A Recombinant Human Hemoglobin with Anti-sickling Properties Greater than Fetal Hemoglobin

A new recombinant, human anti-sickling β-globin polypeptide designated βAS3 (βGly16 → Asp/βGlu22 → Ala/βThr87 → Gln) was designed to increase affinity for α-globin. The amino acid substitutions at β22 and β87 are located at axial and lateral contacts of the sickle hemoglobin (HbS) polymers and strongly inhibit deoxy-HbS polymerization. The β16 substitution confers the recombinant β-globin subunit (βAS3) with a competitive advantage over βS for interaction with the α-globin polypeptide. Transgenic mouse lines that synthesize high levels of HbAS3 (α2βAS32) were established, and recombinant HbAS3 was purified from hemolysates and then characterized. HbAS3 binds oxygen cooperatively and has an oxygen affinity that is comparable with fetal hemoglobin. Delay time experiments demonstrate that HbAS3 is a potent inhibitor of HbS polymerization. Subunit competition studies confirm that βAS3 has a distinct advantage over βS for dimerization with α-globin. When equal amounts of βS- and βAS3-globin monomers compete for limiting α-globin chains up to 82% of the tetramers formed is HbAS3. Knock-out transgenic mice that express exclusively human HbAS3 were produced. When these mice were bred with knock-out transgenic sickle mice the βAS3 polypeptides corrected all hematological parameters and organ pathology associated with the disease. Expression of βAS3-globin should effectively lower the concentration of HbS in erythrocytes of patients with sickle cell disease, especially in the 30% percent of these individuals who coinherit α-thalassemia. Therefore, constructs expressing the βAS3-globin gene may be suitable for future clinical trials for sickle cell disease. A new recombinant, human anti-sickling β-globin polypeptide designated βAS3 (βGly16 → Asp/βGlu22 → Ala/βThr87 → Gln) was designed to increase affinity for α-globin. The amino acid substitutions at β22 and β87 are located at axial and lateral contacts of the sickle hemoglobin (HbS) polymers and strongly inhibit deoxy-HbS polymerization. The β16 substitution confers the recombinant β-globin subunit (βAS3) with a competitive advantage over βS for interaction with the α-globin polypeptide. Transgenic mouse lines that synthesize high levels of HbAS3 (α2βAS32) were established, and recombinant HbAS3 was purified from hemolysates and then characterized. HbAS3 binds oxygen cooperatively and has an oxygen affinity that is comparable with fetal hemoglobin. Delay time experiments demonstrate that HbAS3 is a potent inhibitor of HbS polymerization. Subunit competition studies confirm that βAS3 has a distinct advantage over βS for dimerization with α-globin. When equal amounts of βS- and βAS3-globin monomers compete for limiting α-globin chains up to 82% of the tetramers formed is HbAS3. Knock-out transgenic mice that express exclusively human HbAS3 were produced. When these mice were bred with knock-out transgenic sickle mice the βAS3 polypeptides corrected all hematological parameters and organ pathology associated with the disease. Expression of βAS3-globin should effectively lower the concentration of HbS in erythrocytes of patients with sickle cell disease, especially in the 30% percent of these individuals who coinherit α-thalassemia. Therefore, constructs expressing the βAS3-globin gene may be suitable for future clinical trials for sickle cell disease. Sickle cell disease (SCD) 1The abbreviations used are: SCD, sickle cell disease; LCR, locus control region; HPLC, high performance liquid chromatography; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol. results from an A to T transversion at the sixth codon of the human β-globin gene on chromosome 11 (1Ingram V.M. Nature. 1956; 178: 792-794Crossref PubMed Scopus (474) Google Scholar, 2Ingram V.M. Nature. 1957; 180: 326-328Crossref PubMed Scopus (493) Google Scholar). The mutation of a single DNA base leads to the substitution of a valine for a glutamic acid in the β-globin polypeptide of sickle hemoglobin (HbS). The positioning of a hydrophobic residue at this position permits an interaction with a hydrophobic pocket on another hemoglobin tetramer (see Fig. 1). This interaction allows deoxy-HbS to polymerize in an entropy-driven process (3Wishner B.C. Ward K.B. Lattman E.E. Love W.E. J. Mol. Biol. 1975; 98: 179-194Crossref PubMed Scopus (234) Google Scholar, 4Padlan E.A. Love W.E. J. Biol. Chem. 1985; 260: 8280-8291Abstract Full Text PDF PubMed Google Scholar, 5Dykes G.W. Crepeau R.H. Edelstein S.J. J. Mol. Biol. 1979; 130: 451-472Crossref PubMed Scopus (149) Google Scholar). The polymerization of deoxy-HbS leads to erythrocyte deformation from a biconcave morphology into the sickle shapes for which SCD is named. Polymerization of deoxy-HbS is effectively inhibited by fetal hemoglobin (HbF), and individuals who are homozygous for the sickle mutation but also express high levels of HbF are typically asymptomatic (6Brittenham G. Lozoff B. Harris J.W. Mayson S.M. Miller A. Huisman T.H. Am. J. Hematol. 1979; 6: 107-123Crossref PubMed Scopus (51) Google Scholar, 7Wood W.G. Pembrey M.E. Serjeant G.R. Perrine R.P. Weatherall D.J. Br. J. Haematol. 1980; 45: 431-445Crossref PubMed Scopus (45) Google Scholar, 8Noguchi C.T. Rodgers G.P. Serjeant G. Schechter A.N. N. Engl. J. Med. 1988; 318: 96-99Crossref PubMed Scopus (186) Google Scholar). The level of HbF necessary to significantly reduce the symptoms of SCD ranges from about 20 to 25%; however, data showing an enhanced red cell survival with as little as 9% HbF have been reported (9Platt O.S. Brambilla D.J. Rosse W.F. Milner P.F. Castro O. Steinberg M.H. Klug P.P. N. Engl. J. Med. 1994; 330: 1639-1644Crossref PubMed Scopus (2485) Google Scholar). The efficacy of HbF in inhibiting HbS polymerization suggests that transduction of fetal globin genes into hematopoietic stem cells might be an effective strategy for sickle cell disease gene therapy. However, high levels of γ-globin gene expression are difficult to achieve in adult erythroid cells even in the absence of competition with the β-globin gene for locus control region (LCR) interactions (10Behringer R.R. Ryan T.M. Palmiter R.D. Brinster R.L. Townes T.M. Genes Dev. 1990; 4: 380-389Crossref PubMed Scopus (192) Google Scholar, 11Enver T. Raich N. Ebens A.J. Papayannopoulou T. Costantini F. Stamatoyannopoulos G. Nature. 1990; 344: 309-313Crossref PubMed Scopus (238) Google Scholar). Low level expression of the γ-globin gene apparently results from the absence of fetal-specific positive regulatory factors in adult cells. Our approach to overcome this deficiency has been to utilize the β-globin gene as a backbone and to introduce γ-globin amino acid substitutions into this construct. We demonstrated previously that a β-globin gene containing alanine at position 22 and glutamine at position 87 (βAS2) significantly inhibited HbS polymerization (12McCune S.L. Reilly M.P. Chomo M.J. Asakura T. Townes T.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9852-9856Crossref PubMed Scopus (59) Google Scholar). We have now introduced an additional modification into βAS2 to form βAS3; this modification increases the affinity of β-globin subunits for α-globin polypeptides. In this paper we demonstrate that βAS3 has a competitive advantage over βS polypeptides for interaction with limiting α-globin subunits and that HbAS3 dramatically inhibits deoxy-HbS polymerization. Construction and Microinjection of Anti-sickling β-Globin Genes— Plasmids were constructed by standard procedures (13Sambrook J. Fritch E. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York1989: 390-401Google Scholar). Mutagenesis was performed using the Altered Sites system (Promega, Madison, WI) (14Lewis M.K. Thompson D.V. Nucleic Acids Res. 1990; 18: 3439-3443Crossref PubMed Scopus (39) Google Scholar) and by megaprimer mutagenesis (15Sarkar G. Sommer S.S. BioTechniques. 1990; 8: 404-407PubMed Google Scholar). The mutagenic oligonucleotides were as follows: β16, CTGCCCTGTGGGACAAGGTGAACGTG; β22, GTGAACGTGGATGCCGTTGGTGGTGAG; β87, GGCACCTTTGCCCAGCTGAGTGAGCTG. Fragment preparation and microinjection were as described previously (16Ryan T.M. Townes T.M. Reilly M.P. Asakura T. Palmiter R.D. Brinster R.L. Behringer R.R. Science. 1990; 247: 566-568Crossref PubMed Scopus (100) Google Scholar). Transgenic animals expressing high levels of human hemoglobin were identified by isoelectric focusing of hemolysates. Isoelectric focusing was performed using the Isothermal Controlled Electrophoresis system (Fisher) with precast agarose isoelectric focusing gels (Isolab, Akron, OH). Analysis and Purification of Recombinant Human Hemoglobins— Initial analysis of hemoglobin tetramers was performed by anion exchange high performance liquid chromatography (HPLC) utilizing a Synchropak AN 300 (4.6 × 25 mm) column (MICRA Scientific, Northbrook, IL) (17Ip C.Y. Asakura T. Anal. Biochem. 1986; 156: 348-353Crossref PubMed Scopus (6) Google Scholar). Preparative isoelectric focusing was performed on 4% acrylamide gels with 2% Pharmalyte (Amersham Biosciences AB, Uppsala, Sweden) (pH 6.7–7.7). Bands of hemoglobin were sliced from the gel and eluted in 0.1 m potassium phosphate buffer, (pH 7.0) (18Behringer R.R. Ryan T.M. Reilly M.P. Asakura T. Palmiter R.D. Brinster R.L. Townes T.M. Science. 1989; 245: 971-973Crossref PubMed Scopus (85) Google Scholar). Mouse and human globins were separated by reverse-phase HPLC using a Series 4500i HPLC system (Dionex, Sunnyvale, CA). Approximately 25–30 μg of hemoglobin was injected into a C4 reverse-phase (4.6 × 250 mm) column (Vydac, Hesperia, CA) and eluted with a linear gradient of acetonitrile and 0.3% trifluroacetic acid (19Adachi K. Asakura T. J. Chromatogr. 1987; 419: 303-307Crossref PubMed Scopus (4) Google Scholar, 20Schroeder W.A. Shelton J.B. Shelton J.R. Huynh V. Teplow D.B. Hemoglobin. 1985; 9: 461-482Crossref PubMed Scopus (30) Google Scholar). Functional Analysis of Recombinant Human Hemoglobins—Oxygen equilibrium curves were measured with a Hemox Analyzer (TCS Scientific, New Hope, PA) as described (21Asakura T. Reilly M.P. Nicolau C. Oxygen Transport in Red Blood Cells. Pergamon Press, New York1986Google Scholar). The oxygen equilibrium curves were determined in 0.1 m potassium phosphate buffer (pH 7.0) at 20 °C with a hemoglobin concentration of 25 μm. Polymerization kinetics were determined in 1.8 m potassium phosphate buffer as described (22Adachi K. Asakura T. J. Biol. Chem. 1979; 254: 7765-7771Abstract Full Text PDF PubMed Google Scholar). Polymerization was initiated using the temperature jump method in which the temperature of deoxygenated hemoglobin solutions is rapidly changed from 0 to 30 °C, and aggregation is monitored turbidimetrically at 700 nm (22Adachi K. Asakura T. J. Biol. Chem. 1979; 254: 7765-7771Abstract Full Text PDF PubMed Google Scholar, 23Adachi K. Segal R. Asakura T. J. Biol. Chem. 1980; 255: 7595-7603Abstract Full Text PDF PubMed Google Scholar). Analysis of Hemoglobin Subunit Recombination—Monomeric α- and β-globin subunits were prepared as described (24Turci S.M. McDonald M.J. J. Chromatogr. 1985; 343: 168-174Crossref PubMed Scopus (19) Google Scholar). The hemolysates were treated with carbon monoxide prior to separation to reduce formation of methemoglobin. Isolated α- and β-globin monomers were allowed to combine at 0 °C for 1 h. The amounts of HbS and HbAS3 formed were determined by HPLC using a PolyCAT A cation exchange column (PolyLC, Columbia, MD). Hemoglobins were eluted from the column with a linear gradient of Buffer A (35 mm BisTris, 1.5 mm KCN, 3 mm ammonium acetate, (pH 6.47)) and Buffer B (35 mm BisTris, 1.5 mm KCN, 16.85 mm ammonium acetate, 150 mm sodium acetate, (pH 7.0)) (25Kutlar A. Kutlar F. Gu L.G. Mayson S.M. Huisman T.H. Hum. Genet. 1990; 85: 106-110Crossref PubMed Scopus (123) Google Scholar). The flow rate was 1 ml/min with detection at 415 nm. The relative amounts of each hemoglobin were calculated by integration of the area under each peak. Analysis of Heterotetramer Formation—Equimolar amounts of purified oxygenated HbS and HbAS3 or HbA were mixed and allowed to equilibrate overnight at 0 °C as described previously (17Ip C.Y. Asakura T. Anal. Biochem. 1986; 156: 348-353Crossref PubMed Scopus (6) Google Scholar). The mixtures were analyzed by cation exchange chromatography as described above with the addition of 3 mm sodium dithionite to the elution buffers. Sodium dithionite was added to allow separation of hemoglobins under anaerobic conditions, which was necessary for detection of heterotetramers. Production of HbAS3, Knock-out Transgenic Sickle Mice—Mice that express HbAS3 exclusively were produced by breeding the HbAS3 mice with mouse α- and β-globin gene knock-out animals (26Ciavatta D.J. Ryan T.M. Farmer S.C. Townes T.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9259-9263Crossref PubMed Scopus (110) Google Scholar, 27Paszty C. Mohandas N. Stevens M.E. Loring J.F. Liebhaber S.A. Brion C.M. Rubin E.M. Nat. Genet. 1995; 11: 11-39Crossref Scopus (65) Google Scholar). These animals were subsequently bred with knock-out transgenic sickle mice (28Ryan T.M. Ciavatta D.J. Townes T.M. Science. 1997; 278: 873-876Crossref PubMed Scopus (213) Google Scholar) to obtain mice that were homozygous for mouse α- and β-globin gene knock-outs and contained the human LCR α, LCR γ-βS, and LCR βAS3 transgenes. These animals expressed approximately equal amounts of HbAS3 and HbS. Hematological Indices and Histopathology—Blood was collected from anesthetized animals into Microtainer EDTA collection tubes. The red blood cell count was measured on a HemaVet 1500 hematology analyzer. Hemoglobin concentration was determined spectrophotometrically after conversion to cyanmethemoglobin with Drabkin's reagent. Before determining the hemoglobin concentration, red cell membranes were formed into pellets at 14,000 rpm for 5 min in an Eppendorf centrifuge. Removal of the membranes inhibits artifactually high values caused by membrane-bound, denatured hemoglobin. Hematocrit was measured with a JorVet J503 microhematocrit centrifuge. Reticulocyte count was determined by flow cytometry after staining with thiazole orange. Urine osmolality was measured after food and water were withheld from the mice for 4 h. Tissues were fixed in 70% alcoholic formalin, embedded in paraffin, sectioned, and stained with hematoxylin-eosin or Gomori's iron stain by standard methods. Production of Recombinant Human Hemoglobin in Transgenic Mice—Fig. 1 illustrates the major contacts present in the HbS polymer. We reported previously amino acid substitutions (βGly22 → Asp and βThr87 → Gln) that inhibit HbS polymerization (12McCune S.L. Reilly M.P. Chomo M.J. Asakura T. Townes T.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9852-9856Crossref PubMed Scopus (59) Google Scholar). To provide the modified β-globin polypeptide with a competitive advantage for interacting with α-globin chains, we made an additional amino acid substitution (βGly16 → Asp). Codon changes were introduced into the human β-globin gene by site-directed mutagenesis, and the modified sequences were inserted downstream of a 22-kb DNA fragment containing the DNase hypersensitive sites 1–5(5′-HS 1–5) of the β-globin LCR (16Ryan T.M. Townes T.M. Reilly M.P. Asakura T. Palmiter R.D. Brinster R.L. Behringer R.R. Science. 1990; 247: 566-568Crossref PubMed Scopus (100) Google Scholar). These constructs were injected into fertilized mouse eggs, and transgenic lines were established. Hemolysates obtained from several animals were analyzed by HPLC to quantitate the amounts of human, and hemoglobins (17Ip C.Y. Asakura T. Anal. Biochem. 1986; 156: 348-353Crossref PubMed Scopus (6) Google Scholar). The of the human hemoglobins was by reverse-phase HPLC, which separated the α- and β-globin subunits (19Adachi K. Asakura T. J. Chromatogr. 1987; 419: 303-307Crossref PubMed Scopus (4) Google Scholar, 20Schroeder W.A. Shelton J.B. Shelton J.R. Huynh V. Teplow D.B. Hemoglobin. 1985; 9: 461-482Crossref PubMed Scopus (30) Google Scholar). Functional Analysis of Recombinant Human Hemoglobins— The oxygen equilibrium for purified HbAS3 is that oxygen is The of oxygen at which hemoglobin is was determined for HbAS3 and with HbA and HbF The for HbAS3 is mm and is to mm in the of mm HbAS3 has a oxygen affinity HbA or affinity in the of is to that of In a HbAS3 should be from which is a that is to in to provide values of recombinant and human in a new of HbS Polymerization by Recombinant Human of HbAS3 to inhibit deoxy-HbS polymerization was analyzed by time (22Adachi K. Asakura T. J. Biol. Chem. 1979; 254: 7765-7771Abstract Full Text PDF PubMed Google Scholar). HbS or mixtures of HbS and HbF or HbAS3 were and polymerization as a of time was measured spectrophotometrically (22Adachi K. Asakura T. J. Biol. Chem. 1979; 254: 7765-7771Abstract Full Text PDF PubMed Google Scholar, 23Adachi K. Segal R. Asakura T. J. Biol. Chem. 1980; 255: 7595-7603Abstract Full Text PDF PubMed Google Scholar). Fig. that HbS rapidly but that HbF and HbAS3 HbS polymerization. HbAS3 inhibits HbS polymerization at approximately the level as which is to inhibit in at a (6Brittenham G. Lozoff B. Harris J.W. Mayson S.M. Miller A. Huisman T.H. Am. J. Hematol. 1979; 6: 107-123Crossref PubMed Scopus (51) Google Scholar, 7Wood W.G. Pembrey M.E. Serjeant G.R. Perrine R.P. Weatherall D.J. Br. J. Haematol. 1980; 45: 431-445Crossref PubMed Scopus (45) Google Scholar, C. W.A. Huisman T.H. Am. J. Hematol. PubMed Scopus Google Scholar). This strongly suggests that HbAS3 inhibit HbS polymerization in HbAS3 levels of hemoglobin. The determined in Fig. were all measured at a concentration of Fig. illustrates the results of experiments performed using of hemoglobin. The of HbS to HbF or HbAS3 in these experiments was In this the of the of the time and the of hemoglobin concentration are reported by J. W.A. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google an time and hemoglobin concentration is described by the and is an The is to the of formed polymerization. The values of the data in Fig. are and which with previously in high phosphate buffer (22Adachi K. Asakura T. J. Biol. Chem. 1979; 254: 7765-7771Abstract Full Text PDF PubMed Google Scholar). The time for mixtures of HbS with HbF and HbS with HbAS3 that HbAS3 has an to inhibit HbS polymerization that that of for with the demonstrated that were to provide the β-globin subunit with a to inhibit the polymerization of sickle hemoglobin (12McCune S.L. Reilly M.P. Chomo M.J. Asakura T. Townes T.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9852-9856Crossref PubMed Scopus (59) Google Scholar). The anti-sickling described in that was the for the anti-sickling which we have HbAS3 the at position 22 and 87 of with a mutation at position which is as C. Weatherall D.J. PubMed Scopus Google Scholar). This mutation increases the of a to compete for dimerization with an McDonald M.J. S. R. A. J. Biol. Chem. 1986; Full Text PDF PubMed Google Scholar). The parameters that a with an have been using hemoglobins M.J. S.M. J. Biol. Chem. 1987; Full Text PDF PubMed Google Scholar). The dimerization is and is the of the α- and 1987; PubMed Google Scholar). conditions, the is and the is McDonald M.J. Nature. PubMed Scopus (65) Google Scholar). that increase the on the increase to with the that the on the to with the The is to competition with a the sickle glutamic acid to the on the this erythrocytes in individuals with sickle HbS and HbA but HbS and Press, Scholar). for the to be a method to increase the of anti-sickling hemoglobin in an erythrocyte at the of sickle hemoglobin. The addition of the mutation the on βAS3 to equal that of the addition of an acid at β16 for the of a glutamic acid at βAS3 should have a competitive advantage over βS for dimerization with the When and βAS3-globin subunits are at an β-globin of HbAS3 of hemoglobin. the α-globin subunit the of HbAS3 increases a level of of hemoglobin at an of and 82% of hemoglobin at a of These results demonstrate that with the mutation have a competitive advantage over for interaction with The with the even be on the of the of in the of this polypeptide to with α-globin a recombinant hemoglobin be to form with deoxy-HbS to achieve effective of polymerization. studies have that the of HbF on the polymerization of deoxy-HbS is on the formation of R.L. T. Nature. 1975; PubMed Scopus (59) Google Scholar). A was to the polymerization of the R.L. J. W.A. G.R. G. K. Proc. Natl. Acad. Sci. U. S. A. 1979; PubMed Scopus Google Scholar). the the and are from the sickle which for the of HbF and relative to To recombinant HbAS3 form we mixed oxygenated HbAS3 with oxygenated HbS. a of hemoglobins and is results were obtained for oxygenated mixtures of HbA and HbS. of Red Blood and Hematological in Knock-out Transgenic HbAS3 inhibit HbS polymerization in we bred mice that express HbAS3 with knock-out transgenic sickle mice and obtained animals that were homozygous for mouse α- and β-globin gene knock-outs and contained the human LCR α, LCR γ-βS, and LCR βAS3 transgenes. Blood from sickle control and animals are in Fig. cells are in the sickle however, cells are in mice The is a The blood of animals also the and that are of erythrocyte morphology in SCD mice and HbS patients (28Ryan T.M. Ciavatta D.J. Townes T.M. Science. 1997; 278: 873-876Crossref PubMed Scopus (213) Google Scholar, and Press, Scholar). Fig. 5 hematological of and In red blood cell are hemoglobin levels are by is and is to levels of erythrocytes are in blood or in of These data demonstrate that HbAS3 is a potent anti-sickling hemoglobin in parameters of corrected are hematological of control sickle and Red blood cell of mice are hemoglobin levels are by is and is to levels of of and and of in of and animals are in Fig. The of sickle mice are by a of red of and a of In red and is and of sickle erythrocytes or are In is in mice are of with sickle that are 4% of of sickle animals are by of and of the with of red blood cells. of erythroid are in the and this is of is also to cell In of and aggregation of erythrocytes are and are In the of and of blood results in and and are at the are in this region of oxygen blood flow in HbS patients that results in and this of is in the sickle of sickle animals also in the and these are with Gomori's iron staining In of mice and of the red blood cell and in treated is in mice Expression of βAS3-globin should effectively lower the concentration of HbS in erythrocytes of patients with SCD, especially in the 30% of these individuals who coinherit Weatherall D.J. 1989; PubMed Google Scholar). We corrected knock-out transgenic mouse of SCD using transduction of the βAS3 anti-sickling gene into purified hematopoietic stem cells Ryan T.M. Townes T.M. PubMed Scopus Google Scholar). These results that stem and using recombinant βAS3-globin may be to be to human sickle We of the Townes for