transcription start To test if the element is indeed for transcriptional activation of the Angptl3 gene by LXR, we a into the 5′ site of the element the Angptl3 promoter shown in this completely abolished the response of the human Angptl3 promoter to or the of and these results strongly that the element is for In of the potential of Angptl3 in lipid metabolism (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar), we studied the transcriptional regulation of Angptl3. that expression of Angptl3 mRNA is in mice by and by administration of the LXR of HepG2 cells with or synthetic that LXR increases Angptl3 and the promoter of the human Angptl3 gene and an LXR response the an assay that the activity of a of the human Angptl3 promoter. Angptl3 promoter is active in HepG2 cells and is induced by of that LXR or Mutation of the element completely abolished the response of the Angptl3 promoter to selective LXR or RXR agonists. that Angptl3 is a direct target gene of LXR. The element is in the human and mouse Angptl3 that LXR is also In addition to the LXR response analysis of the Angptl3 promoter several potential binding for transcription factors including and of these potential binding were also in both the mouse and human Angptl3 that may be and are transcription which are involved in gene expression The DNA binding of the liver nuclear protein is Scholar, in the human genes the transcription factors of the nuclear factor and and 2001; Scholar, transcription factor is a novel of the receptor Dev. Scholar). The of and that are in the mouse and human Angptl3 promoter may for a expression of Angptl3 in the liver. Angiopoietins are members of the vascular endothelial growth factor family S. A. D.L. T.E. J. of a for the by expression Scholar, S. D. J. S. Sato T.N. a for that in 1997; 277: Scholar). of this family the a signal an a and a Angptl3 from such as of a the of binding and expression in the liver (2Conklin D. Gilbertson D. Taft D.W. Maurer M.F. Whitmore T.E. Smith D.L. Walker K.M. Chen L.H. Wattler S. Nehls M. Lewis K.B. Identification of a mammalian angiopoietin-related protein expressed specifically in liver.Genomics. 1999; 62: 477-482Google Scholar). it was recently found that of Angptl3 is responsible for low plasma lipid levels in KK/San mice, administration of Angptl3 elicited a rapid increase in circulating levels of cholesterol, TG, and fatty acid (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar). these studies revealed a potential role for Angptl3 in lipid metabolism, they did not address the and molecular by which a hyperlipidemic response is mediated by Angptl3. recently, it was that Angptl3 may regulate levels of direct of lipoprotein lipase activity T. Ono M. Shimamura M. K. Ando Y. R. K. T. H. T. Furukawa H. by of lipoprotein Biol. Chem. 2002; 277: Scholar). Here we report for the time a transcriptional regulation of Angptl3 by LXR, a lipid transcription findings are with a role of Angptl3 in lipid metabolism, and be for of mechanism of the hyperlipidemic of Angptl3. Administration of that LXR results in an increase of cholesterol and TG in plasma (11Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar, 12Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c.J. Biol. Chem. 2002; 277: 9520-9528Google Scholar). a of cholesterol to is a direct target gene of LXR K. gene expression and cholesterol are regulated by 2000; Scholar, P. Y. Wang of the promoter by the liver X X Biol. Chem. 2000; Scholar). of by the of LXR agonists may be responsible for an increase of However, a for the LXR agonist-mediated increase of circulating TG to be In addition to activation of LXR may also increase the expression of a of genes involved in fatty acid metabolism, including fatty acid synthase, and lipoprotein lipase (8Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta.Genes Dev. 2000; 14: 2819-2830Google Scholar, 9Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. Direct and indirect mechanisms for regulation of fatty acid synthase gene expression by liver X receptors.J. Biol. Chem. 2002; 277: 11019-11025Google Scholar, 10Zhang Y. Repa J.J. Gauthier K. Mangelsdorf D.J. Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta.J. Biol. Chem. 2001; 276: 43018-43024Google Scholar). of LXR agonists on such genes are to be responsible for an increase of circulating However, this is by the that overexpression of SREBP-1c in mice increases TG level in the TG level in the plasma was reduced (13Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells.J. Clin. Invest. 1997; 99: 846-854Google Scholar). The role of Angptl3 in hyperlipidemic response to be Given the profound effect of Angptl3 on plasma lipid levels (3Koishi R. Ando Y. Ono M. Shimamura M. Yasumo H. Fujiwara T. Horikoshi H. Furukawa H. Angptl3 regulates lipid metabolism in mice.Nat. Genet. 2002; 30: 151-157Google Scholar), it is that Angptl3 may play an important role in increases of plasma It is to that administration of LXR agonists (11Schultz J.R. Tu H. Luk A. Repa J.J. Medina J.C. Li L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Role of LXRs in control of lipogenesis.Genes Dev. 2000; 14: 2831-2838Google Scholar, A. T. T. of by activation of the liver X receptor to of low lipoprotein Biol. Chem. 2002; 277: or Angptl3 T. Ono M. Shimamura M. K. Ando Y. R. K. T. H. T. Furukawa H. by of lipoprotein Biol. Chem. 2002; 277: both in increase of TG levels in the Administration of an to the KK/San which has an Angptl3 be used to test an of in increases of plasma The D. for and P. and for and and and for in angiopoietin-like protein 3 fetal calf serum liver X receptor acid sterol regulatory element-binding protein triglycerides