Primulina tabacum Hance is a widespread ornamental and medicinal plant of tropical and subtropical regions (Li et al. 2023). In 23 May 2023, symptoms including stunting, yellowing of leaves, and severe root galls were observed in P. tabacum growing in the Guilin Botanical Garden, China (GPS 25°15′0″ N; 110°16′50″ E). The investigated area of P. tabacum was approximately 0.8 ha, we evaluated 12 P. tabacum plants within the sampled area and found a root galling incidence of 50%, with an average gall index of 3.5 (on a scale of 0 to 10) (Bridge and Page, 1980). Nematode egg masses were collected from infected roots of P. tabacum, and nematodes at different stages were collected using the shallow dish method for morphological identification. Females were globular to pyriform, with perineal patterns characterized by an oval or nearly circular shape as a whole, the dorsal arch was usually high, the lateral lines were wavy. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. Morphological measurements of females (n = 15): body length = 687.3 ± 24.4 μm, body width = 532.4 ± 28.4 μm, stylet length = 14.4 ± 0.6 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.4 ± 0.2 μm. The measurements of J2s (n = 20): body length = 412.3 ± 16.1 μm, body width = 16.8 ± 1.1 μm, stylet length = 12.6 ± 0.5 μm, DGO length = 3.7 ± 0.2 μm. Average tail length = 57.4 ± 3.8 μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from a single egg mass were used for DNA extraction and molecular identification. The specific primers of M. enterolobii Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) were used to validate the identity of the species (Long et al 2006). Consistent with that previously described, the target amplification product was about 236 bp, and no product was amplified from the M. incognita or M. javanica (Chen et al. 2023). The rDNA-ITS region was obtained and sequenced by PCR amplification using V5367/26S (Vrain et al. 1992). The target product was 769 bp (GenBank accession no. PX285227), which was 99.87%-100% homologous to the M. enterolobii rDNA-ITS sequence available in the GenBank (OR789453, MT406251). Additionally, we amplified the D2A-D3B fragment of the 28S rRNA gene using the primers D2A/D3B (De Ley et al. 1999). The target product was 759 bp (GenBank accession no. PX287183), which was 100% homologous to those M. enterolobii 28S rRNA sequences available in the GenBank (MF467276, KX823403). Pathogenicity of M. enterolobii on P. tabacum plants was confirmed by Koch's Postulates. Approx 2000 J2s were inoculated on each plant (n=12), grown at 26℃ in sterilized soil. All inoculated plants developed root knots and egg massess after two months, whereas non-inoculated controls (n=12) remained healthy. The average root knots rating was 4.8. Approximately 60 ± 20 egg masses formed at the root, confirming the pathogenicity of M. enterolobii on P. tabacum. To our knowledge, this is the first report of M. enterolobii parasitizing P. tabacum in China. China is the center of origin and a main distribution area for P. tabacum, harboring abundant wild germplasm resources. The intensive cultivation of this prized specimen necessitates robust phytosanitary strategies focusing on prevention, strict quarantine, and careful management to mitigate biosecurity risks. This finding has important implications for control of M. enterolobii threatening P. tabacum in China.
Li et al. (Mon,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: