Key points are not available for this paper at this time.
We report the cloning, expression, and characterization of a new family of cyclic nucleotide phosphodiesterase (PDE) that has unique kinetic and inhibitor specificities. A clone corresponding to the C terminus of this PDE was initially identified by a bioinformatic approach and used to isolate a cDNA that is likely full-length. This novel PDE, designated as MMPDE9A1, shows highest mRNA expression in kidney with lower levels in liver, lung, and brain. The mRNA size by Northern blot analysis is approximately 2.0 kilobases, and the cDNA encoding PDE9A1 is 1929 base pairs in length. The largest open reading frame predicts a protein of 534 amino acids with a molecular mass of 62,000 Da. When expressed in COS-7 cells, PDE9A1 activity was not inhibited well by either the nonselective inhibitor 3-isobutyl-1-methyl-xanthine or the new selective PDE5 inhibitor, sildenafil, but it is inhibited by the PDE1/5 inhibitor (+)-cis-5,6a,7,8,9 hyl] phenylmethyl]-5-methyl-cylopent4,5imidao2,1-bpurin-49(3H)one (SCH51866) with an IC50 of 1.55 μm. This new phosphodiesterase is highly specific for cGMP. ItsK m of ∼0.07 μm for cGMP is the lowest yet reported for a PDE, being at least 40–170 times lower than that of PDE5 and PDE6, respectively. We report the cloning, expression, and characterization of a new family of cyclic nucleotide phosphodiesterase (PDE) that has unique kinetic and inhibitor specificities. A clone corresponding to the C terminus of this PDE was initially identified by a bioinformatic approach and used to isolate a cDNA that is likely full-length. This novel PDE, designated as MMPDE9A1, shows highest mRNA expression in kidney with lower levels in liver, lung, and brain. The mRNA size by Northern blot analysis is approximately 2.0 kilobases, and the cDNA encoding PDE9A1 is 1929 base pairs in length. The largest open reading frame predicts a protein of 534 amino acids with a molecular mass of 62,000 Da. When expressed in COS-7 cells, PDE9A1 activity was not inhibited well by either the nonselective inhibitor 3-isobutyl-1-methyl-xanthine or the new selective PDE5 inhibitor, sildenafil, but it is inhibited by the PDE1/5 inhibitor (+)-cis-5,6a,7,8,9 hyl] phenylmethyl]-5-methyl-cylopent4,5imidao2,1-bpurin-49(3H)one (SCH51866) with an IC50 of 1.55 μm. This new phosphodiesterase is highly specific for cGMP. ItsK m of ∼0.07 μm for cGMP is the lowest yet reported for a PDE, being at least 40–170 times lower than that of PDE5 and PDE6, respectively. The cyclic nucleotides cAMP and cGMP serve as second messengers for a wide variety of extracellular signals such as neurotransmitters, hormones, light, and odorants. The diverse cellular and behavioral responses to these second messengers are mediated by the action of cAMP and cGMP on their intracelluar targets, which include kinases, ion channels, transcriptional activators, and several isoforms of phosphodiesterases (PDEs). 1The abbreviations used are: PDE, phosphodiesterase; IBMX, 3-isobutyl-1-methyl-xanthine; RACE, rapid amplification of cDNA ends; EST, expressed sequence tag; kb, kilobase(s); SCH 51866, (+)-cis-5,6a,7,8,9 hyl] phenylmethyl]-5-methyl-cylopent4,5imidao2,1-bpurin-49(3H)one; ANP, atrial natriuretic peptide; PCR, polymerase chain reaction; MOPS, 3-N-morpholinopropanesulfonic acid. Accordingly, these responses are regulated by the rates of synthesis of cyclic nucleotides by cyclases and their degradation by PDEs to biologically inactive 5′ monophosphate nucleosides. Seven 2Note that an eighth family of cyclic nucleotide phosphodiesterases has also been identified by our lab and by Fisher et al. Fisher, D. A., Smith, J. F., Pillar, J. S., St. Denis, S. H., and Cheng, J. B. (1998) Biochem. Biophys. Res. Commun. 246, in press. different gene families of PDEs previously have been isolated based on their distinct kinetic and substrate characteristics, inhibitor profiles, allosteric activators and inhibitors, and amino acid sequence (1Beavo J.A. Physiol. Rev. 1995; 75: 725-748Crossref PubMed Scopus (1643) Google Scholar). Family 1 is activated by Ca2+/calmodulin and hydrolyzes both cAMP and cGMP; family 2 is stimulated by cGMP, and both cAMP and cGMP serve as substrate; family 3 is distinguished by cAMP hydrolysis that is inhibited by cGMP; family 4 is cAMP-specific; family 5 binds cGMP at a noncatalytic site and specifically hydrolyzes cGMP; family 6 is the retinal PDE that is inhibited by a γ subunit in the absence of activated transducin and hydrolyzes cGMP; and family 7 is a very lowK m cAMP-specific PDE. Not only does each family of PDE have specialized substrate and regulatory features, but each PDE family and even members within a family also exhibit tissue-, cell-, and subcell-specific expression patterns and therefore participate in distinct signal transduction pathways. The precise cellular and subcellular profile of PDE expression then will determine the cyclic nucleotide phenotype of a cell and how it responds to first messengers. Identifying and characterizing these functionally distinct PDEs is therefore crucial for our understanding of the mechanisms by which cyclic nucleotides moderate their biologic effects. We report here the cloning, expression, and characterization of a previously unknown PDE designated as MMPDE9A1 (2Beavo J.A. Conti M. Heaslip R.J. Mol. Pharmacol. 1994; 46: 399-405PubMed Google Scholar). This PDE represents a new gene family because it shares less than 50% amino acid identity in the conserved catalytic domain with the other seven PDE families. A search of GenBank™ reveals that PDE9A1 has slightly higher sequence homology to a recently described Dictyostelium discoideumPDE referred to as RegA (3Shaulsky G. Escalante R. Loomis W.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15260-15265Crossref PubMed Scopus (147) Google Scholar) rather than other mammalian PDEs. Additionally, expression of PDE9A1 in COS cells results in functional PDE activity that is unique kinetically from the other seven families in that it is cGMP-specific and has the lowest K mfor cGMP reported so far for a PDE. The amino acid sequence of MMPDE1A2 was used as a query to search the data base of expressed sequence tags (4Boguski M.S. Lowe T.M. Tolstoshev C.M. Nat. Genet. 1993; 4: 332-333Crossref PubMed Scopus (1140) Google Scholar, 5Hillier L.D. et al.Genome Res. 1996; 6: 807-828Crossref PubMed Scopus (389) Google Scholar). The program used was the Basic Local Alignment Search Tool (BLAST) (6Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (70758) Google Scholar) accessed from the data base search and analysis Search Launcher (7Smith R.F. Wiese B.A. Wojzynski M.K. Davison D.B. Worley K.C. Genome Res. 1996; 6: 454-462Crossref PubMed Google Scholar). This search resulted in many EST sequences with homology to the PDE1A2 query. Each of these EST sequences were then used as queries in a BLASTN search of GenBank™ to determine whether they represented different but known PDEs or whether the EST sequence represented a truly unknown PDE. EST clone identification number 404030 was isolated in this manner as a sequence that appeared to represent a novel PDE. Clone 404030 was ordered from the American Type Culture Collection. Clones 420451 was ordered from Genome Systems, Inc. Plasmid DNA was prepared using the SNAP kit (Invitrogen). Primers were designed using the program Amplify (freeware by William Engels, Genetics Department, University of Wisconsin, Madison, WI). Sequencing was done using ABI PRISM dye terminator cycle sequencing kit (Perkin-Elmer), and sequencing reactions were purified using Centri-sep columns (Princeton Separations). Sequences were assembled using the program Sequencher 3.0 (Gene Codes Corporation). The primers used were: Krace.S1, gcgatgggggccggctcctcaagctac; 4040AS2, gtttcaaacattgggatcaggacaaac; PDE9stp.AS2, ccacaattcatctgctctaactggtacagtc; PDE9stp.AS1, cctgggaagcctcgcttggctctgtccac; Gal4ActAS.pri, gaaattgagatggtgcacgatgcacag; AP1, ccatcctaatacgactcactatagggc AP2, actcactatagggctcgagcggc. DNA probes were generated from EST clone 404030 and B-actin using Prime-It RmT random primer labeling kit (Stratagene). α-32PdCTP at 6000 Ci/mmol was used, and the reaction product was purified using Centri-sep columns. Multiple tissue mRNA blot was purchased fromCLONTECH. Prehybridization, hybridization, and washing was done according to the manufacturer's guidelines. Hybridization was done using 2 × 106 cpm/ml in a final volume of 20 ml at 42 °C overnight. EST clone 404030 was used to screen approximately 700,000 plaques from a mouse kidney λgT10 cDNA library (CLONTECH). Briefly, the library was incubated with an overnight culture of c600Hfl Escherichia coli and plated onto NZY plates with NZY plus top agarose and incubated for 8 h. Plates were then stored overnight at 4 °C. Nitrocellulose filters were placed on top of these plates for 3 min in duplicate and denatured for 5 min in 1.5 m NaCl and 0.5n NaOH followed by neutralization in 1.5 m NaCl and 0.5 m Tris-HCl, pH 8, for 5 min again. Filters were then rinsed in 2× SSC, air dried, and UV cross-linked (0.15 J/cm2). Filters were then prewetted in 2× SSC and then incubated in hybridization solution (50 mm Tris-HCl, 1% SDS, 10% dextran sulfate, 1 m NaCl) for 1 h at 65 °C. 5 × 106 cpm/ml of boiled probe was added, and hybridization was continued overnight. Filters were then washed in 2× SSPE for 15 min twice at room temperature and then twice in 0.1× SSPE, 0.5% SDS for 30 min at 65 °C. Filters were then exposed to autoradiographic film overnight, and positive plaques were picked and stored in 50 mm Tris-HCl, pH 7.5, 100 mm NaCl, 10 mm MgSO4, 2% gelatin until further rounds of screening were done. This resulted in two independent clones, clones 2.1 and 6.1, which were identical and contained the sequence of EST clone 404030 in addition to a polyadenine tail, representing the full 3′ end of PDE9. Additionally, primers 4040AS2 and a primer against the multiple cloning site, Gal4ActAS.pri, were used in a screen by polymerase chain reaction of 6 × 106 colony forming units of a rat brain pGAD10 library for sequences to the 404030 This resulted in a clone that contained 5′ end sequence but was the This rat sequence was then used to the EST data for new EST clones that contained 5′ end This resulted in clone which the but is 3′ at nucleotide because of an site in PDE9. cDNA and polymerase was purchased from were as 0.5 of μm or μm 5 of reaction with mm and 1 of in a final volume of 50 were as °C for 1 5 of °C for 30 °C for 4 5 of °C for 30 °C for 4 of °C for 30 °C for 4 from the mouse kidney clone was a of clone 420451 to the 3′ end of PDE9A1 from this clone because of an site and the of in library for clone This generated a PDE9A1 This was by 0.5 of PDE9A1 for 10 using primers and were used to for clones with PDE9A1 in the The cDNA as reported here has been to as a mRNA by of kidney cDNA using primers and PDE9A1 cDNA in was purified using columns. 10 of DNA was 2 × 106 COS-7 in a at and using 50 and 50 The of was also the as a for plates for each were and plated onto and in for h. this was added, and cells were placed in 10% for h. Each of plates was and in 4 ml of mm Tris-HCl, pH 15 mm 15 mm 1 1 and 5 mm This was in a on with and then 1 volume of was This was stored at °C in and not activity 2 PDE were done according to the of and J.A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar) in a mm MOPS, pH 7.5, mm mm and in a final volume of were done in and reaction times and were such that the lowest substrate than activity is as the specific activity in COS cells the specific activity of COS cGMP activity was approximately higher in cells with cells at 1 μm cGMP and approximately higher at μm cGMP. the cGMP activity in COS-7 cells was not a to the activity in were done cGMP to the final substrate so that IC50 the K IBMX, and were from was a from was from SCH was a from and was a from was a from the We have and a cDNA encoding a new cyclic nucleotide phosphodiesterase that represents a previously unknown gene A cDNA representing this novel PDE, which but homology to the C terminus of PDE was initially isolated from the data base of expressed sequence This sequence EST clone not GenBank™ PDE sequence with homology but PDEs in than other GenBank™ that this sequence represent a PDE of a new This EST was used to probe a mouse multiple tissue Northern blot to tissue and mRNA Northern blot analysis that mRNA representing this EST has a of expression in mouse kidney and lower levels of expression in liver, lung, and brain. This mRNA is to 2.0 in on this to clone the cDNA for this EST from to determine whether it represent a novel PDE. for cloning the cDNA of this EST were used, hybridization screening of screening of cDNA 5′ RACE, and EST data base which using sequence to screen EST data for EST clones the clones DNA probes were prepared from the 404030 EST and used to screen 700,000 mouse kidney λgT10 The clones were from and for analysis clones 2.1 and were both approximately 1 in the mRNA size by Northern blot analysis was 2 kb, this that these clones were Sequencing of these clones this to the Clones 2.1 and are identical and the sequence of EST clone 404030 to a polyadenine to the hybridization library screen also designed primers to the EST cDNA sequence to screen by for sequence 5′ to the EST This sequence was for whether the EST for a PDE because the catalytic domain sequence was to 5′ to the sequence of blot analysis of this reaction two that were specific to our EST reactions were done that resulted in a cDNA that was for This was and contained not only the sequence of EST clone 404030 but also the sequence that appeared to for a PDE catalytic domain the of J.A. Pharmacol. Sci. 1990; PubMed Scopus Google Scholar). this PDE appeared to to a novel family of cyclic nucleotide phosphodiesterases in that the conserved domain less than 50% sequence