Amylin, or islet amyloid polypeptide (IAPP), is a peptide hormone co-secreted with insulin by pancreatic β-cells. Emerging evidence demonstrates that amyloid-forming amylin accumulates in the brain microvasculature inducing brain microhemorrhages and neurological deficits. Telomeres, composed of repetitive TTAGGG sequences, maintain chromosomal integrity, and their shortening is a recognized biomarker of cellular aging and stroke risk. This association has been observed in various populations and studies have shown that shorter telomeres may indicate a higher likelihood of experiencing a stroke and potentially more severe strokes. Furthermore, shorter telomeres have been associated with mortality after stroke. Objective of this study is to investigate whether suppressing pancreatic secretion of amylin influences telomere length in brain and peripheral tissues. We used stroke-prone human amylin-expressing rats (HIP rats) and amylin knockout (AKO) rats to extract genomic DNA from brain tissue and blood . DNA concentration and purity were assessed via Nanodrop, and relative telomere length was measured using SYBR Green-based real-time PCR with telomere-specific primers (CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT, GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT) on a CFX96 C1000 Thermal Cycler. Relative telomere length was calculated using the dtdtCt method, comparing telomere Ct values to single-copy gene Ct values normalized to control DNA. Compared to HIP rats, AKO rats exhibited longer telomere length in brain tissues (p < 0.0001), whole blood (p < 0.001), and leukocytes (p < 0.001). As shorter telomere length is associated with higher risk of stroke, our findings suggest that reducing the circulating level of amyloid-forming amylin protects against loss of telomere length, potentially mitigating stroke susceptibility in vulnerable population. Further investigation is required to elucidate the mechanisms by which amylin deletion preserves telomere integrity and confers neurovascular protection.
Verma et al. (Thu,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: