Los puntos clave no están disponibles para este artículo en este momento.
Interleukin-1β converting enzyme (ICE) is a cytoplasmic cysteine protease required for generating the bioactive form of the interleukin-1β cytokine from its inactive precursor. We report the identification of ICH-2, a novel human gene encoding a member of the ICE cysteine protease family, and characterization of its protein product. ICH-2 mRNA is widely expressed in human tissues in a pattern similar to, but distinct from, that of ICE. Overexpression of ICH-2 in insect cells induces apoptosis. Purified ICH-2 is functional as a protease in vitro. A comparison of the inhibitor profiles and substrate cleavage by ICH-2 and ICE shows that the enzymes share catalytic properties but may differ in substrate specificities, suggesting that the two enzymes have different functions in vivo. Interleukin-1β converting enzyme (ICE) is a cytoplasmic cysteine protease required for generating the bioactive form of the interleukin-1β cytokine from its inactive precursor. We report the identification of ICH-2, a novel human gene encoding a member of the ICE cysteine protease family, and characterization of its protein product. ICH-2 mRNA is widely expressed in human tissues in a pattern similar to, but distinct from, that of ICE. Overexpression of ICH-2 in insect cells induces apoptosis. Purified ICH-2 is functional as a protease in vitro. A comparison of the inhibitor profiles and substrate cleavage by ICH-2 and ICE shows that the enzymes share catalytic properties but may differ in substrate specificities, suggesting that the two enzymes have different functions in vivo. INTRODUCTIONICE1( 1The abbreviations used are: ICEinterleukin-1β-converting enzymehICEhuman ICEIL-1βinterleukin-1βPCRpolymerase chain reactionSf9Spodoptera frugiperda cellsAcMNPVAutographa californica nuclear polyhedrosis virusN-HisNH2-terminal polyhistidinePMSFphenylmethylsulfonyl fluoridebpbase pair(s)kbkilobase(s)CHAPS3-(3-cholamidopropyl)dimethylammonio-1-propanesulfonic acidTricineN-2-hydroxy-1,1-bis(hydroxymethyl)ethylglycine.) is a member of a growing family of proteins involved in both cytokine maturation and apoptosis. ICE is an intracellular cysteine protease required for the proteolysis of the inflammatory cytokine interleukin-1β (IL-1β) to its biologically active form(1Black R.A. Kronheim S.R. Cantrell M. Deeley M.C. March C.J. Prickett K.S. Wignall J. Conlon P.J. Cosman D. Hopp T.P. Mochizuki D.Y. J. Biol. Chem. 1988; 263: 9437-9442Abstract Full Text PDF PubMed Google Scholar, 2Kostura M.J. Tocci M.J. Limjuco G. Chin J. Cameron P. Hillman A.G. Chartrain N.A. Schmidt J.A. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5227-5231Crossref PubMed Scopus (454) Google Scholar, 3Li P. Allen H. Banerjee S. Franklin S. Herzog L. Johnston C. McDowell J. Paskind M. Rodman L. Salfeld J. Towne E. Tracey D. Wardwell S. Wei F.-Y. Wong W. Kamen R. Seshadri T. Cell. 1995; 80: 401-411Abstract Full Text PDF PubMed Scopus (1299) Google Scholar, 4Thornberry N.A. Bull H.G. Calaycay J.R. Chapman K.T. Howard A.D. Kostura M.J. Miller D.K. Molineaux S.M. Weidner J.R. Aunins J. Elliston K.O. Ayala J.M. Casano F.J. Chin J. Ding G.J.-F. Egger L.A. Gaffney E.P. Limjuco G. Palyha O.C. Raju S.M. Rolando A.M. Salley J.P. Yamin T.-T. Lee T.D. Shively J.E. MacCross M. Mumford R.A. Schmidt J.A. Tocci M.J. Nature. 1992; 356: 768-774Crossref PubMed Scopus (2185) Google Scholar). Unexpectedly, a role for ICE in programmed cell death, or apoptosis, was suggested by the cloning of ced-3, an invertebrate gene whose product is required for apoptosis during development in Caenorhabditis elegans, and the observation that the Ced-3 protein is 29% identical with ICE(5Yuan J. Shaham S. Ledoux S. Ellis H.M. Horvitz H.R. Cell. 1993; 75: 641-652Abstract Full Text PDF PubMed Scopus (2234) Google Scholar). A role for ICE in apoptotic pathways was further supported by experiments showing that overexpression of ICE in a rat fibroblast cell line caused apoptosis, and this activity could be blocked by CrmA, a cowpox virus protein that is a selective inhibitor of ICE function(6Miura M. Zhu H. Rotello R. Hartwieg E.A. Yuan J. Cell. 1993; 75: 653-660Abstract Full Text PDF PubMed Scopus (1325) Google Scholar). Moreover, introduction of CrmA protein into chicken dorsal root ganglion cells or murine mammary epithelial cells blocked apoptosis induced by nerve growth factor deprivation or by the absence of extracellular matrix, respectively(7Gagliardini V. Fernandez P.A. Lee R.K. Drexler H.C. Rotello R.J. Fishman M.C. Yuan J. Science. 1994; 263: 826-828Crossref PubMed Scopus (604) Google Scholar, 8Boudreau N. Sympson C.J. Werb Z. Bissell M.J. Science. 1995; 267: 891-893Crossref PubMed Scopus (1113) Google Scholar).There is increasing evidence for an involvement of other ICE family members in apoptotic pathways. For example, a family member named Nedd-2 in mouse and ICH-1 in humans induced apoptosis when overexpressed in mammalian cells(9Kumar S. Kinoshita M. Noda M. Copeland N.G. Jenkins N.A. Genes 8: 1613-1626Crossref PubMed Scopus (585) Google Scholar, 10Wang L. Miura M. Bergeron L. Zhu H. Yuan Y. Cell. 1994; 78: 739-750Abstract Full Text PDF PubMed Scopus (800) Google Scholar). Similarly, overexpression of CPP32, another ICE family member which was isolated from human cells, induced apoptosis in Sf9 insect cells(11Fernandes-Alnemri T. Litwack G. Alnemri E.S. J. Biol. Chem. 1994; 269: 30761-30764Abstract Full Text PDF PubMed Google Scholar). Finally, another link between ICE family members and apoptosis was recently suggested by experiments showing that poly(ADP-ribose) polymerase, a protein that is processed in cells undergoing apoptosis, may be cleaved by an ICE-like chicken protease called prICE(12Lazebnik Y.A. Kaufmann S.H. Desnoyers S. Poirier G.G. Earnshaw W.C. Nature. 1994; 371: 346-347Crossref PubMed Scopus (2339) Google Scholar, 13Kaufmann S.H. Desnoyers S. Ottaviano Y. Davidson N.E. Poirier G.G. Cancer Res. 1993; 53: 3976-3985PubMed Google Scholar). Although ICE itself may participate directly in the diverse biological processes of cytokine maturation and apoptosis, it is also possible that in vivo, a related enzyme (or enzymes) plays a more pivotal role in one or both of these pathways.Recently we generated ICE-deficient mice and observed that these mice are deficient in the production of mature IL-1β, but develop normally (3). Thymocytes and macrophages from these animals undergo normal apoptosis with a variety of stimulatory signals. This suggests that despite its ability to induce apoptosis in vitro, ICE is not absolutely required for apoptosis in these murine cell types. To identify novel ICE-related proteins that may function in apoptosis or other biological processes, we have begun to clone human genes with sequence homology to human ICE (hICE). We report here the discovery of one such gene, ICH (ICE and Ced-3 homolog)-2, and a preliminary characterization of its protein product. This is the first demonstration and characterization of the protease activity of an ICE-related protein.MATERIALS AND METHODSCloning of ICH-2An oligo(dT) and random-primed human thymus cDNA library (Clontech) was screened with a 1,241-bp probe containing the entire human ICE coding sequence. The probe was generated by cleaving ICE5-1, a pGEM (Promega)-derived plasmid containing the human ICE coding sequence, with XhoI and BamHI. Hybridization of 4 × 105 plaque-forming units was performed overnight at 55°C in 10% dextran sulfate, 0.1% sodium dodecyl sulfate (SDS), 1.25 × Denhardt's solution, 5 × SSC, 500 ng/ml poly(A), and 50 μg/ml sheared salmon sperm DNA. Filters were washed in 2 × SSC, 0.1% SDS at 50°C. Forty-three positive plaques were isolated, and phage inserts were sequenced. Five clones contained inserts with overlapping segments of the ICH-2 gene. One phage isolate (Th18-3) contained an approximately 1.5-kb insert in which there was a 1,131 bp open reading frame. Both strands of this phage insert were completely sequenced using an ABI automated sequencer.The P1 clones denoted DMPC-HFF#1-319-D4 and DMPC-HFF#1-618-B9 were isolated from the DuPont Merck Pharmaceutical Co. human foreskin fibroblast P1 library 1 by Genome Systems Inc. The following PCR primers derived from the human ICE coding sequence were used for the isolation of these clones: GACATGACTACAGAGCTGG and ACCACGGCAGGCCTGGAT.Northern Blot AnalysisHuman adult tissue Northern blot membranes were purchased from Clontech. Each lane contains 2 μg of pure poly(A)+ RNA. The ICH-2-specific probe was a 264-bp fragment consisting of bases 1-250 of the ICH-2 coding sequence plus a 14-bp tail introduced by the PCR reaction. PCR primers used to generate this fragment were CCCACTAGTTCCCTATGGCAGAAGGCAACCA and GGGATATTTGGTCTATGTT. The hICE-specific probe was a 347-bp fragment derived from bases 1 to 347 of the hICE coding sequence. The sequences of the PCR primers used to generate this fragment were CCCCTCGAGGCCATGGCCGACAAGGTCCTGAAGGAG and GGAAGAAAGTACTCCTTGAGAG. The human β-actin control probe was supplied with the Northern blots (Clontech). Hybridization with the ICH-2 probe (25 ng of DNA, specific activity: 7 × 108 cpm/μg) was performed overnight at 65°C in 5 × SSPE (0.9 M NaCl, 0.5 M Na2PO4, 0.005 M EDTA, pH 7.7), 10 × Denhardt's solution, 100 μg/ml sheared salmon sperm DNA, 50% formamide, 2% SDS and was followed by two washes at 60°C in 2 × SSC, 0.1% SDS. Hybridization with the ICE probe (50 ng of DNA, specific activity: 5 × 108 cpm/μg) was performed as above except the annealing temperature was 60°C and the wash temperature was 55°C.Generation of Recombinant BaculovirusesRecombinant transfer were by of PCR generated ICE and ICH-2 into the and transfer The insert containing the ICE and ICH-2 were generated by PCR with a human ICE cDNA plasmid Franklin S. T. M.C. Herzog L. M. W. J.A. L. E. Paskind M. P. A. M. J.P. L. A. Tracey Kamen R. Wong Cell. 1994; 78: Full Text PDF PubMed Scopus Google or with ICH-2 phage clone as the The PCR primers for ICE The primers were and The PCR primers for ICH-2 and and the for both and was primers introduced for as as an sequence to ICE and both of The clones were by enzyme and generate the the transfer above were used to Sf9 cells with and using the The cell containing were and were for Recombinant plaques were of and PCR and was performed 10 of in to insert two of the were used to generate Sf9 cell were at a of of 5 in containing × cells, and was at of ICH-2 in sequences encoding of ICH-2 were into the of the E. using the following and This the ICH-2 gene the control of the and introduced an for a J. 1992; PubMed Scopus Google Scholar). cleavage was also to of the sequence. with these PCR primers in the of the coding sequences of the encoding fragment to E. A was also the for of an to ICH-2 was into E. E. and and for which also contained a plasmid encoding the of the at as caused of the and of the ICH-2 overnight at of the above was used to were at to an of and to were and 1 a that in a a of protease activity not of were in 100 of (50 pH 100 NaCl, 10% 0.1% 1 50 1 were in a and at × for at The was with A (50 M NaCl, 10% pH and a with 1 of 100 washed with and in A. The protein was with a to A plus 0.5 M active in a protease were and at and of ICE was to that of ICH-2, except that the protein was A to The of ICE and ICH-2 were by the a a of primers 1 and 4 derived from the human sequence were used to isolate the coding sequence in one for into the XhoI and of a containing plasmid derived from (Clontech). The was generated in a PCR reaction. primers 1 and were used to generate the and primers 2 and 4 were used to generate the gene product. the of these were and overlapping PCR was performed to generate the product. Finally, the cDNA was with primers 1 and 4 for into the were sequenced PCR primers used were as bases to the protein for in cleavage were generated using a in and 1 μg of plasmid was directly to were to for at and the generated proteins were used or at were in a of 100 pH 5 0.5 were in a of 100 pH 5 0.5 of μg of protein were to with and and at for were by of of containing the substrate were at and of was at for in a To substrate was between 10 and for ICE and between 100 and for was 500 for inhibitor except as were performed in AND of human thymus cDNA library was screened with a human ICE gene the phage clones isolated, 5 contained ICH-2 The of these phage inserts contained a open reading that was to human ICE Although ICE and ICH-2 are the first bases of coding sequences are related in the encoding the mature form of ICE of ICH-2 clones isolated in a similar of a human library to the of that of the are between ICE C.J. N. 1994; PubMed Scopus Google and ICH-2 with the of the of ICE. This is in ICH-2, and the of sequence between the of ICH-2 and the of the ICE gene suggests that the of these two genes may have different To that the gene we have is an expressed human gene, we performed human thymus mRNA with ICH-2-specific approximately product was and its was by not ICE is generated from its protein by of the and of N.A. Bull H.G. Calaycay J.R. Chapman K.T. Howard A.D. Kostura M.J. Miller D.K. Molineaux S.M. Weidner J.R. Aunins J. Elliston K.O. Ayala J.M. Casano F.J. Chin J. Ding G.J.-F. Egger L.A. Gaffney E.P. Limjuco G. Palyha O.C. Raju S.M. Rolando A.M. Salley J.P. Yamin T.-T. Lee T.D. Shively J.E. MacCross M. Mumford R.A. Schmidt J.A. Tocci M.J. Nature. 1992; 356: 768-774Crossref PubMed Scopus (2185) Google and contains two called and The of mature human ICE with by and another Franklin S. T. M.C. Herzog L. M. W. J.A. L. E. Paskind M. P. A. M. J.P. L. A. Tracey Kamen R. Wong Cell. 1994; 78: Full Text PDF PubMed Scopus Google Scholar, J.A. J.P. R.A. Nature. 1994; PubMed Scopus Google Scholar). that ICE is a of two and two The catalytic in the active are and of the ICE protease family have the for in the P1 Kronheim S.R. March C.J. R.A. J. Biol. Chem. Full Text PDF PubMed Google Scholar, A.D. Kostura M.J. N. Ding Limjuco G. Weidner J. Salley J.P. Mumford R.A. J. Google Scholar). form the P1 and as as and are in ICH-2, as as in ICE family members to The ICH-2 cDNA a with to ICE the entire of the two proteins and in the mature ICH-2 is the of ICE isolated to mature ICE with ICH-1 and with P1 clones containing ICE sequences were using PCR and One of these clones also contains ICH-2 suggesting that ICH-2 is in the of the ICE gene human not C.J. N. 1994; PubMed Scopus Google of ICH-2 in the pattern of ICH-2, a human adult Northern blot was with and and 347 derived from the of the coding the of sequence and of the by ICE family it was to to between family the probe to of and C.J. N. Science. 1992; PubMed Scopus Google Scholar). an we not the not The ICH-2 probe to a mRNA The of ICH-2 may be that of but the two genes a similar these ICE and ICH-2 be in tissues with the of an ICE in human M.J. J.M. M. A. and to the are and ICE is expressed in these there are of pattern of ICH-2 in human adult Northern blots were with ICH-2, and as and of are in that be used in one blot to another as the control ICE family members to have to induce apoptosis when overexpressed in cell To this was also for ICH-2, we Sf9 insect cells with a the protein or a of ICH-2 which the of insect cells with these and or ICE that of these proteins caused Sf9 cells to the and cleavage of cells undergoing apoptotic cell in Sf9 cells ICE or was isolated from Sf9 cells with or the following ICE ICE ICE ICH-2 and ICH-2 ICE and ICH-2 are ICE and ICH-2 are the and ICE is the of ICE was a are and of ICH-2 of performed by ICE is a of cleavage and N.A. Bull H.G. Calaycay J.R. Chapman K.T. Howard A.D. Kostura M.J. Miller D.K. Molineaux S.M. Weidner J.R. Aunins J. Elliston K.O. Ayala J.M. Casano F.J. Chin J. Ding G.J.-F. Egger L.A. Gaffney E.P. Limjuco G. Palyha O.C. Raju S.M. Rolando A.M. Salley J.P. Yamin T.-T. Lee T.D. Shively J.E. MacCross M. Mumford R.A. Schmidt J.A. Tocci M.J. Nature. 1992; 356: 768-774Crossref PubMed Scopus (2185) Google Scholar). and are in ICH-2 and The ICE is not in ICH-2, but there is an at which the cleavage for of the and of a form of to generate ICH-2 protein with cysteine protease we the sequences encoding of ICH-2 into an E. the control of an with similar experiments the ICE this of ICH-2 was to be expressed in E. and as an active protease from the was for the ICE protein an sequence was introduced the coding of ICH-2 to of the ICE catalytic properties with similar to of V. ICH-2 was expressed in E. and by Purified ICH-2 an as two with of and 10 not suggesting that the ICH-2 is processed to to of mature ICE during Purified ICE also at and 10 suggesting that a of the ICE protein was inactive not of the was identical to the ICH-2 sequence of showing that this may as an to of ICE. activity of ICH-2 was in two the ICH-2 protein was for the ability to protein and its properties were in more using to human at two cleavage between and a and cleavage between and the bioactive M.J. Tocci M.J. Limjuco G. Chin J. Cameron P. Hillman A.G. Chartrain N.A. Schmidt J.A. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5227-5231Crossref PubMed Scopus (454) Google Scholar, R.A. Kronheim S.R. 1989; PubMed Scopus Google Scholar). To the cleavage performed by the two we cleavage of an substrate protein by the ICH-2 and ICE ICE processed of the to the mature form by the with ICH-2 to the of of mature IL-1β, To the ability of the two enzymes to generate the of ICH-2 or ICE were with a protein in which to ICE and ICH-2 are to this protein such that the mature form of is generated ICE of the substrate to the form by 5 ICH-2 this cleavage to by the that ICE at both the and ICH-2 a in its activity these two cleavage of ICE protein in vitro. cleavage of cleavage of in which to μg for 5 μg for of ICE and ICH-2 were with the substrate were to at the and at the of the a of the the mature and the are with in catalytic properties of ICE and ICH-2 were using the substrate L.A. J. Res. 1994; PubMed Scopus Google Scholar). of substrate were to the to which were for ICH-2 and 10 for ICE. The inhibitor of also in to the the substrate at to the for of and for ICE and ICH-2, similar the two Both were to the and as cysteine and both were to the protease inhibitor Biol. Chem. Scopus Google an inhibitor of cysteine H. M. J. PubMed Scopus Google with ICE a R.A. Kronheim S.R. 1989; PubMed Scopus Google was The of these inhibitor and that the enzymes share catalytic but differ in of proteins in the of ICH-2 in a We have a member of the ICE cysteine protease family, a family with or in both and apoptosis. The of sequence between ICE and ICH-2 suggests that the two have similar or overlapping functions in vivo. it is that ICE and ICH-2 are not ICH-2 is expressed in and J. but not for the of ICE protein in ICE-deficient in the production of mature or the to (3). We here in the of protein and and by ICE and ICH-2, suggesting that ICE and ICH-2 may participate in different functions or were performed in in the of at the as and are expressed as of control INTRODUCTIONICE1( 1The abbreviations used are: ICEinterleukin-1β-converting enzymehICEhuman ICEIL-1βinterleukin-1βPCRpolymerase chain reactionSf9Spodoptera frugiperda cellsAcMNPVAutographa californica nuclear polyhedrosis virusN-HisNH2-terminal polyhistidinePMSFphenylmethylsulfonyl fluoridebpbase pair(s)kbkilobase(s)CHAPS3-(3-cholamidopropyl)dimethylammonio-1-propanesulfonic acidTricineN-2-hydroxy-1,1-bis(hydroxymethyl)ethylglycine.) is a member of a growing family of proteins involved in both cytokine maturation and apoptosis. ICE is an intracellular cysteine protease required for the proteolysis of the inflammatory cytokine interleukin-1β (IL-1β) to its biologically active form(1Black R.A. Kronheim S.R. Cantrell M. Deeley M.C. March C.J. Prickett K.S. Wignall J. Conlon P.J. Cosman D. Hopp T.P. Mochizuki D.Y. J. Biol. Chem. 1988; 263: 9437-9442Abstract Full Text PDF PubMed Google Scholar, 2Kostura M.J. Tocci M.J. Limjuco G. Chin J. Cameron P. Hillman A.G. Chartrain N.A. Schmidt J.A. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5227-5231Crossref PubMed Scopus (454) Google Scholar, 3Li P. Allen H. Banerjee S. Franklin S. Herzog L. Johnston C. McDowell J. Paskind M. Rodman L. Salfeld J. Towne E. Tracey D. Wardwell S. Wei F.-Y. Wong W. Kamen R. Seshadri T. Cell. 1995; 80: 401-411Abstract Full Text PDF PubMed Scopus (1299) Google Scholar, 4Thornberry N.A. Bull H.G. Calaycay J.R. Chapman K.T. Howard A.D. Kostura M.J. Miller D.K. Molineaux S.M. Weidner J.R. Aunins J. Elliston K.O. Ayala J.M. Casano F.J. Chin J. Ding G.J.-F. Egger L.A. Gaffney E.P. Limjuco G. Palyha O.C. Raju S.M. Rolando A.M. Salley J.P. Yamin T.-T. Lee T.D. Shively J.E. MacCross M. Mumford R.A. Schmidt J.A. Tocci M.J. Nature. 1992; 356: 768-774Crossref PubMed Scopus (2185) Google Scholar). Unexpectedly, a role for ICE in programmed cell death, or apoptosis, was suggested by the cloning of ced-3, an invertebrate gene whose product is required for apoptosis during development in Caenorhabditis elegans, and the observation that the Ced-3 protein is 29% identical with ICE(5Yuan J. Shaham S. Ledoux S. Ellis H.M. Horvitz H.R. Cell. 1993; 75: 641-652Abstract Full Text PDF PubMed Scopus (2234) Google Scholar). A role for ICE in apoptotic pathways was further supported by experiments showing that overexpression of ICE in a rat fibroblast cell line caused apoptosis, and this activity could be blocked by CrmA, a cowpox virus protein that is a selective inhibitor of ICE function(6Miura M. Zhu H. Rotello R. Hartwieg E.A. Yuan J. Cell. 1993; 75: 653-660Abstract Full Text PDF PubMed Scopus (1325) Google Scholar). Moreover, introduction of CrmA protein into chicken dorsal root ganglion cells or murine mammary epithelial cells blocked apoptosis induced by nerve growth factor deprivation or by the absence of extracellular matrix, respectively(7Gagliardini V. Fernandez P.A. Lee R.K. Drexler H.C. Rotello R.J. Fishman M.C. Yuan J. Science. 1994; 263: 826-828Crossref PubMed Scopus (604) Google Scholar, 8Boudreau N. Sympson C.J. Werb Z. Bissell M.J. Science. 1995; 267: 891-893Crossref PubMed Scopus (1113) Google Scholar).There is increasing evidence for an involvement of other ICE family members in apoptotic pathways. For example, a family member named Nedd-2 in mouse and ICH-1 in humans induced apoptosis when overexpressed in mammalian cells(9Kumar S. Kinoshita M. Noda M. Copeland N.G. Jenkins N.A. Genes 8: 1613-1626Crossref PubMed Scopus (585) Google Scholar, 10Wang L. Miura M. Bergeron L. Zhu H. Yuan Y. Cell. 1994; 78: 739-750Abstract Full Text PDF PubMed Scopus (800) Google Scholar). Similarly, overexpression of CPP32, another ICE family member which was isolated from human cells, induced apoptosis in Sf9 insect cells(11Fernandes-Alnemri T. Litwack G. Alnemri E.S. J. Biol. Chem. 1994; 269: 30761-30764Abstract Full Text PDF PubMed Google Scholar). Finally, another link between ICE family members and apoptosis was recently suggested by experiments showing that poly(ADP-ribose) polymerase, a protein that is processed in cells undergoing apoptosis, may be cleaved by an ICE-like chicken protease called prICE(12Lazebnik Y.A. Kaufmann S.H. Desnoyers S. Poirier G.G. Earnshaw W.C. Nature. 1994; 371: 346-347Crossref PubMed Scopus (2339) Google Scholar, 13Kaufmann S.H. Desnoyers S. Ottaviano Y. Davidson N.E. Poirier G.G. Cancer Res. 1993; 53: 3976-3985PubMed Google Scholar). Although ICE itself may participate directly in the diverse biological processes of cytokine maturation and apoptosis, it is also possible that in vivo, a related enzyme (or enzymes) plays a more pivotal role in one or both of these pathways.Recently we generated ICE-deficient mice and observed that these mice are deficient in the production of mature IL-1β, but develop normally (3). Thymocytes and macrophages from these animals undergo normal apoptosis with a variety of stimulatory signals. This suggests that despite its ability to induce apoptosis in vitro, ICE is not absolutely required for apoptosis in these murine cell types. To identify novel ICE-related proteins that may function in apoptosis or other biological processes, we have begun to clone human genes with sequence homology to human ICE (hICE). We report here the discovery of one such gene, ICH (ICE and Ced-3 homolog)-2, and a preliminary characterization of its protein product. This is the first demonstration and characterization of the protease activity of an ICE-related
Kamens et al. (Thu,) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: