Tandem Promoters and Developmentally Regulated 5′- and 3′-mRNA Untranslated Regions of the Mouse Scn5a Cardiac Sodium Channel

The SCN5A gene encodes a voltage-sensitive sodium channel expressed in cardiac and skeletal muscle. Coding region mutations cause cardiac sudden death syndromes and conduction system failure. Polymorphisms in the 5′-sequence adjacent to the SCN5A gene have been linked to cardiac arrhythmias. We identified three alternative 5′-splice variants (1A, 1B, and 1C) of the untranslated exon 1 and two 3′-variants in the murine Scn5a mRNA. Two of the exon 1 isoforms (1B and 1C) were novel when compared with the published human and rat SCN5A sequences. Quantitative real time PCR results showed that the abundance of the isoforms varied during cardiac development. The 1A, 1B, and 1C mRNA splice variants increased 7.8 ± 1.7-fold (E1A), 6.0 ± 1.0-fold (E1B), and 20.6 ± 3.7-fold (E1C) from fetal to adult heart, respectively. Promoter deletion and luciferase reporter gene analysis using cardiac and skeletal muscle cell lines demonstrated a pattern of distinct cardiac-specific enhancer elements associated with exons 1A and 1C. In the case of exon 1C, the enhancer element appeared to be within the exon. A 5′-repressor preceded each cardiac enhancer element. We concluded that the murine Na+ channel has both 5′- and 3′-untranslated region mRNA variants that are developmentally regulated and that the promoter region contains two distinct cardiac-specific enhancer regions. The presence of homologous human splicing suggests that that these regions may be fruitful new areas of study in understanding cardiac sodium channel regulation and the genetic susceptibility to sudden death. The SCN5A gene encodes a voltage-sensitive sodium channel expressed in cardiac and skeletal muscle. Coding region mutations cause cardiac sudden death syndromes and conduction system failure. Polymorphisms in the 5′-sequence adjacent to the SCN5A gene have been linked to cardiac arrhythmias. We identified three alternative 5′-splice variants (1A, 1B, and 1C) of the untranslated exon 1 and two 3′-variants in the murine Scn5a mRNA. Two of the exon 1 isoforms (1B and 1C) were novel when compared with the published human and rat SCN5A sequences. Quantitative real time PCR results showed that the abundance of the isoforms varied during cardiac development. The 1A, 1B, and 1C mRNA splice variants increased 7.8 ± 1.7-fold (E1A), 6.0 ± 1.0-fold (E1B), and 20.6 ± 3.7-fold (E1C) from fetal to adult heart, respectively. Promoter deletion and luciferase reporter gene analysis using cardiac and skeletal muscle cell lines demonstrated a pattern of distinct cardiac-specific enhancer elements associated with exons 1A and 1C. In the case of exon 1C, the enhancer element appeared to be within the exon. A 5′-repressor preceded each cardiac enhancer element. We concluded that the murine Na+ channel has both 5′- and 3′-untranslated region mRNA variants that are developmentally regulated and that the promoter region contains two distinct cardiac-specific enhancer regions. The presence of homologous human splicing suggests that that these regions may be fruitful new areas of study in understanding cardiac sodium channel regulation and the genetic susceptibility to sudden death. The voltage-sensitive sodium channel (Nav1.5) α-subunit is encoded by the SCN5A gene, and its product is the main determinant of Na+ influx and excitability in cardiac cells. In humans, mutations of the coding region cause sudden death syndromes such as long QT type 3 (1Bezzina C.R. Rook M.B. Wilde A.A.M. Cardiovasc. Res. 2001; 49: 257-271Crossref PubMed Scopus (104) Google Scholar), idiopathic ventricular fibrillation (2Antzelevitch C. Brugada P. Brugada J. Brugada R. Shimizu W. Gussak I. Perez Riera A.R. Circ. Res. 2002; 91: 1114-1118Crossref PubMed Scopus (206) Google Scholar, 3Baroudi G. Deschenes I. Guicheney P. Chahine M. Circulation. 1999; 100: 278Google Scholar, 4Baroudi G. Carbonneau E. Pouliot V. Chahine M. FEBS Lett. 2000; 467: 12-16Crossref PubMed Scopus (60) Google Scholar, 5Baroudi G. Pouliot V. Denjoy I. Guicheney P. Shrier A. Chahine M. Circ. Res. 2001; 88: E78-E83Crossref PubMed Google Scholar, 6Baroudi G. Acharfi S. Larouche C. Chahine M. Circ. Res. 2002; 90: E11-E16Crossref PubMed Scopus (93) Google Scholar, 7Chen Q.Y. Kirsch G.E. Zhang D.M. Brugada R. Brugada J. Brugada P. Potenza D. Moya A. Borggrefe M. Breithardt G. Ortiz-Lopez R. Wang Z. Antzelevitch C. O'Brien R.E. Schulze-Bahr E. Keating M.T. Towbin J.A. Wang Q. Nature. 1998; 392: 293-296Crossref PubMed Scopus (1545) Google Scholar), and progressive cardiac conduction defect (8Probst V. Schott J.J. Kyndt F. Le Marec H. Circulation. 2000; 102: 281Google Scholar, 9Watson J. Haites N.E. Dean J.C.S. J. Med. Genet. 2000; 37: S82Google Scholar). Recent reports indicated that polymorphisms of sequences 5′ to the human SCN5A gene might contribute to cardiac arrhythmias in the general population (10Yang P. Kupershmidt S. Roden D.M. Cardiovasc. Res. 2004; 61: 56-65Crossref PubMed Scopus (53) Google Scholar). The Nav1.5 sodium channel is prominently expressed in heart but has been detected also in prenatal skeletal muscle (11Kallen R.G. Sheng Z.H. Yang J. Chen L.Q. Rogart R.B. Barchi R.L. Neuron. 1990; 4: 233-242Abstract Full Text PDF PubMed Scopus (230) Google Scholar) and jejunal circular smooth muscle (12Ou Y. Gibbons S.J. Miller S.M. Strege P.R. Rich A. Distad M.A. Ackerman M.J. Rae J.L. Szurszewski J.H. Farrugia G. Neurogastroenterol. Motil. 2002; 14: 477-486Crossref PubMed Scopus (68) Google Scholar). All or parts of the cardiac SCN5A gene have been cloned from several species, including humans, rats, mice, cows, dogs, and guinea pigs. Each of these genes shows a high degree of homology. For example, between humans, rats, and mice, coding region homology is as high as 99%, and genomic structure is maintained in all species for which the sequences are known. Cardiac sodium channel dysfunction as the result of coding region mutations has been well described. Mutations can result in changes of the gating kinetics of the channel, expression level, and distribution pattern on the cell membrane (12Ou Y. Gibbons S.J. Miller S.M. Strege P.R. Rich A. Distad M.A. Ackerman M.J. Rae J.L. Szurszewski J.H. Farrugia G. Neurogastroenterol. Motil. 2002; 14: 477-486Crossref PubMed Scopus (68) Google Scholar, 13Herfst L.J. Rook M.B. Jongsma H.J. J. Mol. Cell. Cardiol. 2004; 36: 185-193Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). On the other hand, little is known about the transcriptional and translational regulation of SCN5A that seem to be important determinants of channel expression. One report suggesting the importance of this type of regulation showed that anti-arrhythmic drugs could up-regulate cardiac Na+ channel mRNA and subsequent current expression (14Kang J.X. Li Y.Y. Leaf A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2724-2728Crossref PubMed Scopus (50) Google Scholar). Moreover, heart failure and atrial fibrillation have been shown to reduce Na+ channel mRNA abundance (15Gaspo R. Bosch R.F. Bou-Abboud E. Nattel S. Circ. Res. 1997; 81: 1045-1052Crossref PubMed Scopus (212) Google Scholar, 16Yue L.X. Melnyk P. Gaspo R. Wang Z.G. Nattel S. Circ. Res. 1999; 84: 776-784Crossref PubMed Scopus (314) Google Scholar), and this may have a role in the pathophysiology of these conditions. The promoter regions of a few voltage-gated Na+ channels have been studied. These include the brain sodium channel II (SCN2A) (17Lu C.M. Eichelberger J.S. Beckman M.L. Schade S.D. Brown G.B. J. Mol. Neurosci. 1998; 11: 179-182Crossref PubMed Scopus (8) Google Scholar, 18Schade S.D. Brown C.B. Mol. Brain Res. 2000; 81: 187-190Crossref PubMed Scopus (17) Google Scholar) and one type of skeletal muscle sodium channel (rSkM2) (19Sheng Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar, 20Zhang H. Maldonado M.N. Barchi R.L. Kallen R.G. Gene Expr. 1999; 8: 85-103PubMed Google Scholar). Recently, Yang et al. (10Yang P. Kupershmidt S. Roden D.M. Cardiovasc. Res. 2004; 61: 56-65Crossref PubMed Scopus (53) Google Scholar) have described multiple transcription initiation sites in human SCN5A, but little else is known about the promoter region of this important channel. To investigate the regulatory elements of the Scn5a gene, we have isolated and characterized mouse genomic clones encoding the cardiac sodium channel. We identified multiple novel transcription start sites associated with three untranslated exon 1 splice variants. Also, we have identified two 3′-splice variants. The mRNA abundance of these splice variants was developmentally regulated. Promoter analysis revealed that there were two regions containing cardiac-specific elements. Each promoter region was preceded by repressor elements. Thus, the Scn5a gene showed a complex transcriptional regulation and the possibility of six mRNA variants, giving the opportunity of translational control. Transcriptional or translational alterations might contribute to variations in Na+ channel current and the risk for arrhythmia. Cloning of the Mouse Scn5a Gene—PCR primers RHI28F/R (Table I) were used to screen Down-To-The-Well 129sv/J mouse embryonic stem cell bacterial artificial chromosome (BAC) 1The abbreviations used are: BAC, bacterial artificial chromosome; RACE, rapid amplification of cDNA ends; TSS, transcription start site; Pa, promoter A; Pb, promoter B; UTR, untranslated region; RT, reverse transcription. DNA pools (Genome Systems, St. Louis, MO). The primers were designed based upon the reported rat cardiac sodium channel gene exon 28 cDNA sequence (Gen-Bank™ accession number M27902). Two positive BAC clones on vector pBeloBAC11, GS 24810 and 24811, were found to contain Scn5a sequences. Sequencing the ends of BAC clone 24810 confirmed that this BAC contained a fragment of mouse chromosome 9. Subsequent sequencing of the entire region containing the Scn5a gene was carried out with a series of primers.Table IPCR PrimersPrimer pairOligo sequence (5′ to 3′) forward/reverse primersLocationApplicationRHI28F/RGCATGGCCAACTTCGCTTACGExon 28Screening BAC clone/CCGGGAGGTTATCACTGGTGSP5′primer/TGGTGGCACTGAACCGGAAGATGExon 3RACE-PCRGSP3′AGCGAGAGGGACTCATTGCCTACATExon 28RACE-PCRE1AFCCAAGCCCTACGCCGAACExon 1ART-PCRE1BFGCCCTGAGAGGAAGTGAAGCTExon 1BRT-PCRE1CFGCTGCCTCTATGCCTCAGCTTExon 1CRT-PCRrtpcr/R/TGGTGCCCCGAGGTAACAExon 2RT-PCREPF/RTGGATCTGGCAGGATTTCATAGTGPromoter APromoter analysis/CTTGCTTTGACCTGTACAGACTCGCAPF-KpnIggggtaccCCGTCGACATATGGAGCAGCGATGPromoter BPromoter analysis/APR-BgIII/gaagatctCACAGGCTCTCCTCAGGCTGCCTAHE1FAGTCTAGCTAGGGACGGTGCTGCExon 1CPromoter analysisAHI1FGGTTTGATTTGCACCTCTTGTGTGIntron 1CPromoter analysisHRE1FGCCGCTGAGCCTGCGCCCGCTGCExon 1APCRmE2R/CTTCTCATCCTGCTTCTGGGGGCAExon 2PCR Open table in a new tab Characterization of the 5′- and 3′-Ends of Scn5a Transcript by Rapid Amplification of cDNA Ends—Heart tissue from CD1 adult and 16-day postcoitum embryos was homogenized, and total RNA was isolated using the RNeasy minikit following the manufacturer's instructions (Qiagen, Valencia, CA). RNA ligase-mediated rapid amplification of cDNA ends (RACE) methods were used to characterize the 5′- and 3′-ends of the mouse Scn5a mRNA using a GeneRacer kit (Invitrogen). Briefly, 1 μg of total RNA was treated with calf intestinal phosphatase to remove the 5′-phosphates of the truncated mRNA and non-mRNA forms of total RNA. Tobacco acid pyrophosphatase was used to remove the 5′-cap structure from intact full-length mRNA, and T4 RNA ligase was used to add the GeneRacer RNA oligo to the 5′-end of the mRNA. The first strand cDNA was synthesized by SuperScript II reverse transcription using a reverse gene-specific primer GSP5′ (Table I) complementary to exon 3 of the mouse Scn5a gene and the GeneRacer oligo(dT) primer at the 5′- and 3′-ends, respectively. The 5′- and 3′-end PCR reactions were performed with platinum Pfx DNA polymerase using 10 μm GSP5′ and the GeneRacer 5′-primer for amplifying the 5′-end fragment and using 10 μm the forward GSP3′ (Table I) complementary to exon 28 of the mouse Scn5a and the GeneRacer oligo(dT) primer to obtain the 3′-end. An additional PCR reaction with nested primers was performed. The nested PCR products were cloned into pCRII-TOPO vector (Invitrogen) and sequenced to confirm that the RACE-PCR products were from the Scn5a cDNA. For the 3′-untranslated region (UTR) splice variants, relative mRNA variant abundance was analyzed by gel densitometry of the PCR results using the Image-Quant software (Amersham Biosciences) and normalized to the abundance of β-actin. Primary DNA sequence analysis was performed with the Vector NTI 6 software (Informax, Frederick, MD). The sequences were aligned to mouse genomic DNA and cDNA sequences in the GenBank™ data base to identify transcription start sites (TSSs) and The promoter region was for using the and for transcription sites by using for of Scn5a the abundance of cardiac variant exon 1 total RNA from adult and 16-day postcoitum embryos were isolated using the RNeasy minikit with the of I. transcription was carried out at for 1 with reverse 1 μg of total and 10 μm The first strand cDNA was used as a for subsequent Each PCR reaction contained of PCR kit and μm primer in a total reaction The forward primers for exon 1 variants were and (Table The reverse primer (Table I) was in each The reactions to and PCR respectively. All were performed in and of of at at and 1 at in a PCR products were analyzed by on was used as a when of the total of the region two Scn5a promoter regions were by PCR using the primer and (Table I) using DNA polymerase to obtain PCR products with high and BAC clone 24810 was used as a The primers a to as promoter A A the entire was cloned into (Invitrogen) and into the sites of the vector as containing the fragment from to of the Scn5a gene first base of the start is to as A series of with with and and by the promoter A reporter to to to and to and with and and a promoter A fragment from to to as The primer (Table I) a DNA fragment as to promoter containing to of fragment was cloned into the sites of the luciferase reporter and was The primer to and to were used to exon 1C) and containing exon respectively. The PCR products were cloned into and into at the and Cell and rat embryonic cell number and the murine skeletal cell from were in (Invitrogen) with fetal calf tissue at were at and were in each well of and to of μg of each and the was carried out with 10 of or following the manufacturer's in for the were treated with and cell were for analysis of luciferase and using of luciferase and of was in using software The and and were used in all as positive and respectively. of the reporter was by to The luciferase of all of the promoter was normalized to a control. three were and at each were performed in were for each All data are as ± analysis of was carried out using or of Mouse Cardiac Scn5a of the mouse BAC for exon 28 of Scn5a identified two genomic BAC clones containing mouse cardiac sodium channel sequences. and sequencing confirmed the presence of BAC clone 24810 was used in all as the genomic DNA Sequencing at BAC vector sites the presence of the entire Scn5a genomic DNA fragment with of 5′- and of sequences. The Scn5a gene was in including the 5′- and of 5′- and Two both and rats, analysis shows that the SCN5A mRNA is (19Sheng Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar, 20Zhang H. Maldonado M.N. Barchi R.L. Kallen R.G. Gene Expr. 1999; 8: 85-103PubMed Google Scholar, Chen L.Q. Chahine M. R. Barchi R.L. Kallen R.G. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). The first mouse Scn5a cDNA for this channel accession number was with a 5′-end to of the and a which is published human and rat we to the reported mouse sequences the of the mouse The was to the 5′- and ends of the start and of the respectively. PCR amplification of cDNA several distinct on gel Subsequent nested PCR amplification two and in fetal heart RNA and one in adult heart RNA of these showed that the and were Scn5a A between the products and genomic sequences showed that there were two exon 1 one was and of exon was or and was by from exon the we were to obtain the exon 1 reported L.J. J. 2004; Scholar), suggesting that a total of three exon 1 splice variants possibility was confirmed by PCR using the primers and (Table a exon 1 of the exon. We these untranslated cDNA exon 1A exon and exon 1C or respectively. 1A, identified by primer and has been reported in human and rat J. Haites N.E. Dean J.C.S. J. Med. Genet. 2000; 37: S82Google Scholar, 18Schade S.D. Brown C.B. Mol. Brain Res. 2000; 81: 187-190Crossref PubMed Scopus (17) Google Scholar) with a from to (10Yang P. Kupershmidt S. Roden D.M. Cardiovasc. Res. 2004; 61: 56-65Crossref PubMed Scopus (53) Google Scholar, Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar). the sequences containing exon 1A reported in the full-length clones were using are several for the failure of analysis to identify this exon 1 One possibility is that the high and within 3 of the region a complex structure that polymerase We several of each of the Scn5a exon 1 but the of was to be to high possibility is that the full-length mRNA is and in this the such as the one we used be to the is with the of multiple by the alternative methods Y. R. S. Res. 2002; PubMed Scopus Google Scholar). is that these of the showed of splice variations in fetal and adult RACE-PCR using and oligo(dT) primers (Table we identified two alternative of genomic and cDNA sequences showed that the two splicing variants. One was the and was with the published mouse Scn5a cDNA accession number there was a long variant of which to the human SCN5A cDNA accession number A of the is in 5′- and expression is developmentally regulated (11Kallen R.G. Sheng Z.H. Yang J. Chen L.Q. Rogart R.B. Barchi R.L. Neuron. 1990; 4: 233-242Abstract Full Text PDF PubMed Scopus (230) Google Scholar, Brain Res. 2000; PubMed Scopus Google Scholar). variants in the are known to expression during and of P. D. Mol. Cell. Biol. 1997; PubMed Scopus Google Scholar, G. P. J. Mol. 1999; PubMed Scopus Google Scholar, A.A.M. J. Cell Biol. 1999; PubMed Scopus Google Scholar). we novel isoforms varied during a for to the regulation of expression. We real time PCR to the relative abundance of the Scn5a mRNA splice variants. time PCR results indicated that the abundance of each exon 1 increased 7.8 ± 1.7-fold 6.0 ± 1.0-fold and 20.6 ± 3.7-fold in the adult relative to the fetal heart exon 1A as a exon 1A, 1B, and 1C mRNA abundance was ± ± and ± in fetal heart and ± ± and ± in adult heart, 1C was the in fetal heart and increased the with development. In adult heart, the relative mRNA abundance of the isoforms was The was also developmentally regulated. shown in 1C, both the and long forms of the were in fetal and adult by densitometry relative to there was in the of the long but the abundance of the was in adult heart by compared with that in fetal heart of the Scn5a Promoter shows to cardiac and skeletal muscle. is in skeletal muscle when compared with encoded by To the of this tissue we containing of the Scn5a gene of a luciferase reporter of its we the and analyzed reporter based upon two regions the entire promoter A and The luciferase of these were compared into cardiac and skeletal muscle cell In all the was normalized by with the which contained the gene of the in the promoter region revealed that exons 1A and 1C associated elements that increased in the heart cell associated with exon but 1C expression in the skeletal muscle. to containing exon 1C, showed the promoter in the ± 6.0 relative promoter sequences are shown in sequences of the mouse Scn5a the sequence region the fragment of the first containing exon 1A and of exon exon sequence the sequence region the promoter and containing exon 1C. The sequence are from the start The first exon isoforms are shown The transcription sites are shown The are shown multiple of exon 1A reported by of exon two of exon the first of exon Na+ current is for heart, and skeletal muscle In the case of heart, the SCN5A gene encodes the of Na+ The encoded Nav1.5 channel is the of anti-arrhythmic and mutations in the channel coding sequence sudden death In and humans, Nav1.5 is developmentally expressed in cardiac and skeletal and during (15Gaspo R. Bosch R.F. Bou-Abboud E. Nattel S. Circ. Res. 1997; 81: 1045-1052Crossref PubMed Scopus (212) Google Scholar, 16Yue L.X. Melnyk P. Gaspo R. Wang Z.G. Nattel S. Circ. Res. 1999; 84: 776-784Crossref PubMed Scopus (314) Google Scholar, R. Cardiol. 2002; PubMed Scopus Google Scholar, L.J. F. C.R. Le Marec H. S. I. D. Jongsma H.J. Wilde A.A.M. Rook M.B. J. Mol. Cell. Cardiol. Full Text Full Text PDF PubMed Scopus Google Scholar). its little is known about the transcriptional or translational regulation of this we report that the mouse Scn5a gene encodes for three untranslated exon 1 variants and two 3′-untranslated regions. for the possibility of six Scn5a and are important in mRNA and and or D. R. Cell. 81: Full Text PDF PubMed Scopus Google Scholar, 1997; Google Scholar), is that these sequence variations can contribute to the expression of with a regulatory role in Na+ the splice variants in relative abundance during with a of exon 1C and of the mRNA forms in adult compared with a fetal The long Scn5a sequence has the of and and has multiple sites for initiation of suggesting the possibility of complex transcriptional and translational The long Scn5a is to other and channel which also long G. J. 2002; Scholar). These multiple transcription start as the Scn5a gene (19Sheng Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar). We identified two associated with exon 1C three have been identified in the human SCN5A gene in sequences exon 1A (10Yang P. Kupershmidt S. Roden D.M. Cardiovasc. Res. 2004; 61: 56-65Crossref PubMed Scopus (53) Google Scholar). have been identified in rat muscle (19Sheng Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar). the possibility of complex the total identified promoter region contained sites for several transcription that may be including and The heart and skeletal muscle cell lines to investigate the of regulatory sequences on reporter expression. The fragment reporter expression in both cardiac and skeletal muscle. region been shown to expression in the skeletal muscle cell (19Sheng Z.H. Zhang H. Barchi R.L. Kallen R.G. DNA Cell Biol. 1994; 13: 9-23Crossref PubMed Scopus (22) Google Scholar). results with the and were to with the human SCN5A promoter region expressed in rat cardiac (10Yang P. Kupershmidt S. Roden D.M. Cardiovasc. Res. 2004; 61: 56-65Crossref PubMed Scopus (53) Google Scholar, 20Zhang H. Maldonado M.N. Barchi R.L. Kallen R.G. Gene Expr. 1999; 8: 85-103PubMed Google Scholar). The promoter regions associated with exons 1A and 1C increased expression of the reporter in a cardiac cell analysis showed and transcription sites exons 1A and 1C, with transcription of these variants in cardiac S. D. P. Biol. PubMed Scopus Google Scholar). were transcription sites in the repressor the cardiac-specific enhancer elements A.A.M. J. Cell Biol. 1999; PubMed Scopus Google Scholar). results that exon and its may be important for skeletal muscle expression of cell lines were these results may in but the possibility of complex transcriptional regulation with two cardiac-specific promoter regions. In results the possibility of complex transcriptional and translational regulation of the cardiac sodium channel. The Scn5a promoter region is and complex including repressor promoter and three untranslated exon 1 variants. The abundance of exon 1 and varied with development. these were in mice, sequence and data that the human SCN5A gene is in is that complex genetic regulation to of the Nav1.5 current during and and may be a fruitful of in syndromes that be by coding region