Primary and secondary structure of 7-3 (K) RNA of Novikoff hepatoma.

7-3 RNA (also known as K-RNA and 7SK-RNA) is a distinct small RNA found in insect to mammalian cells.Previous studies showed that this RNA is not capped, contains no modified nucleotides, is conserved through evolution, is synthesized by RNA polymerase 111, and, in part, is associated by polyribosomes.In this study, the complete nucleotide sequence of 7-3 RNA was determined by RNA-sequencing methods, and the sequence is compared with several small RNAs and repetitive DNA sequences for homology.This 330nucleotide-long RNA contained pppGp as its 5' terminus and exhibited heterogeneity with respect to the 3"terminal AoH.The nucleotide sequence is: ppp GGAUGUGAGGCGAUCUGGCU GCGACAUCUGUCACCCUAUUGAUCGCCAGG 50 GUUGAUUCGG CUGAUCUGGC UGGCUAGGCG GGUGUCCCCU UCCUCCCUCA 100 CCGCUCCAUGUGCGUCCCUC CCGAAGCUGCGCGCUCGGUC GAAGAGGACG 150 ACCUUCCCCGAAUAGAGGAG GACCGGUCUUCGGUCAAGGG UAUACGAGUA 200 GCUGCGCUCC CCUGCUAGAA CCUCCAAACA AGCUCUCAAG GUCCAUUGUA 250 GGAGAACGUA GGGUAGUCAA GCUUCCAAGA CUCCAGACAC AUCCAAAUGA 300 GGCGCUGCAU GUGGCAGUCU GCCUWCUUU ( A ) w 331The RNA is G-C rich, and evidence is presented that 7-3 RNA is in a ribonucleoprotein particle in the cytoplasm.