identity with the conserved of members of the other seven known families The sequence from the screen of the mouse kidney library and the screen of the rat brain library resulted in a cDNA that appeared to at the 5′ end because site with a M. PubMed Scopus Google Scholar) was the EST data base was done by using the rat brain cDNA sequence as a query to screen the data base using to EST clones that contained the new 5′ end sequence and also an sequence not from the screen of the rat brain cDNA This EST resulted in the of mouse EST clone identification number which contained an 5′ to the rat brain cDNA contained an with a very sequence M. PubMed Scopus Google Scholar). This clone also the sequence of EST clone 404030 and is at the 3′ end site with the of in the of this 5′ of mouse kidney and cDNA was also and sequencing of these sequence but the 5′ end of our The cDNA from the EST clone 420451 and clones 2.1 and of the mouse kidney library screen a sequence that is 1929 base pairs in length. of mouse kidney cDNA using primers and and sequencing of this clone that the cDNA clone here as a mRNA that this cDNA is not because 5′ sequence was in either the EST data base or by 5′ of both mouse kidney and mouse the cDNA size is in with the corresponding mRNA size by Northern and the the of M. PubMed Scopus Google Scholar). A of this family which shares sequence identity to MMPDE9A1, has been recently identified St. J. Biol. Scopus Google Scholar). This clone a identical to the in MMPDE9A1, and the amino acid sequence this is not conserved these two that this is or have been of the in either the mouse or the cDNA is slightly than the mRNA and because have been until either the amino acid sequence of the or an in the is the of the here will the this sequence is likely to full-length. the mouse and PDEs are of the with identical and inhibitor profiles, they are different in that MMPDE9A1 does not an of amino acids within the to the conserved catalytic domain of two PDEs represent distinct of the or this to a The that is conserved from mouse to that this PDE family is functionally to these The protein sequence of MMPDE9A1 is 534 amino acids in with a molecular mass of 4 This and the open reading frame is functional expressed in COS-7 cells mammalian PDEs to a conserved of approximately amino acid representing the catalytic domain of each of these J.A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). within this are either or from to and PDE families. is in that of these very highly conserved amino acids are and to the end of the catalytic The amino acids identified here in mouse are conserved in St. J. Biol. Scopus Google Scholar) 4 is an of the end of the catalytic domain from of each of the families of PDEs. The first 4 is a from a that is other known PDEs to a at this in PDE9. two 4 is less This results in the of a conserved in other mammalian PDEs to a at this in PDE9. The within is a from the conserved and to the and the of these has not been to it is that of these from the highly conserved amino acids participate in the unique kinetic of kinetic and of several PDE catalytic will to determine functional these functional activity for and to further this novel PDE, a cDNA from clones for and the full open reading frame reported here the for expression in mammalian This was COS-7 cells, and PDE activity was h. A K m cGMP PDE activity that was higher on in cells with cells was This activity does not to and cGMP activity is not by to 100 μm not This that is very specific for the hydrolysis of cGMP were done in on two different of COS-7 cell with PDE9. cGMP hydrolysis from cells were from corresponding of that this PDE has m of μm of This is the lowest K m for cGMP for a phosphodiesterase to is specific for the hydrolysis of cGMP, it is of to this PDE with other cGMP specific PDEs. a report J. Pharmacol. 1994; PubMed Scopus Google Scholar) has on the of novel cGMP phosphodiesterases based on kinetic and inhibitor of a purified this activity is not likely to represent because is at least a m for substrate these PDEs. this purified PDE is inhibited by with an IC50 of 10 the for is than μm two other known mammalian PDEs are specific for the hydrolysis of cGMP, PDE5 and PDE6, also known as the retinal PDE, is regulated by the of an γ of PDE activity is by activated transducin in to PDE is also to regulated by the of cGMP at noncatalytic this of of is not well Proc. Natl. Acad. Sci. U. S. A. 1994; PubMed Scopus Google Scholar, J. Biol. PubMed Google Scholar, A. A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, A. S. M. J. J. Biol. 1996; PubMed Scopus Google Scholar). has a K m of μm J.A. J. Biol. PubMed Google approximately times higher than that of PDE9. PDE5 is also cGMP-specific and binds cGMP at a noncatalytic of cGMP at this noncatalytic site is to of regulatory on PDE has been to (1Beavo J.A. Physiol. Rev. 1995; 75: 725-748Crossref PubMed Scopus (1643) Google Scholar). This PDE has a K 4 μm T.M. J. Biol. PubMed Google which is at least times higher than that of PDE9. is the first cGMP-specific PDE to identified that does not a to that of the noncatalytic conserved both PDE5 and J.A. Proc. Natl. Acad. Sci. U. S. A. 1990; PubMed Scopus Google of expressed in COS-7 for PDE were done as described and is not inhibited well by of the at for the new PDE5 and inhibitor SCH has an 15 times higher for SCH than PDE5 and is not inhibited well by the inhibitor in a new were done as described and is not inhibited well by of the at for the new PDE5 and inhibitor SCH has an 15 times higher for SCH than PDE5 and is not inhibited well by the inhibitor were on COS-7 cell activity from to higher than COS-7 cGMP PDE cGMP PDE activity was and inhibitor were from the of were done in on two cGMP was to these reactions so that the final substrate were only by the addition of to the reaction these the approach the K cGMP-specific PDE this PDE is not inhibited well by of the PDE inhibitors, the inhibitor than is to that this PDE is also not inhibited by the inhibitor M. J. Res. 1996; Google Scholar) the PDE5 and inhibitor at within PDE5 and inhibitor, will at is not inhibited well by or the PDE5 or inhibitors, it is inhibited by the new PDE 1 and PDE5 inhibitor SCH with an IC50 of 1.55 μm. This is only 15 times higher than the IC50 of SCH for both and both of which have an IC50 of approximately μm S. M. A. D. M. J. Pharmacol. 1996; PubMed Scopus Google Scholar). the biologic of SCH have been done to such has this to have and S. M. A. D. M. J. Pharmacol. 1996; PubMed Scopus Google Scholar). this SCH inhibited with an IC50 of 10 μm. Additionally, this also inhibited and of cGMP was at these inhibitor of rat SCH inhibited SCH in is that of these results to of in addition to of either or of by SCH also to for for selective and of PDE9. SCH in of in or cells that have or or PDE5 phosphodiesterase A search of GenBank™ using sequence as a query this PDE is slightly to a recently D. PDE, RegA (3Shaulsky G. Escalante R. Loomis W.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15260-15265Crossref PubMed Scopus (147) Google than to of the known mammalian PDEs. Alignment of the conserved domain of RegA to that of shows that amino acid sequence identity these two which higher than that for of the mammalian PDEs is that these two PDEs to in the gene The of this higher of homology to RegA is unknown at this it that these two not functionally because they not the substrate W.F. G. J. Sci. PubMed Google Scholar) and also not homology of the conserved has that the sequence of RegA is highly to that of in and lower that this PDE a in to an acid to PDE activity (3Shaulsky G. Escalante R. Loomis W.F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15260-15265Crossref PubMed Scopus (147) Google Scholar). that has only been described in mammalian cells in a B. 1995; PubMed Scopus Google Scholar, S. J. Biol. 1994; PubMed Google and has only recently been to with J. Biol. PubMed Scopus Google Scholar, J. Biol. 1995; PubMed Scopus Google Scholar). The terminus of does not to homology to and does not homology to the of RegA that is to The slightly higher of these PDEs that in and that RegA and are in to each other than recently mammalian PDEs. is of to that of the amino acid within the conserved of two of these are also in RegA and 4 to the that these two PDEs are to each other than to of the other mammalian PDEs. functional characterization of both RegA and will to determine whether this sequence homology to unknown functional at this it is unknown the identification and of this new family will in these in is to the specific hydrolysis of cGMP, in the of signal transduction that of expressed in kidney by activity M. M.S. Lowe S. PubMed Scopus Google Scholar, J. Biol. PubMed Google Scholar, J. R. R. PubMed Scopus Google Scholar). is highly expressed at the mRNA in it is to that this novel PDE participate in this by cGMP levels at by the cGMP by cGMP levels have that of cGMP hydrolysis by of at higher will the of on in J. 1990; PubMed Scopus Google Scholar, Proc. Natl. Acad. Sci. U. S. A. 1990; PubMed Scopus Google Scholar). are known to within the and J. Physiol. Google it will to determine the cellular of in
Soderling et al. (Mon,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: