AbstractThe present investigation deals with the first comprehensive morphometric and molecular characterization of Meloidogyne incognita infesting banana across eleven major banana growing districts in Assam viz., Golaghat, Jorhat, Sivasagar, Nagaon, Marigaon, Kamrup, Goalpara, Dibrugarh, Tinisukia, Dhemaji, and Lakhimpur. The perineal pattern characters of adult females and morphological characters of second stage juveniles indicated the association of M. incognita with the galls on banana roots in all 11 districts in Assam surveyed. The molecular characterization of the nematode juveniles from all 11 districts using the species-specific SCAR primer inc-K14F (CCCGCTACACCCTCAACTTC) / inc-K14R (GGGATGTGTAAATGCTCCTG), and gel-electrophoresis of the PCR products yielded a band of 399 bp, which confirmed the identity of M. incognita.
Bhagawati et al. (Wed,) studied this question.