Key points are not available for this paper at this time.
We describe here the first characterization of CLEC9A, a group V C-type lectin-like receptor located in the “Dectin-1 cluster” of related receptors, which are encoded within the natural killer (NK)-gene complex. Expression of human CLEC9A is highly restricted in peripheral blood, being detected only on BDCA3+ dendritic cells and on a small subset of CD14+CD16- monocytes. CLEC9A is expressed at the cell surface as a glycosylated dimer and can mediate endocytosis, but not phagocytosis. CLEC9A possesses a cytoplasmic immunoreceptor tyrosine-based activation-like motif that can recruit Syk kinase, and we demonstrate, using receptor chimeras, that this receptor can induce proinflammatory cytokine production. These data indicate that CLEC9A functions as an activation receptor. We describe here the first characterization of CLEC9A, a group V C-type lectin-like receptor located in the “Dectin-1 cluster” of related receptors, which are encoded within the natural killer (NK)-gene complex. Expression of human CLEC9A is highly restricted in peripheral blood, being detected only on BDCA3+ dendritic cells and on a small subset of CD14+CD16- monocytes. CLEC9A is expressed at the cell surface as a glycosylated dimer and can mediate endocytosis, but not phagocytosis. CLEC9A possesses a cytoplasmic immunoreceptor tyrosine-based activation-like motif that can recruit Syk kinase, and we demonstrate, using receptor chimeras, that this receptor can induce proinflammatory cytokine production. These data indicate that CLEC9A functions as an activation receptor. The C-type lectins are a superfamily of proteins containing at least one C-type lectin domain (CTLD), The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1–S8. which have been classified into groups depending on the arrangement of their CTLDs (1Weis W.I. Taylor M.E. Drickamer K. Immunol. Rev. 1998; 163: 19-34Crossref PubMed Scopus (892) Google Scholar). The group V proteins, in particular, are single extracellular CTLD-containing type II transmembrane receptors, which are found only in higher vertebrates and are encoded primarily within a single gene cluster, the NK-gene complex (NKC) on chromosome 12 in human and chromosome 6 in mouse (2Zelensky A.N. Gready J.E. Febs J. 2005; 272: 6179-6217Crossref PubMed Scopus (1023) Google Scholar). Most of the group V C-type lectin receptors (CTLR) appear to be expressed exclusively by NK cells and certain subsets of T-cells and play a role in tumor and antiviral immunity (3Yokoyama W.M. Plougastel B.F. Nat. Rev. Immunol. 2003; 3: 304-316Crossref PubMed Scopus (477) Google Scholar). These receptors detect endogenous ligands, such as MHC class I molecules, and are involved in the detection of “altered-self” or “missing self” (3Yokoyama W.M. Plougastel B.F. Nat. Rev. Immunol. 2003; 3: 304-316Crossref PubMed Scopus (477) Google Scholar, 4Ito M. Maruyama T. Saito N. Koganei S. Yamamoto K. Matsumoto N. J. Exp. Med. 2006; 203: 289-295Crossref PubMed Scopus (186) Google Scholar, 5Iizuka K. Naidenko O.V. Plougastel B.F. Fremont D.H. Yokoyama W.M. Nat. Immunol. 2003; 4: 801-807Crossref PubMed Scopus (236) Google Scholar). Immune responses mediated by these CTLRs are largely determined by the balance of signals from “pairs” of inhibitory and activation receptors, which often recognize the same ligand (6Ravetch J.V. Lanier L.L. Science. 2000; 290: 84-89Crossref PubMed Scopus (1070) Google Scholar). Inhibitory receptors within this group possess immunoreceptor tyrosine-based inhibitory motifs in their cytoplasmic tails, whereas the activation receptors lack cytoplasmic signaling motifs, but associate through charged residues in their transmembrane domains with signaling partners, such as DAP12 (3Yokoyama W.M. Plougastel B.F. Nat. Rev. Immunol. 2003; 3: 304-316Crossref PubMed Scopus (477) Google Scholar). More recently, CTLRs have also been identified on other cell types, including a related subgroup of receptors, the “Dectin-1 cluster” (7Sobanov Y. Bernreiter A. Derdak S. Mechtcheriakova D. Schweighofer B. Duchler M. Kalthoff F. Hofer E. Eur. J. Immunol. 2001; 31: 3493-3503Crossref PubMed Scopus (97) Google Scholar). This cluster, which includes Dectin-1, LOX-1, CLEC-1, CLEC-2, MICL, CLEC12B, and CLEC9A, appear to have more diverse ligands and cellular functions (8Pyz E. Marshall A.S. Gordon S. Brown G.D. Ann. Med. 2006; 38: 242-251Crossref PubMed Scopus (49) Google Scholar), and the study of these receptors has provided a number of surprising new insights into innate immunity and homeostasis (9Robinson M.J. Sancho D. Slack E.C. LeibundGut-Landmann S. Reis e Sousa C. Nat. Immunol. 2006; 7: 1258-1265Crossref PubMed Scopus (429) Google Scholar). For example, Dectin-1 has been shown to be involved in the detection of “non-self” and function as a signaling pattern recognition receptor in anti-fungal immunity, whereas LOX-1 acts as a scavenger receptor, involved in the recognition of a variety of ligands including modified lipoproteins, apoptotic cells, activated platelets, hsp70, and bacteria (10Taylor P.R. Martinez-Pomares L. Stacey M. Lin H.H. Brown G.D. Gordon S. Annu. Rev. Immunol. 2005; 23: 901-944Crossref PubMed Scopus (990) Google Scholar). Furthermore, Dectin-1 and CLEC-2 have been shown to be capable of directly triggering cellular activation through cytoplasmic immunoreceptor tyrosine-based activation (ITAM)-like motifs, involving novel interactions with Syk kinase (11Rogers N.C. Slack E.C. Edwards A.D. Nolte M.A. Schulz O. Schweighoffer E. Williams D.L. Gordon S. Tybulewicz V.L. Brown G.D. Reis e Sousa C. Immunity. 2005; 22: 507-517Abstract Full Text Full Text PDF PubMed Scopus (730) Google Scholar, 12Suzuki-Inoue K. Fuller G.L. Garcia A. Eble J.A. Pohlmann S. Inoue O. Gartner T.K. Hughan S.C. Pearce A.C. Laing G.D. Theakston R.D. Schweighoffer E. Zitzmann N. Morita T. Tybulewicz V.L. Ozaki Y. Watson S.P. Blood. 2006; 107: 542-549Crossref PubMed Scopus (382) Google Scholar, 13Fuller G.L. Williams J.A. Tomlinson M.G. Eble J.A. Hanna S.L. Pohlmann S. Suzuki-Inoue K. Ozaki Y. Watson S.P. Pearce A.C. J. Biol. Chem. 2007; 282: 12397-12409Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). Here we characterize CLEC9A, a novel group V CTLR located within the “Dectin-1 cluster” of receptors and show that the molecule functions as an activation receptor on a small subset of myeloid cells. Primary Cells, Cell Lines, and Growth Conditions—Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats (Western Province Blood Transfusion Service, Cape Town, South Africa) using Ficoll-Paque™ Plus (Amersham Biosciences), as previously described (14Willment J.A. Marshall A.S. Reid D.M. Williams D.L. Wong S.Y. Gordon S. Brown G.D. Eur. J. Immunol. 2005; 35: 1539-1547Crossref PubMed Scopus (213) Google Scholar). Monocyte-derived macrophages and dendritic cells were generated from PBMCs as described (14Willment J.A. Marshall A.S. Reid D.M. Williams D.L. Wong S.Y. Gordon S. Brown G.D. Eur. J. Immunol. 2005; 35: 1539-1547Crossref PubMed Scopus (213) Google Scholar). NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines (15Yokozeki T. Adler K. Lankar D. Bonnerot C. J. Immunol. 2003; 171: 1328-1335Crossref PubMed Scopus (26) Google Scholar) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l-glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). All cells were grown at 37 °C in 5% CO2. Generation of Constructs and Transduced Cell Lines—The complete CLEC9A open reading frame (ORF) was isolated from human PBMC cDNA by PCR and cloned into the pFBneo (Stratagene) retroviral vector containing an HA tag (16Marshall A.S. Willment J.A. Lin H.H. Williams D.L. Gordon S. Brown G.D. J. Biol. Chem. 2004; 279: 14792-14802Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar) using the following primers; AAAGAATTCCCACCATGCACGAGGAAGAAATATAC and AAACTCGAGGACAGAGGATCTCAACGC. C-terminally HA-tagged murine CLEC9A (mCLEC9A) was similarly cloned from mouse splenic cDNA using the following primers; AAAGTCGACCACCATGCATGCGGAAGAAATA and GTACTCGACGATGCAGGATCCAAATGC. The CLEC9A/Dectin-1 chimera in pFBneo was generated using overlap extension PCR with primers CTGCTAAACTTTACAGAAAACCACAAGCCCACA and TCTGGGCTTGTGGTTTTCTGTAAAGTTTAGCAG such that the sequence translated as The was generated by PCR using the following primers; and and cloned into the vector from the human generated as described Willment J.A. Williams D.L. Taylor P.R. Gordon S. K. Brown G.D. J. Immunol. 2006; PubMed Scopus Google Scholar). The of was by and murine CLEC9A and have been at the following cell were into using HEK293T-based Phoenix ecotropic cells, and the cell lines were as previously described (16Marshall A.S. Willment J.A. Lin H.H. Williams D.L. Gordon S. Brown G.D. J. Biol. Chem. 2004; 279: 14792-14802Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). All cell lines were as to and were generated and at least to cell lines were and maintained in mg/ml or CLEC9A was by PCR of human cDNA using the following primers the and was by PCR of mouse cDNA using the same murine primers described Expression of was as a Generation of a CLEC9A, was generated by of with a were and from cells were by The was on to function in and and cellular cells were with and in mm mm mm supplemented with at were by and were and at of cell were determined by and of were on to to (Amersham Biosciences), CLEC9A was detected by with or by were with the (Amersham Cell were with with as described by the and Cell were by on a Biosciences), to at °C in the of 2 mm were in containing mm and 5% heat-inactivated serum or murine serum and human in human cells and to the of were with in to The following were in these (a gift from L. University), and or mouse and were detected using were using cells isolated as described were with 5% mouse serum or human at were with at by and cells were using The cells were at °C the and surface as described The cells of the of PBMCs and were cells within the were the NIH3T3 or RAW264.7 cells were at and in the the the of the cells were and with containing mm mm and 5% heat-inactivated serum at were with or and at °C and with mm and mm to was and the cells at in medium to and the cells were in medium the at 37 or were with and receptor surface by as described For cells were at 2 on in the the were the same as the only with at °C and with to were at 37 °C or °C in the cells were in of mm in 20 The groups were with mm in and with 20 were with and with 20 were with of at and with were with and from at and with were with and by on a were using version and and NIH3T3 were at in the the were a gift from and the cells 20 at °C to of the Dectin-1 G.D. Gordon S. 2001; PubMed Scopus Google Scholar). the of cells were at °C to and to For the of RAW264.7 cells were and the of into the was determined by For cells were in and the of was by using a II For the of the and Syk-deficient 2 cells were with in at 37 into the was by was at by NIH3T3 or RAW264.7 macrophages were at 2 in the the cells were with at 37 to and was maintained the were and was and to at this was by and the cells at 2 or to The of was determined by as previously described J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar). was with (Invitrogen), which was detected with was by on the cell which and the of was determined by the the cell The of by was that the cells were at on cell of were and the cells to the at 37 this the cells were with and with in at was with were with and by on a were using version RAW264.7 cells were with at 37 and the cells in mm mm mm mm mm with and cell were by and the were to with or The CLEC9A were generated and to the following of the cytoplasmic of the receptor, The Dectin-1 have been described previously (11Rogers N.C. Slack E.C. Edwards A.D. Nolte M.A. Schulz O. Schweighoffer E. Williams D.L. Gordon S. Tybulewicz V.L. Brown G.D. Reis e Sousa C. Immunity. 2005; 22: 507-517Abstract Full Text Full Text PDF PubMed Scopus (730) Google Scholar). The were 2 at °C and to by in the were detected with and or by and of previously identified as an gene of 6 within the “Dectin-1 cluster” of C-type lectin-like receptors, in the NK complex on chromosome 12 (7Sobanov Y. Bernreiter A. Derdak S. Mechtcheriakova D. Schweighofer B. Duchler M. Kalthoff F. Hofer E. Eur. J. Immunol. 2001; 31: 3493-3503Crossref PubMed Scopus (97) Google Scholar, A.S. Willment J.A. Lin H.H. Williams D.L. Gordon S. Brown G.D. J. Biol. Chem. 2004; 279: 14792-14802Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar) that encoded a type II transmembrane of with a of CLEC9A possesses a of group V C-type lectin-like receptors (2Zelensky A.N. Gready J.E. Febs J. 2005; 272: 6179-6217Crossref PubMed Scopus (1023) Google Scholar), of a single extracellular to the transmembrane domain by a and an cytoplasmic with signaling The of CLEC9A possesses the which are to be involved in and of the but the residues involved in and found in the C-type lectins (1Weis W.I. Taylor M.E. Drickamer K. Immunol. Rev. 1998; 163: 19-34Crossref PubMed Scopus (892) Google Scholar). The of CLEC9A possesses involved in receptor and a single The cytoplasmic contains a single within a sequence to the sequence of Dectin-1 G.D. Gordon S. 2001; PubMed Scopus Google Scholar). characterize the of we cloned and expressed an HA-tagged version of the receptor in NIH3T3 Dectin-1 G.D. Gordon S. 2001; PubMed Scopus Google Scholar) was as a we that was expressed at the cell surface that to the other receptors in the Dectin-1 cluster, CLEC9A not an (8Pyz E. Marshall A.S. Gordon S. Brown G.D. Ann. Med. 2006; 38: 242-251Crossref PubMed Scopus (49) Google Scholar). of from the NIH3T3 cells, that was expressed as of more to of of and of the cell with which the of to of this and The of a in these cell which was also with Dectin-1, be to other this is to be as with not the of this these data indicate that is expressed as a glycosylated dimer at the cell The Dectin-1 of receptors is L. J. M. S. A. 2006; PubMed Scopus Google Scholar), and we identified the murine on and The encoded by murine is to human CLEC9A, and of the described including the signaling motifs from the the murine receptor to possess an and one of the residues in the these to the human receptor, we the of murine CLEC9A expressed in NIH3T3 the human receptor, was expressed at the cell but that was not glycosylated and that the receptor was expressed as a Expression of CLEC9A on Primary and first the of CLEC9A by using which the from cDNA isolated from a variety of CLEC9A was detected in with in the and a single was that were The murine was expressed in but a number of were which were shown to be to of these lack one or more as found in other C-type was an containing a which the by characterize CLEC9A we generated a by with a was as this human CLEC9A, as by and and not detect CLEC9A by or in not We of CLEC9A by human peripheral blood, of CLEC9A be detected on only a small number of PBMCs with the of detected by in characterize these cells we by cell and that the isolated cells expressed CLEC9A by single with we were to that cells expressed and The of these cells expressed A. A. S. M. S. J. J. Immunol. 2000; PubMed Scopus Google Scholar), but we also detected of cells and with these that CLEC9A is expressed on of cells, BDCA3+ dendritic cells and a of cells, which we were to These cells were of as as including and not of PBMCs that CLEC9A was expressed on BDCA3+ cells, 5% of cells, of cells, and of cells not peripheral macrophages, and dendritic cells not CLEC9A not CLEC9A is expressed by BDCA3+ but also on a subset of CD14+CD16- as as a of cells, which to be CLEC9A an the in cells we to the function of this receptor in cell are involved in J. 2007; PubMed Scopus Google Scholar) and as the cytoplasmic of this molecule contains motifs we the of CLEC9A to mediate For this we CLEC9A on the surface of NIH3T3 and the of this receptor from the cell surface by of CLEC9A to a of the receptor at the cell with cells maintained at that the receptor was of the Dectin-1, which is also to mediate J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar), was as a were in RAW264.7 macrophages in which we also the of of which with the These data indicate that CLEC9A is an receptor. CLEC9A contains a tyrosine-based which is to that shown to mediate in Dectin-1 J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar), we the that CLEC9A also mediate the ligand CLEC9A is we a receptor an HA-tagged extracellular domain of Dectin-1, to the cytoplasmic and transmembrane of CLEC9A This chimera to CLEC9A signaling using a ligand of Dectin-1 G.D. Gordon S. 2001; PubMed Scopus Google Scholar). We expressed the receptor, as as HA-tagged CLEC9A and Dectin-1, in RAW264.7 macrophages and the of these cells to recognize and The of these receptors at the cell surface was by G.D. Gordon S. 2001; PubMed Scopus Google Scholar, G.D. J. Williams D.L. Willment J.A. Marshall Gordon S. J. Exp. Med. 2003; PubMed Scopus Google Scholar), the of Dectin-1 the to in a and of were also with cells the receptor cells with vector only or were to recognize We determined the of these cells to by the cells at 37 °C and the of by and as described and supplemental cells were also with to and and were as in these Dectin-1 mediated the of in an J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar), but we also that macrophages the receptor were to mediate The of complex can receptors, and to the of a receptor of this expressed in cells such as NIH3T3 cells J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar, C. J. Biol. 2005; PubMed Scopus Google Scholar, K. A. J. Exp. Med. PubMed Scopus Google Scholar, S. A.D. Blood. PubMed Google Scholar). We expressed the receptor in these and the of these cells to of the chimera and Dectin-1, but not vector only or CLEC9A, the on these cells to in a and supplemental previously J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar), Dectin-1 mediated in these cells, whereas the receptor, not induce and is not a receptor. CLEC9A to the tyrosine-based motif of Dectin-1 can induce a variety of cellular including the of proinflammatory in to G.D. Nat. Rev. Immunol. 2006; PubMed Scopus Google Scholar). we the that signaling CLEC9A similarly induce in the RAW264.7 macrophages with the receptor. described the of Dectin-1 and the receptor in of in these cells Furthermore, Dectin-1 G.D. J. Williams D.L. Willment J.A. Marshall Gordon S. J. Exp. Med. 2003; PubMed Scopus Google Scholar) and the receptor of in to we have previously shown that Dectin-1 a cytoplasmic can mediate but not the of G.D. J. Williams D.L. Willment J.A. Marshall Gordon S. J. Exp. Med. 2003; PubMed Scopus Google Scholar), indicate that the cellular by the receptor is to the of the CLEC9A cytoplasmic these data Dectin-1, CLEC9A signaling can induce a proinflammatory CLEC9A and Syk cytokine mediated by Dectin-1 signaling Syk G.D. Nat. Rev. Immunol. 2006; PubMed Scopus Google Scholar, E. Willment J.A. Taylor P.R. A. Gordon S. F. Schweighoffer E. Tybulewicz Williams D.L. M.G. Brown G.D. Eur. J. Immunol. 38: PubMed Scopus Google Scholar), we the that this kinase was involved in the signaling mediated by For we generated and of to the cytoplasmic of CLEC9A and These were to signaling from RAW264.7 cell which were by with with a of in with of CLEC9A and Dectin-1, which we to be Syk by with We were also to show an with the kinase, which is to be involved in of motifs ligand A. K. A. J. Immunol. PubMed Scopus Google Scholar). that CLEC9A induce signaling Syk kinase, we expressed the receptor in and Syk-deficient B-cell lines and their to This was to that we previously to the of Dectin-1 (11Rogers N.C. Slack E.C. Edwards A.D. Nolte M.A. Schulz O. Schweighoffer E. Williams D.L. Gordon S. Tybulewicz V.L. Brown G.D. Reis e Sousa C. Immunity. 2005; 22: 507-517Abstract Full Text Full Text PDF PubMed Scopus (730) Google Scholar). The receptor was expressed at in cell types, as determined by The of to the the receptor the of this was in vector cells and in the Syk-deficient B-cell Furthermore, we also the in the cells by including the Syk CLEC9A can mediate signaling Syk We describe here the first characterization of human CLEC9A and that functions as an activation receptor, capable of triggering signaling Syk This is mediated by the cytoplasmic of the CLEC9A that contains a single tyrosine-based which can be to be an motif J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar). These were first identified in other receptors of the Dectin-1 cluster, Dectin-1 (11Rogers N.C. Slack E.C. Edwards A.D. Nolte M.A. Schulz O. Schweighoffer E. Williams D.L. Gordon S. Tybulewicz V.L. Brown G.D. Reis e Sousa C. Immunity. 2005; 22: 507-517Abstract Full Text Full Text PDF PubMed Scopus (730) Google Scholar), and more CLEC-2 K. Fuller G.L. Garcia A. Eble J.A. Pohlmann S. Inoue O. Gartner T.K. Hughan S.C. Pearce A.C. Laing G.D. Theakston R.D. Schweighoffer E. Zitzmann N. Morita T. Tybulewicz V.L. Ozaki Y. Watson S.P. Blood. 2006; 107: 542-549Crossref PubMed Scopus (382) Google Scholar). the of Syk signaling these motifs is domains of this kinase G.L. Williams J.A. Tomlinson M.G. Eble J.A. Hanna S.L. Pohlmann S. Suzuki-Inoue K. Ozaki Y. Watson S.P. Pearce A.C. J. Biol. Chem. 2007; 282: 12397-12409Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar) and of receptor (11Rogers N.C. Slack E.C. Edwards A.D. Nolte M.A. Schulz O. Schweighoffer E. Williams D.L. Gordon S. Tybulewicz V.L. Brown G.D. Reis e Sousa C. Immunity. 2005; 22: 507-517Abstract Full Text Full Text PDF PubMed Scopus (730) Google Scholar). myeloid cells, mediated signaling through Syk has largely been with this kinase through a novel involving O. A. K. M. T. C. J. 2006; PubMed Scopus Google Scholar) and can induce a variety of cellular responses including the of as and the and the of G.D. Nat. Rev. Immunol. 2006; PubMed Scopus Google Scholar, S. O. M.J. F. Slack E.C. Schweighoffer E. Tybulewicz Brown G.D. J. Reis Nat. Immunol. 2007; PubMed Scopus Google Scholar). signaling this was shown to induce type responses in S. O. M.J. F. Slack E.C. Schweighoffer E. Tybulewicz Brown G.D. J. Reis Nat. Immunol. 2007; PubMed Scopus Google Scholar). CLEC9A can this is that this receptor be to induce not of these which be by to The motif of Dectin-1 also J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar). we that CLEC9A induce in macrophages, was to expressed in NIH3T3 cells. the of a receptor is to to cell we that CLEC9A is not directly to mediate the RAW264.7 macrophages, is that the of endogenous Dectin-1 were to this G.D. Taylor P.R. Reid D.M. Willment J.A. Williams D.L. Martinez-Pomares L. Wong Gordon S. J. Exp. Med. Scopus Google Scholar). through novel J. Marshall E. Edwards A.D. Williams D.L. Schweighoffer E. Tybulewicz V.L. Reis e Sousa C. Gordon S. Brown G.D. Blood. 2004; PubMed Scopus Google Scholar), which are and residues D.M. E. Blood. 2005; PubMed Scopus Google Scholar) that are in The characterization of CLEC9A on cells was by on of peripheral blood The receptor is expressed by BDCA3+ which of PBMC K. S. 2007; Full Text PDF PubMed Scopus Google Scholar). is this cell but are to be of and were shown to receptors K. S. 2007; Full Text PDF PubMed Scopus Google Scholar, A. J. Blood. PubMed Scopus Google Scholar, D. S. E. S. C. M. D. F. A. Blood. 2007; PubMed Scopus Google Scholar). CLEC9A is also expressed on small subsets of CD14+CD16- and on cells we were to CD14+CD16- the of the PBMC and are to to of can into dendritic cells F. S. Immunity. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar, B. D. Blood. PubMed Google Scholar). The of CLEC9A on a subset of these cells is of of this and this receptor be as a to characterize this subset in the ligand and role of CLEC9A is on peripheral blood that is to function as a pattern recognition receptor. the of in the and as determined by are of a role in Furthermore, as an receptor, CLEC9A and and a as has been a variety of other C-type including Dectin-1 C. Reid D.M. Wong S.Y. J. Immunol. 2006; PubMed Scopus Google Scholar). being L. J. M. S. A. 2006; PubMed Scopus Google Scholar), the murine CLEC9A to be to human but not receptor is into a number Furthermore, murine CLEC9A is not glycosylated the receptor the of these is of of this molecule the the of cells this receptor in human blood, be study of this receptor to be in We the Province Blood Transfusion the buffy and and and We also and the and with
Huysamen et al. (Fri,) studied this question.