Cystic Fibrosis Transmembrane Conductance Regulator Inhibits Epithelial Na+ Channels Carrying Liddle's Syndrome Mutations

Epithelial Na+ channels (ENaC) are inhibited by the cystic fibrosis transmembrane conductance regulator (CFTR) upon activation by protein kinase A. It is, however, still unclear how CFTR regulates the activity of ENaC. In the present study we examined whether CFTR interacts with ENaC by interfering with the Nedd4- and ubiquitin-mediated endocytosis of ENaC. Various C-terminal mutations were introduced into the three α-, β-, and γ-subunits of the rat epithelial Na+ channel, thereby eliminating PY motifs, which are important binding domains for the ubiquitin ligase Nedd4. When expressed in Xenopus oocytes, most of the ENaC stop (α-H647X, β-P565X, γ-S608X) or point (α-P671A, β-Y618A, γ-P(624–626)A) mutations induced enhanced Na+ currents when compared with wild type α,β,γ-rENaC. However, ENaC currents formed by either of the mutant α-, β-, or γ-subunits were inhibited during activation of CFTR by forskolin (10 μmol/l) and 3-isobutyl-1-methylxanthine (1 mmol/l). Antibodies to dynamin or ubiquitin enhanced α,β,γ-rENaC whole cell Na+ conductance but did not interfere with inhibition of ENaC by CFTR. Another mutant, β-T592m,T593A-ENaC, also showed enhanced Na+currents, which were down-regulated by CFTR. Moreover, activation of ENaC by extracellular proteases and xCAP1 does not disturb CFTR-dependent inhibition of ENaC. We conclude that regulation of ENaC by CFTR is distal to other regulatory limbs and does not involve Nedd4-dependent ubiquitination. Epithelial Na+ channels (ENaC) are inhibited by the cystic fibrosis transmembrane conductance regulator (CFTR) upon activation by protein kinase A. It is, however, still unclear how CFTR regulates the activity of ENaC. In the present study we examined whether CFTR interacts with ENaC by interfering with the Nedd4- and ubiquitin-mediated endocytosis of ENaC. Various C-terminal mutations were introduced into the three α-, β-, and γ-subunits of the rat epithelial Na+ channel, thereby eliminating PY motifs, which are important binding domains for the ubiquitin ligase Nedd4. When expressed in Xenopus oocytes, most of the ENaC stop (α-H647X, β-P565X, γ-S608X) or point (α-P671A, β-Y618A, γ-P(624–626)A) mutations induced enhanced Na+ currents when compared with wild type α,β,γ-rENaC. However, ENaC currents formed by either of the mutant α-, β-, or γ-subunits were inhibited during activation of CFTR by forskolin (10 μmol/l) and 3-isobutyl-1-methylxanthine (1 mmol/l). Antibodies to dynamin or ubiquitin enhanced α,β,γ-rENaC whole cell Na+ conductance but did not interfere with inhibition of ENaC by CFTR. Another mutant, β-T592m,T593A-ENaC, also showed enhanced Na+currents, which were down-regulated by CFTR. Moreover, activation of ENaC by extracellular proteases and xCAP1 does not disturb CFTR-dependent inhibition of ENaC. We conclude that regulation of ENaC by CFTR is distal to other regulatory limbs and does not involve Nedd4-dependent ubiquitination. Recent studies have indicated that epithelial Na+channels (ENaC) 1The abbreviations used are: ENaC, epithelial Na+ channel(s); CFTR, cystic fibrosis transmembrane conductance regulator; wt, wild type; l, liter; IBMX, 3-isobutyl-1-methylxanthine 1The abbreviations used are: ENaC, epithelial Na+ channel(s); CFTR, cystic fibrosis transmembrane conductance regulator; wt, wild type; l, liter; IBMX, 3-isobutyl-1-methylxanthine are inhibited during activation of Cl− secretion in human airways and the colonic epithelium (1Mall M. Bleich M. Greger R. Schreiber R. Kunzelmann K. J. Clin. Invest. 1998; 102: 15-21Crossref PubMed Scopus (182) Google Scholar). 2M. Mall, M. Bleich, J. Kühr, M. Brandis, R. Greger, and K. Kunzelmann, submitted for publication. 2M. Mall, M. Bleich, J. Kühr, M. Brandis, R. Greger, and K. Kunzelmann, submitted for publication. These tissues coexpress both CFTR and α,β,γ-rENaC and demonstrate that CFTR, when activated by cAMP, inhibits epithelial Na+ channels. In fact, recent studies in cells expressing both recombinant CFTR and ENaC indicate CFTR-dependent inhibition of ENaC (3Stutts M.J. Canessa C.M. Olsen J.C. Hamrick M. Cohn J.A. Rossier B.C. Boucher R.C. Science. 1995; 269: 847-850Crossref PubMed Scopus (955) Google Scholar, 4Mall M. Hipper A. Greger R. Kunzelmann K. FEBS Lett. 1996; 381: 47-52Crossref PubMed Scopus (132) Google Scholar). Currently, several models for regulation may be proposed: (i) we have shown recently that CFTR and α,β,γ-rENaC may interact directly (5Kunzelmann K. Kiser G. Schreiber R. Riordan J.R. FEBS Lett. 1997; 400: 341-344Crossref PubMed Scopus (129) Google Scholar). Two independent groups detected inhibition of ENaC single channel currents by CFTR in isolated membranes (6Stutts M.J. Rossier B.C. Boucher R.C. J. Biol. Chem. 1997; 272: 14037-14040Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 7Ismailov I.I. Awayda M.S. Jovov B. Berdiev B.K. Fuller C.M. Dedman J.R. Kaetzel M.A. Benos D.J. J. Biol. Chem. 1996; 271: 4725-4732Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar), while other studies demonstrate inhibition of ENaC by increase of cytosolic Cl− activities (8Dinudom A. Young J.A. Cook D.I. J. Membr. Biol. 1993; 135: 289-295Crossref PubMed Scopus (90) Google Scholar, 9Komwatana P. Dinudom A. Young J.A. Cook D.I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8107-8111Crossref PubMed Scopus (83) Google Scholar). The results of the latter study are supported by the notion that Cl− movement through the activated CFTR Cl− channel is essential for the inhibition of ENaC (10Briel M. Greger R. Kunzelmann K. J. Physiol. (Lond.). 1998; 508: 825-836Crossref Scopus (115) Google Scholar). Very recently, a C-terminal CFTR domain was detected that binds to PDZ domains of proteins that anchor CFTR to the cytoskeleton (11Short D.B. Trotter K.W. Reczek D. Kreda S.M. Bretscher A. Boucher R.C. Stutts M.J. Milgram S.L. J. Biol. Chem. 1998; 273: 19797-19801Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar, 12Wang S. Raab R.W. Schatz P.J. Guggino W.B. Li M. FEBS Lett. 1998; 427: 103-108Crossref PubMed Scopus (249) Google Scholar). This could provide a potential mechanism through which CFTR can affect the activity of other membrane proteins. Along this line, the cytoskeleton has been suggested for a long time to participate in the regulation of the epithelial Na+ channel (13Ismailov I.I. Berdiev B.K. Shlyonsky V.G. Fuller C.M. Prat A.G. Jovov B. Cantiello H.F. Ausiello D.A. Benos D.J. Am. J. Physiol. 1997; 272: C1077-C1086Crossref PubMed Google Scholar). Nedd4-dependent ubiquitination turned out to be an important regulatory pathway for ENaC that is also of clinical relevance in Liddle's disease (14Staub O. Gautschi I. Ishikawa T. Breitschopf K. Ciechanover A. Schild L. Rotin D. EMBO. J. 1997; 16: 6325-6336Crossref PubMed Scopus (597) Google Scholar, 15Hansson J.H. Nelson-Williams C. Suzuki H. Schild L. Shimkets R. Lu Y. Canessa C. Iwasaki T. Rossier B. Lifton R.P. Nat. Genet. 1995; 11: 76-82Crossref PubMed Scopus (716) Google Scholar, 16Shimkets R.A. Warnock D.G. Bositis C.M. Nelson-Williams C. Hansson J.H. Schambelan M. Gill Jr., J.R. Ulick S. Milora R.V. Findling J.W. Cell. 1994; 79: 407-414Abstract Full Text PDF PubMed Scopus (1190) Google Scholar). Regulation by Nedd4 includes binding of Nedd4 to a PY motif in the C terminus of all three ENaC subunits via WW domain interaction with subsequent ubiquitination- and dynamin-mediated endocytosis of ENaC (17Schild L. Lu Y. Gautschi I. Schneeberger E. Lifton R.P. Rossier B.C. EMBO. J. 1996; 15: 2381-2387Crossref PubMed Scopus (360) Google Scholar, 18Shimkets R.A. Lifton R.P. Canessa C.M. J. Biol. Chem. 1997; 272: 25537-25541Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 19Firsov D. Schild L. Gautschi I. Merillat A.M. Schneeberger E. Rossier B.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15370-15375Crossref PubMed Scopus (395) Google Scholar). In the present paper we addressed the question to what extent the PY motifs in the three rENaC subunits contribute to the CFTR-dependent regulation of rENaC and whether elimination of respective motifs interferes with the ability of CFTR to down-regulate rENaC. This seems to be of particular importance since Liddle's disease patients do not suffer from pulmonary symptoms that would be caused by an enhanced Na+conductance in the airways along with hyperabsorption of the airway surface fluid. In addition, preliminary results demonstrate inhibition of α,β,γ573X-ENaC by CFTR in Madin-Darby canine kidney cells (20Stutts M.J. Homolya V. Robinson J. Zhou J. Boucher R.C. Knowles M.R. Pediatr. Pulmonol. Suppl. 1998; 17 (abstr.): 217Google Scholar). In this study we coexpressed various ENaC mutants that show a gain of function. We examined the inhibitory effects of CFTR on these ENaC mutants. In addition, we analyzed whether another, recently identified regulatory pathway for ENaC, the epithelial serine protease CAP1 (21Vallet V. Chraibi A. Gaeggeler H.P. Horisberger J.D. Rossier B.C. Nature. 1997; 389: 607-610Crossref PubMed Scopus (451) Google Scholar), interferes with CFTR-dependent inhibition of ENaC. Mutations of the rat epithelial Na+ channel subunits were generated by polymerase chain reaction. For the C-terminal stop mutations α-H647X, β-P565X, γ-S608X the following sense (s) and antisense (as) oligonucleotides (5′-3′) were used: α-H647X, CGACCCACGCGTCGCG (s); AGGACAGAAACGGGACG (as); β-P565X, CCCACGCGTCCGACC (s), GCCGCCTCCTGCGCA (as); γ-S608X, TCGACCCACGCGTCC (s), AGGTAAAAGTGGGCAGGTC (as). C-terminal point mutations α-P671A, β-Y618A, γ-P (624–626)A were generated using GACAGCCCCTCCAGCTGCCTATGCTACT (s), AGTAGCATAGCCAGCTGGAGGG-GCTGTC (as) for α-P671A); GCACTCCACCTCCCAATGCGCACTCCCTGAGGCTG (s), CAGCCTCAGGGAGTGGCGATTGGGAGGTGGAGTGC (as) for β-Y618A; GGTGCCTGGCACAGCGGCCGCCAGATACAATA (s), TATTGTATCTGGCGGCCGCTGTGCCTGGTATT (as) for γ-P (624–626)A). βT592m,T593A was created using the oligonucleotides TCTTCCAGCCTGACATGGCTAGCTGCAGGCCCAAT (s), ATTGGGCCTGCAGCTAGCCATGTCAGGCTGGAA (as). ENaC mutations were checked for correct sequences by restriction digest and by cycle sequencing (PRISM, Perkin-Elmer). cDNAs encoding α,β,γ-rENaC and the serine protease xCAP1 were kindly provided by Prof. Dr. B. Rossier, Pharmacological Institute of Lausanne, Switzerland. cDNAs encoding wild type human CFTR, the three (α, β, γ) subunits of the rat amiloride-inhibitable Na+ channel ENaC, and theXenopus protease xCAP1 were linearized using eitherNotI or KpnI, and cRNA was in vitrotranscribed using T7, T3, or SP6 polymerases and a 5′-cap (mCAP mRNA capping kit, Stratagene). Isolation and microinjection of oocytes have been described in a previous report (10Briel M. Greger R. Kunzelmann K. J. Physiol. (Lond.). 1998; 508: 825-836Crossref Scopus (115) Google Scholar). In brief, after isolation from adult Xenopus laevisfemale frogs oocytes were dispersed and defolliculated by a 0.5-h treatment with collagenase (type A, Boehringer, Mannheim, Germany). Subsequently oocytes were rinsed and kept in ND96 buffer (in mmol/l): 96 NaCl, 2 KCl, 1.8 CaCl2, 1 MgCl2, 5 HEPES, 2.5 sodium pyruvate, pH 7.55, supplemented with theophylline (0.5 mmol/l) and gentamycin (5 mg/l) at 18 °C. Oocytes of identical batches were injected with cRNA of either wt or mutant α,β,γ-rENaC (each subunit 10 ng), xCAP1, and CFTR (each 20 ng), respectively, after dissolving cRNAs in about 50 nl of double-distilled water (PV830 pneumatic pico pump, WPI, Berlin, Germany). Oocytes injected with 50 nl of double-distilled water served as controls. For some experimental protocols oocytes were injected with 50 ng of either sense or antisense oligonucleotides of the serine proteasexCAP1 (21Vallet V. Chraibi A. Gaeggeler H.P. Horisberger J.D. Rossier B.C. Nature. 1997; 389: 607-610Crossref PubMed Scopus (451) Google Scholar). 2–4 days after injection oocytes were impaled with two electrodes (Clark instruments), which had resistances of 1 MΩ when filled with 2.7 mol/l KCl. A flowing (2.7 mol/l) KCl electrode served as bath reference. Membrane currents were measured by voltage clamping of the oocytes (OOC-1 amplifier, WPI) in intervals from −90 to +30 mV in steps of 10 mV. Current data were filtered at 400 Hz (OOC-1 amplifier). Between intervals, oocytes were voltage-clamped to their spontaneous membrane voltage for 20 s. Data were collected continuously on a computer hard disc and analyzed by using the programs chart and scope (McLab, AD-Instruments, Macintosh). Conductances were calculated for the voltage clamp range of −90 to +30 mV according to Ohm's law. During the whole experiment the bath was continuously perfused at a rate of 5–10 ml/min. All used compounds were of highest available grade of purity. 3-Isobutyl-1-methylxanthine (IBMX), forskolin, trypsin, and amiloride were all from Sigma (Deisenhofen, Germany). The dynamin and ubiquitin antibodies were purchased from Calbiochem (Bad Soden, Germany) and Dianova (Hamburg, Germany). Sense and antisense oligonucleotides of the protease xCAP1 were synthesized by the facility of the local University and were stabilized by phosphorothioate modification. The oligonucleotides had the following (5′-3′) sequence: ATGGAGCCTCTTCCACTTCTC (sense) and GAGAAGTGGAAGTGGCTCCAT (antisense). Statistical analysis was performed according to Student's t test. p values <0.05 were accepted to indicate statistical significance. All experiments were conducted at room temperature (22 °C). PY motifs in either α-, β-, or γ-subunits of rENaC were deleted by either C-terminal point (α-P671A, β-Y618A, γ-P(624–626)A) or C-terminal stop mutations (α-H647X, β-P565X, γ-S608X). A representative record of the whole cell current from an oocyte coexpressing β-P565X with wild type α- and γ-subunits is shown in the lower trace of Fig.1. This current is enhanced when compared with that induced by α,β,γ-rENaC (Fig. 1, upper trace). Amiloride-sensitive whole cell conductances (GENaC-mut) were calculated for the various mutations and were compared with that of α,β,γ-rENaC (GENaC-mut/GENaC-wt). As demonstrated in Fig.2 GENaC was significantly enhanced for β-P565X, γ-S608X, α-P671A, and β-Y618A, while α-H647X and γ-P(624–626)A did not produce enhanced conductances. These results confirm those of previous studies (17Schild L. Lu Y. Gautschi I. Schneeberger E. Lifton R.P. Rossier B.C. EMBO. J. 1996; 15: 2381-2387Crossref PubMed Scopus (360) Google Scholar, 22Snyder P.M. Price M.P. McDonald F.J. Adams C.M. Volk K.A. Zeiher B.G. Stokes J.B. Welsh M.J. Cell. 1995; 83: 969-978Abstract Full Text PDF PubMed Scopus (397) Google Scholar) and indicate the importance of the C-terminal PY motif for the regulation of ENaC.Figure 2Effects of C-terminal deletions and elimination of PY motifs in α-, β-, and γ-subunits of ENaC on amiloride-sensitive Na+ currents. cRNAs encoding either of the α-, β-, or γ-mutants were coinjected with the complementary wild type subunits. The corresponding bars indicate whole cell conductances normalized for wild type ENaC values (GENaC-mut/GENaC-wt). Results are means ± S.E. (number of experiments). * indicates significant difference from Gwt.View Large Image Figure ViewerDownload Hi-res ENaC mutants were coexpressed with CFTR, and we examined whether these ENaC mutants are still down-regulated by CFTR. As demonstrated in A, the whole cell conductance that is by α,β,γ-rENaC and is inhibited by 10 amiloride is after of CFTR by (1 mmol/l) and forskolin (10 The indicates significant inhibition of α,β,γ-rENaC by CFTR, while effects of and forskolin could be detected in the of CFTR. to also whole cell conductances were down-regulated upon of CFTR with and forskolin (Fig. The results from the various ENaC mutants coexpressed with CFTR are in It is shown that GENaC caused by of the C-terminal stop or point mutants is significantly upon of CFTR by and forskolin conclude that PY motifs do not participate in CFTR-dependent regulation of ENaC.Figure inhibition of ENaC C-terminal deletions or point mutations in either α-, β-, or γ-subunits of rENaC. A, of the whole cell conductances by either point or stop mutations of ENaC and of amiloride and after activation of CFTR. of GENaC by ENaC either stop or point mutations and after with and forskolin Results are means ± S.E. (number of experiments). * indicates significant effects of indicates significant inhibition of ENaC by Large Image Figure ViewerDownload Hi-res In to the of the in the regulation of ENaC by CFTR, we of two which to either ubiquitin and When coinjected with ENaC, both of these antibodies enhanced GENaC when compared with amiloride-sensitive whole cell conductances measured in oocytes from the and injected with α,β,γ-rENaC In of we coinjected α,β,γ-rENaC with CFTR and ubiquitin or dynamin The of these experiments indicates that after interfering with both ubiquitin and CFTR is to ENaC (Fig. 5 to previous a in the of the human ENaC a of protein kinase C inhibition and to in the Y. M. M. A.G. Proc. Natl. Acad. Sci. U. S. A. 1997; PubMed Scopus Google Scholar). We examined whether the respective mutations in the rat ENaC interferes with CFTR-dependent when coexpressed with of α- and to an amiloride Na+conductance that was significantly in oocytes from the injected with wt with and forskolin had on Na+ conductance ± ± When coexpressed with CFTR, conductance was significantly by with and forskolin A and gain of mutations of ENaC do not inhibition of ENaC by CFTR. It was shown recently that extracellular proteases ENaC by interfering with the extracellular of ENaC (21Vallet V. Chraibi A. Gaeggeler H.P. Horisberger J.D. Rossier B.C. Nature. 1997; 389: 607-610Crossref PubMed Scopus (451) Google Scholar). We also of GENaC by in a In an oocyte coexpressing both ENaC and CFTR the amiloride-sensitive Na+ conductance was enhanced after to 2 (Fig. by (1 mmol/l) and forskolin (10 μmol/l) and activation of a CFTR whole cell the inhibitory of amiloride was The shown in C indicates a significant increase of GENaC by and inhibition of GENaC by CFTR. The results demonstrate the ability of CFTR to ENaC in the of extracellular protease activity and that the of GENaC that is activated by is also to by CFTR. In to the of the serine protease xCAP1, we of xCAP1 by injection of xCAP1 antisense The of the results is shown in A and demonstrate of GENaC in oocytes coinjected with antisense compared with oocytes coinjected with However, when CFTR was activated by and forskolin, GENaC was inhibited in both and In a we xCAP1 with ENaC and xCAP1 with ENaC and CFTR. The of the results from these experiments is shown in C. The data demonstrate that GENaC was when ENaC was coexpressed with However, a GENaC was detected when CFTR was coexpressed with both rENaC and It is shown that in the of xCAP1, CFTR was still to down-regulate ENaC. We conclude that ENaC currents that are detected in the of protease activity are inhibited by CFTR. The of the epithelial Na+ current is by the of ENaC channels present in the cell membrane and by the activity of membrane channels R.A. Lifton R.P. Canessa C.M. J. Biol. Chem. 1997; 272: 25537-25541Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 19Firsov D. Schild L. Gautschi I. Merillat A.M. Schneeberger E. Rossier B.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15370-15375Crossref PubMed Scopus (395) Google Scholar, 22Snyder P.M. Price M.P. McDonald F.J. Adams C.M. Volk K.A. Zeiher B.G. Stokes J.B. Welsh M.J. Cell. 1995; 83: 969-978Abstract Full Text PDF PubMed Scopus (397) Google Scholar). effects of Liddle's and the of Na+ channels expressed at the cell surface have been described D. Schild L. Gautschi I. Merillat A.M. Schneeberger E. Rossier B.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15370-15375Crossref PubMed Scopus (395) Google Scholar). However, endocytosis of ENaC by a pathway is the mechanism for regulation of epithelial Na+ (14Staub O. Gautschi I. Ishikawa T. Breitschopf K. Ciechanover A. Schild L. Rotin D. EMBO. J. 1997; 16: 6325-6336Crossref PubMed Scopus (597) Google Scholar). a of Nedd4 enhanced Na+ in kidney and a J.H. Nelson-Williams C. Suzuki H. Schild L. Shimkets R. Lu Y. Canessa C. Iwasaki T. Rossier B. Lifton R.P. Nat. Genet. 1995; 11: 76-82Crossref PubMed Scopus (716) Google Scholar, 16Shimkets R.A. Warnock D.G. Bositis C.M. Nelson-Williams C. Hansson J.H. Schambelan M. Gill Jr., J.R. Ulick S. Milora R.V. Findling J.W. Cell. 1994; 79: 407-414Abstract Full Text PDF PubMed Scopus (1190) Google Scholar, L. Lu Y. Gautschi I. Schneeberger E. Lifton R.P. Rossier B.C. EMBO. J. 1996; 15: 2381-2387Crossref PubMed Scopus (360) Google Scholar). The Na+ H. Physiol. 1997; PubMed Scopus Google Scholar) detected in cells via activation of proteins through increase of Na+ and also via Nedd4-dependent of Na+ channels from the cell membrane A. P. Young J.A. S. Cook D.I. Proc. Natl. Acad. Sci. U. S. A. 1998; PubMed Scopus Google Scholar). However, in Xenopus oocytes inhibition of ENaC channels by Na+ the of ENaC channels S. Gautschi I. Rossier B.C. Schild L. J. Clin. Invest. 1998; PubMed Scopus Google Scholar, 19Firsov D. Schild L. Gautschi I. Merillat A.M. Schneeberger E. Rossier B.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15370-15375Crossref PubMed Scopus (395) Google Scholar). Nedd4 and ubiquitination a in ENaC we examined whether of ENaC by CFTR via this regulatory to the present however, this seems since ENaC channels either α-, β-, or γ-subunits with PY motifs were inhibited during activation of CFTR. Moreover, the data indicate inhibition by CFTR for most of the ENaC which may that the of Na+ conductance that is to from the cell membrane and enhanced ENaC activity is also inhibited by CFTR. for and ENaC currents activated by We may that CFTR-dependent inhibition of ENaC is to the regulation by the pathway and extracellular This also to other gain of mutations which was not directly by in Y. M. M. A.G. Proc. Natl. Acad. Sci. U. S. A. 1997; PubMed Scopus Google Scholar). The results of the present report also Liddle's disease do not show enhanced Na+ conductance in their airways and do not suffer from pulmonary symptoms (20Stutts M.J. Homolya V. Robinson J. Zhou J. Boucher R.C. Knowles M.R. Pediatr. Pulmonol. Suppl. 1998; 17 (abstr.): 217Google Scholar). regulation of ENaC does not provide a mechanism through which ENaC is by CFTR. The and of the inhibitory effects of CFTR on ENaC (10Briel M. Greger R. Kunzelmann K. J. Physiol. (Lond.). 1998; 508: 825-836Crossref Scopus (115) Google Scholar) are in with a The question the the CFTR-dependent regulation of ENaC can not be at the We from previous that interaction of CFTR with ENaC in isolated membranes and after into (6Stutts M.J. Rossier B.C. Boucher R.C. J. Biol. Chem. 1997; 272: 14037-14040Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 7Ismailov I.I. Awayda M.S. Jovov B. Berdiev B.K. Fuller C.M. Dedman J.R. Kaetzel M.A. Benos D.J. J. Biol. Chem. 1996; 271: 4725-4732Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). The interaction does not CFTR but cytosolic domains of CFTR (5Kunzelmann K. Kiser G. Schreiber R. Riordan J.R. FEBS Lett. 1997; 400: 341-344Crossref PubMed Scopus (129) Google Scholar) and on ability to Cl− (10Briel M. Greger R. Kunzelmann K. J. Physiol. (Lond.). 1998; 508: 825-836Crossref Scopus (115) Google Scholar). studies are to show whether the recently identified PDZ domain interaction of CFTR and ENaC. We the of H.