Characterization of the Reversible Conformational Equilibrium in the Cytoplasmic Domain of Human Erythrocyte Membrane Band 3

The cytoplasmic domain of erythrocyte membrane band 3 (cdb3) serves as a center of membrane organization, interacting with such proteins as ankyrin, protein 4.1, protein 4.2, hemoglobin, several glycolytic enzymes, and a tyrosine kinase, p72syk. cdb3 exists in a reversible, pH-dependent conformational equilibrium characterized by large changes in Stokes radius (11 Å) and intrinsic fluorescence (2-fold). Based on the crystallographic structure of the cdb3 dimer, we hypothesized that the above conformational equilibrium might involve the movement of flanking peripheral protein binding domains away from a shared dimerization domain. To test this hypothesis, we have mutated both donor (W105L) and acceptor (D316A) residues of a prominent H bond that bridges the above two domains and have examined the effect on the resulting conformational equilibrium. Analysis of the intrinsic fluorescence, Stokes radius, thermal stability, urea stability, and segmental mobility of these mutants reveals that the above H bond is indeed present in the low pH conformation of cdb3 and broken in a higher pH conformation. The data further reveal that cdb3 exists in three native pH-dependent conformations and that rupture of the aforementioned H bond occurs only during conversion of the low pH conformation to the mid-pH conformation. Conversion of the mid-pH conformation to the high pH conformation would now appear to involve structural changes primarily in the peripheral protein binding domain. Because ankyrin associates avidly with the low pH conformation of cdb3, ankyrin occupancy should strongly influence this structural equilibrium and thereby affect band 3 and perhaps global membrane properties. The cytoplasmic domain of erythrocyte membrane band 3 (cdb3) serves as a center of membrane organization, interacting with such proteins as ankyrin, protein 4.1, protein 4.2, hemoglobin, several glycolytic enzymes, and a tyrosine kinase, p72syk. cdb3 exists in a reversible, pH-dependent conformational equilibrium characterized by large changes in Stokes radius (11 Å) and intrinsic fluorescence (2-fold). Based on the crystallographic structure of the cdb3 dimer, we hypothesized that the above conformational equilibrium might involve the movement of flanking peripheral protein binding domains away from a shared dimerization domain. To test this hypothesis, we have mutated both donor (W105L) and acceptor (D316A) residues of a prominent H bond that bridges the above two domains and have examined the effect on the resulting conformational equilibrium. Analysis of the intrinsic fluorescence, Stokes radius, thermal stability, urea stability, and segmental mobility of these mutants reveals that the above H bond is indeed present in the low pH conformation of cdb3 and broken in a higher pH conformation. The data further reveal that cdb3 exists in three native pH-dependent conformations and that rupture of the aforementioned H bond occurs only during conversion of the low pH conformation to the mid-pH conformation. Conversion of the mid-pH conformation to the high pH conformation would now appear to involve structural changes primarily in the peripheral protein binding domain. Because ankyrin associates avidly with the low pH conformation of cdb3, ankyrin occupancy should strongly influence this structural equilibrium and thereby affect band 3 and perhaps global membrane properties. cytoplasmic domain of erythrocyte membrane 3 fast protein liquid chromatography Band 3 is the most abundant polypeptide of the human erythrocyte membrane, comprising ∼25% of the total membrane protein (1Fairbanks G. Steck T.L. Wallach D.F. Biochemistry. 1971; 10: 2606-2617Crossref PubMed Scopus (6279) Google Scholar, 2Steck T.L. J. Supramol. Struct. 1978; 8: 311-324Crossref PubMed Scopus (207) Google Scholar). Band 3 is composed of two major domains, a transmembrane domain and a cytoplasmic domain, which perform distinct and essential cellular functions (3Appell K.C. Low P.S. Biochemistry. 1982; 21: 2151-2157Crossref PubMed Scopus (66) Google Scholar). The transmembrane domain serves as an anion transporter that catalyzes the exchange of Cl− for HCO3− across the lipid bilayer (4Lepke S. Passow H. Biochim. Biophys. Acta. 1976; 455: 353-370Crossref PubMed Scopus (92) Google Scholar), whereas the cytoplasmic domain functions as an anchoring site for the membrane skeleton of the cell and several other cytoplasmic proteins. Among those peripheral proteins shown to bind band 3 are ankyrin (5Bennett V. Stenbuck P.J. J. Biol. Chem. 1980; 255: 6424-6432Abstract Full Text PDF PubMed Google Scholar,6Hargreaves W.R. Giedd K.N. Verkleij A. Branton D. J. Biol. Chem. 1980; 255: 11965-11972Abstract Full Text PDF PubMed Google Scholar), band 4.1 (7Pasternack G.R. Anderson R.A. Leto T.L. Marchesi V.T. J. Biol. Chem. 1985; 260: 3676-3683Abstract Full Text PDF PubMed Google Scholar, 8An X.L. Takakuwa Y. Nunomura W. Manno S. Mohandas N. J. Biol. Chem. 1996; 271: 33187-33191Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar), band 4.2 (9Korsgren C. Cohen C.M. J. Biol. Chem. 1988; 263: 10212-10218Abstract Full Text PDF PubMed Google Scholar), glyceraldehyde-3-phosphate dehydrogenase (10Tsai I.H. Murthy S.N. Steck T.L. J. Biol. Chem. 1982; 257: 1438-1442Abstract Full Text PDF PubMed Google Scholar), aldolase (11Murthy S.N. Liu T. Kaul R.K. Kohler H. Steck T.L. J. Biol. Chem. 1981; 256: 11203-11208Abstract Full Text PDF PubMed Google Scholar), phosphofructokinase (12Jenkins J.D. Madden D.P. Steck T.L. J. Biol. Chem. 1984; 259: 9374-9378Abstract Full Text PDF PubMed Google Scholar), hemoglobin (13Walder J.A. Chatterjee R. Steck T.L. Low P.S. Musso G.F. Kaiser E.T. Rogers P.H. Arnone A. J. Biol. Chem. 1984; 259: 10238-10246Abstract Full Text PDF PubMed Google Scholar), hemichromes (14Waugh S.M. Low P.S. Biochemistry. 1985; 24: 34-39Crossref PubMed Scopus (137) Google Scholar), and the protein-tyrosine kinase, p72syk(15Harrison M.L. Isaacson C.C. Burg D.L. Geahlen R.L. Low P.S. J. Biol. Chem. 1994; 269: 955-959Abstract Full Text PDF PubMed Google Scholar). Not surprisingly, band 3 appears to be essential for the maintenance of the structure and function of the red blood cell membrane, including control of cell flexibility and shape (16Peters L.L. Shivdasani R.A. Liu S.C. Hanspal M. John K.M. Gonzalez J.M. Brugnara C. Gwynn B. Mohandas N. Alper S.L. Orkin S.H. Lux S.E. Cell. 1996; 86: 917-927Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar, 17Southgate C.D. Chishti A.H. Mitchell B. Yi S.J. Palek J. Nat. Genet. 1996; 14: 227-230Crossref PubMed Scopus (143) Google Scholar, 18Jarolim P. Rubin H.L. Liu S.C. Cho M.R. Brabec V. Derick L.H. Yi S.J. Saad S.T. Alper S. Brugnara C. et al.J. Clin. Invest. 1994; 93: 121-130Crossref PubMed Scopus (93) Google Scholar, 19Low P.S. Willardson B.M. Mohandas N. Rossi M. Shohet S. Blood. 1991; 77: 1581-1586Crossref PubMed Google Scholar), regulation of glucose metabolism (20Low P.S. Rathinavelu P. Harrison M.L. J. Biol. Chem. 1993; 268: 14627-14631Abstract Full Text PDF PubMed Google Scholar), catalysis of ion transport (21Jennings M.L. Passow H. Biochim. Biophys. Acta. 1979; 554: 498-519Crossref PubMed Scopus (177) Google Scholar), and control of red cell lifespan (22Kannan R. Yuan J. Low P.S. Biochem. J. 1991; 278: 57-62Crossref PubMed Scopus (67) Google Scholar). A remarkable property of the cytoplasmic domain of band 3 (cdb3)1 involves its ability to undergo a large, fully reversible, pH-dependent conformational change (23Thevenin B.J. Periasamy N. Shohet S.B. Verkman A.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1741-1745Crossref PubMed Scopus (39) Google Scholar, 24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, 25Low P.S. Biochim. Biophys. Acta. 1986; 864: 145-167Crossref PubMed Scopus (377) Google Scholar, 26Appell K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar). Thus, as pH is raised from 6.0 to 10.0, the Stokes radius of cdb3 enlarges by 11 Å, and the intrinsic fluorescence, which is highly quenched at a lower pH, more than doubles. Thermal stability decreases by ∼15 °C over this pH range, whereas both protein segmental motion and protein axial ratio increase significantly. Based on careful measurements of these and other parameters, it has been concluded that cdb3 probably exists in three native conformational states defined by structural transitions at pH values 7.2 and 9.2. Because these structural transitions control ankyrin association with band 3 and thereby membrane stability (19Low P.S. Willardson B.M. Mohandas N. Rossi M. Shohet S. Blood. 1991; 77: 1581-1586Crossref PubMed Google Scholar, 27Thevenin B.J. Low P.S. J. Biol. Chem. 1990; 265: 16166-16172Abstract Full Text PDF PubMed Google Scholar) and because both hemoglobin association with the membrane and band 3 subunit association display a similar pH dependence (28Salhany J.M. Cordes K.A. Sloan R.L. Biochim. Biophys. Acta. 1998; 1371: 107-113Crossref PubMed Scopus (32) Google Scholar, 29Low P.S. Allen D.P. Zioncheck T.F. Chari P. Willardson B.M. Geahlen R.L. Harrison M.L. J. Biol. Chem. 1987; 262: 4592-4596Abstract Full Text PDF PubMed Google Scholar, 30Low P.S. Kannan R. Prog. Clin. Biol. Res. 1989; 319: 525-546PubMed Google Scholar), 2Rettig, M. P., Orendorff, C. J., Campanella, E., and Low, P. S. (2001) Biochim. Biophys. Acta, in press. characterization of the conformational change could provide considerable insight into the structure and operation of the erythrocyte membrane. The crystallographic structure of the low pH conformation of human erythrocyte cdb3 has recently been solved to 0.26-nm resolution (31Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar). cdb3 is crystallized at pH 4.8 as a tight, symmetric dimer comprised of a shared central dimerization domain flanked by two peripheral protein binding domains (Fig. 1A). Both the dimerization domain and the peripheral protein binding domains are tightly folded, but movement of one domain relative to the other appears highly possible from the crystal structure. Because the conformational change in cdb3 occurs with no significant change in protein secondary structure (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar), we have speculated that the responsible structural rearrangement might involve a change in interactions between the aforementioned domains (Fig.1B). For such movement to occur, however, a prominent H bond connecting Trp105 of one subunit's peripheral protein binding domain to Asp316 of the opposite subunit's sequence in the shared dimerization domain would have to be severed, thereby allowing the peripheral protein binding domains to bend away from the central dimerization domain. In this study, we have undertaken to evaluate whether the prominent structural change of cdb3 involves rupture of this Trp105–Asp316 H bond and, by extension, separation of the dimerization domain from the flanking peripheral protein binding domains. DEAE-Sepharose CL-6B was purchased from Amersham Pharmacia Biotech. Isopropyl-1-thio-β-d-galactopyranoside and antibiotics (chloramphenicol and ampicillin) were obtained from U. S. Biochemical Corp. All other reagents used were of the highest purity available. The following oligonucleotides were synthesized and used for site-directed mutagenesis: (a) for mutation of Trp105 to Leu105 (W105L), 5′CTCACCTTCTTGAGCCTCCTAG3′, and (b) for mutation of Asp316 to Ala316(D316A), 5′GGCTTCCTGGCCTGCAGCCTAG3′ (base substitution underlined). Site-directed mutagenesis was performed in vitro with a GeneEditorTMin vitrosite-directed mutagenesis system (Promega) following the manufacturer's instructions. cdb3 cDNA in a pT7-7 plasmid was used as the template. The resulting mutant cDNAs were sequenced to verify the mutations. Plasmids were then transferred into BL21(DE3) pLysS cells for expression of the mutated cdb3 proteins (32Wang C.C. Badylak J.A. Lux S.E. Moriyama R. Dixon J.E. Low P.S. Protein Sci. 1992; 1: 1206-1214Crossref PubMed Scopus (43) Google Scholar). Purification of recombinant cdb3 was performed as described previously (33Wang C.C. Moriyama R. Lombardo C.R. Low P.S. J. Biol. Chem. 1995; 270: 17892-17897Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 34Zhou J. Weiner H. Biochemistry. 2000; 39: 12019-12024Crossref PubMed Scopus (29) Google Scholar) with minor modifications. Briefly, Escherichia coli BL21(DE3) pLysS cells harboring the cdb3 vector were grown at 37 °C in 2×YT medium (1.6% tryptone, 1.0% yeast and both and the at was to the The were then grown at 37 °C for 3 and the cells were by of the cells in a cell and were by at for in a a DEAE-Sepharose CL-6B the was with the pH and and proteins were by with a from to The cdb3 were and in and the protein was in the above The cdb3 was then to an in the and the protein was by the of The purity of the resulting cdb3 was by The pH dependence of the Stokes radius of cdb3 was as previously (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar), that the used was a Pharmacia The pH dependence of the intrinsic fluorescence was from to in of and with of urea an at an of and at For stability cdb3 was at the urea for at 3 fluorescence measurements were in protein flexibility between and mutant cdb3 were examined in the by the and of the fluorescence of the protein at and of and to The dependence of and mutant cdb3 stability was on a at a protein of in the The measurements were obtained at pH values 6.0 and by °C as the was raised from to and that the cdb3 dimer secondary structure as pH is (3Appell K.C. Low P.S. Biochemistry. 1982; 21: 2151-2157Crossref PubMed Scopus (66) Google Scholar, 24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, 26Appell K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar). are by it is possible to such structural data for possible of this conformational change by movement an in Based on this we have a possible in cdb3 of the two peripheral protein binding domains away from the shared dimerization domain and to protein a change in secondary structure an of (Fig. of the conformational change reveals that a prominent H from Trp105 of subunit's peripheral protein binding domain to Asp316 of the subunit's dimerization domain, be broken for the structural change to (31Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar). Because rupture of this H bond would to the characterized increase in cdb3 intrinsic fluorescence pH (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, Y. Biochemistry. 1998; PubMed Scopus Google Scholar), we to test the by Trp105 and Asp316 to and thereby the donor the acceptor in the prominent H the and mutated of cdb3 were to and characterized as described of whether of the aforementioned H bond might mobility was by and mutant proteins for in intrinsic fluorescence at pH an H bond in cdb3 would be to a more than is possible in the mutated with this the fluorescence of the protein was to be whereas the for the mutant was at data that the segmental motion of one more residues in cdb3 of Asp316 with a in at pH interactions to be segmental in both mutant and a of is obtained for 3 Thus, the structural that mobility at pH more in the than mutant cdb3 are at pH The fluorescence of cdb3 from pH to has been shown to a increase in the intrinsic fluorescence characterized by values of 7.2 and (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, 26Appell K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar). Because the pH-dependent changes in Stokes radius pH 7.2 and (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, C.C. Badylak J.A. Lux S.E. Moriyama R. Dixon J.E. Low P.S. Protein Sci. 1992; 1: 1206-1214Crossref PubMed Scopus (43) Google Scholar) and because ankyrin for band 3 the two pH transitions B.J. Low P.S. J. Biol. Chem. 1990; 265: 16166-16172Abstract Full Text PDF PubMed Google Scholar), we have concluded that the fluorescence transitions the conformational changes in cdb3 (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar). To whether of the bond might affect this conformational we have examined the pH dependence of the intrinsic fluorescence of the mutated the prominent H in of cdb3 the fluorescence increase with values 7.2 and 9.2. In of the cdb3 mutant in a no fluorescence change between pH 6.0 and (Fig. by a in fluorescence pH A of these be to that mutation of Trp105 to the of the lower pH structural the conformational change might occur, but its could be by of the of the the data that the two in the pH of cdb3 to two distinct structural transitions because of one be the Trp105 be in the lower pH structural because substitution with its To evaluate whether mutation of Trp105 to the low pH conformational change the responsible for its two were of the intrinsic fluorescence of the H bond acceptor was in this mutant no of a lower pH that the of the in the mutant might from a To this hypothesis, the Stokes of the mutants as as cdb3 were as a function of pH a the Stokes radius of cdb3 has been to increase from to as pH is from to the above higher resolution we now an increase from to over the pH both the and mutants the that the mutation no of the pH-dependent conformational change but the that A test of the of the Trp105–Asp316 bond in the prominent conformational change in the stability of and mutant cdb3 both at pH the H bond in the native protein is and at pH the H bond in both native and mutated proteins should be For this both thermal and urea were performed on both and mutated intrinsic fluorescence to the For of these it should be that the intrinsic fluorescence of cdb3 is quenched at pH and that protein to a fluorescence whereas intrinsic fluorescence is high at pH and protein in fluorescence (24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar). shown in the intrinsic fluorescence of cdb3 at pH decreases in as the is probably to thermal of the as the of is an in fluorescence is with a of one more this is at °C for cdb3, in with previously data (3Appell K.C. Low P.S. Biochemistry. 1982; 21: 2151-2157Crossref PubMed Scopus (66) Google Scholar, 26Appell K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar), whereas the occurs at °C for both the and mutants (Fig. data that the Trp105–Asp316 H bond in cdb3 is and to protein stability at pH In at pH the are in and mutant cdb3 (Fig. Thus, the at low the in fluorescence between and with cdb3 is at °C at pH (3Appell K.C. Low P.S. Biochemistry. 1982; 21: 2151-2157Crossref PubMed Scopus (66) Google is for three data that the Trp105–Asp316 H bond is broken at of the peripheral protein binding domain away from the dimerization domain at high pH for this to the of the Trp105–Asp316 H bond in the high pH conformation of cdb3, we have the dependence of urea of and mutant at both pH the intrinsic fluorescence of three of cdb3 as a function of urea at pH cdb3 at a higher than with the of the prominent H bond in the two In of the three of cdb3 at pH reveals no major in stability the the of the Trp105–Asp316 H bond in the structure of cdb3 at high and have shown that the conformational change in cdb3 is characterized by an increase in Stokes radius, a in thermal stability, a in intrinsic fluorescence, an increase in protein segmental an in axial and a of ankyrin major change in protein secondary structure (3Appell K.C. Low P.S. Biochemistry. 1982; 21: 2151-2157Crossref PubMed Scopus (66) Google Scholar, B.J. Periasamy N. Shohet S.B. Verkman A.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1741-1745Crossref PubMed Scopus (39) Google Scholar, 24Low P.S. Westfall M.A. Allen D.P. Appell K.C. J. Biol. Chem. 1984; 259: 13070-13076Abstract Full Text PDF PubMed Google Scholar, 25Low P.S. Biochim. Biophys. Acta. 1986; 864: 145-167Crossref PubMed Scopus (377) Google Scholar, 26Appell K.C. Low P.S. J. Biol. Chem. 1981; 256: 11104-11111Abstract Full Text PDF PubMed Google Scholar, 27Thevenin B.J. Low P.S. J. Biol. Chem. 1990; 265: 16166-16172Abstract Full Text PDF PubMed Google Scholar, C.C. Badylak J.A. Lux S.E. Moriyama R. Dixon J.E. Low P.S. Protein Sci. 1992; 1: 1206-1214Crossref PubMed Scopus (43) Google Scholar). Because crystal structure that movement of the two peripheral protein binding domains away from the shared dimerization domain might for these we to evaluate this by both donor and acceptor residues of a major H bond the two domains. mutation of H bond changes in cdb3 at pH a in thermal stability, an increase in segmental a in urea but at this pH dependence to that the H bond is present and at low pH but in the conformation at high The motion in a structural with the Because pH changes are the the function of the structural that pH in a of the conformational because ankyrin most avidly to the low pH conformation of cdb3 (19Low P.S. Willardson B.M. Mohandas N. Rossi M. Shohet S. Blood. 1991; 77: 1581-1586Crossref PubMed Google Scholar, 27Thevenin B.J. Low P.S. J. Biol. Chem. 1990; 265: 16166-16172Abstract Full Text PDF PubMed Google Scholar), ankyrin binding the structural equilibrium in the conformation. of the peripheral protein binding and dimerization domains might then between the domain is to the dimerization and the peripheral protein binding domain associates with a of other this the of ankyrin binding on erythrocyte membrane might be (5Bennett V. Stenbuck P.J. J. Biol. Chem. 1980; 255: 6424-6432Abstract Full Text PDF PubMed Google Scholar, B.J. Periasamy N. Shohet S.B. Verkman A.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1741-1745Crossref PubMed Scopus (39) Google B.J. Low P.S. J. Biol. Chem. 1990; 265: 16166-16172Abstract Full Text PDF PubMed Google Scholar, P. Rubin H.L. J.T. Brabec V. Palek J. Blood. 1996; PubMed Google Scholar, P. Palek J. Rubin H.L. J.T. C. Cohen C.M. Blood. 1992; PubMed Google Scholar, B.M. B.J. Harrison M.L. Low P.S. J. Biol. Chem. 1989; Full Text PDF PubMed Google Scholar, A. R. Biochemistry. PubMed Scopus Google Scholar). of the H bond in cdb3 changes in both protein stability and segmental it appear to change in protein structure. Thus, both the increase in Stokes radius (Fig. and the in intrinsic fluorescence (Fig. with pH as as the for cdb3 fluorescence was Trp105 be present to the then the peripheral protein binding domain bend away from the dimerization domain mutation of the H of the crystal structure reveals the of other H between the peripheral protein binding domains and the dimerization domain. Thus, and of peripheral protein binding domain with and of the dimerization domain. these H be broken during the structural that the Trp105–Asp316 H appear to be in the of the Trp105–Asp316 H bond to the native conformation of cdb3 at low of the Trp105–Asp316 H bond only the low pH conformation to band 3 structure have been by the because the at pH 7.2 and in the Stokes radius and intrinsic fluorescence of cdb3 are the that might two but conformational transitions has been the ability to these two transitions by mutation of Trp105 to (Fig. now the of the structural equilibrium. because cdb3 was crystallized for structural at pH the of the protein to the structure at low The that the thermal and urea as as the pH dependence of the intrinsic fluorescence, segmental and stability change in the mutants as in the crystal structure that this structure is on other of cdb3 the of the structure. and P. S. Low, in In cdb3 now be to in a conformational equilibrium defined by pH-dependent transitions at pH and The crystallographic structure obtained on grown at pH 4.8 appears to the conformation of cdb3 pH of pH to separation of the peripheral protein binding domains from the shared dimerization domain, with the rupture of the Trp105–Asp316 H pH further then to an structural change in the peripheral protein binding domain a increase in Stokes radius and a structural rearrangement that is by the domain Because at peripheral proteins with cdb3 in of its conformational states and the influence of these states on peripheral protein interactions should erythrocyte membrane structure at this center of membrane of the for with the for the in