The Kinetics of p53 Activation Versus Cyclin E Accumulation Underlies the Relationship between the Spindle-assembly Checkpoint and the Postmitotic Checkpoint

Although cells can exit mitotic block aberrantly by mitotic slippage, they are prevented from becoming tetraploids by a p53-dependent postmitotic checkpoint. Intriguingly, disruption of the spindle-assembly checkpoint also compromises the postmitotic checkpoint. The precise mechanism of the interplay between these two pivotal checkpoints is not known. We found that after prolonged nocodazole exposure, the postmitotic checkpoint was facilitated by p53. We demonstrated that although disruption of the mitotic block by a MAD2-binding protein promoted slippage, it did not influence the activation of p53. Both p53 and its downstream target p21CIP1/WAF1 were activated at the same rate irrespective of whether the spindle-assembly checkpoint was enforced or not. The accelerated S phase entry, as reflected by the premature accumulation of cyclin E relative to the activation of p21CIP1/WAF1, is the reason for the uncoupling of the postmitotic checkpoint. In support of this hypothesis, forced premature mitotic exit with a specific CDK1 inhibitor triggered DNA replication without affecting the kinetics of p53 activation. Finally, replication after checkpoint bypass was boosted by elevating the level of cyclin E. These observations indicate that disruption of the spindle-assembly checkpoint does not directly influence p53 activation, but the shortening of the mitotic arrest allows cyclin E-CDK2 to be activated before the accumulation of p21CIP1/WAF1. These data underscore the critical relationship between the spindle-assembly checkpoint and the postmitotic checkpoint in safeguarding chromosomal stability. Although cells can exit mitotic block aberrantly by mitotic slippage, they are prevented from becoming tetraploids by a p53-dependent postmitotic checkpoint. Intriguingly, disruption of the spindle-assembly checkpoint also compromises the postmitotic checkpoint. The precise mechanism of the interplay between these two pivotal checkpoints is not known. We found that after prolonged nocodazole exposure, the postmitotic checkpoint was facilitated by p53. We demonstrated that although disruption of the mitotic block by a MAD2-binding protein promoted slippage, it did not influence the activation of p53. Both p53 and its downstream target p21CIP1/WAF1 were activated at the same rate irrespective of whether the spindle-assembly checkpoint was enforced or not. The accelerated S phase entry, as reflected by the premature accumulation of cyclin E relative to the activation of p21CIP1/WAF1, is the reason for the uncoupling of the postmitotic checkpoint. In support of this hypothesis, forced premature mitotic exit with a specific CDK1 inhibitor triggered DNA replication without affecting the kinetics of p53 activation. Finally, replication after checkpoint bypass was boosted by elevating the level of cyclin E. These observations indicate that disruption of the spindle-assembly checkpoint does not directly influence p53 activation, but the shortening of the mitotic arrest allows cyclin E-CDK2 to be activated before the accumulation of p21CIP1/WAF1. These data underscore the critical relationship between the spindle-assembly checkpoint and the postmitotic checkpoint in safeguarding chromosomal stability. Genome instability in the form of aneuploidy is commonly found in solid tumors. It has been suggested that mutations that lead to compromised spindle-assembly checkpoint may increase the chance of chromosome missegregation, leading to aneuploidy (1Rajagopalan H. Nowak M.A. Vogelstein B. Lengauer C. Nat. Rev. Cancer. 2003; 3: 695-701Crossref PubMed Scopus (407) Google Scholar, 2Kops G.J. Weaver B.A. Cleveland D.W. Nat. Rev. Cancer. 2005; 5: 773-785Crossref PubMed Scopus (918) Google Scholar). Tetraploidization is also believed to be a route to aneuploidy (3Ganem N.J. Storchova Z. Pellman D. Curr. Opin. Genet. Dev. 2007; 17: 157-162Crossref PubMed Scopus (521) Google Scholar). Transient blocking of cytokinesis in p53-null mouse mammary epithelial cells generates tetraploids, which promotes aneuploidy and tumorigenesis (4Fujiwara T. Bandi M. Nitta M. Ivanova E.V. Bronson R.T. Pellman D. Nature. 2005; 437: 1043-1047Crossref PubMed Scopus (790) Google Scholar). Another study reported that chromosome nondisjunction (both copies of a chromosome segregate to the same daughter cells) leads to binucleated tetraploids by promoting cleavage furrow regression; the tetraploid cells then become aneuploidy through further divisions (5Shi Q. King R.W. Nature. 2005; 437: 1038-1042Crossref PubMed Scopus (325) Google Scholar). These and other studies provide strong evidence on the importance of polyploidization in tumorigenesis. During mitosis, microtubules radiated from two opposite spindle poles and captured chromosomes by attaching to the kinetochores. Sister chromatid segregation is only initiated when all the chromosomes have achieved bipolar attachment to the mitotic spindles. The current paradigm states that unattached kinetochores or the absence of tension between paired kinetochores activates a surveillance mechanism called spindle-assembly checkpoint. The underlying mechanism of the checkpoint is not completely defined, but a growing body of evidence indicates that unattached kinetochores attract the components of the checkpoint machinery. This catalyzes the formation of diffusible mitotic checkpoint complexes (components include MAD2, BUBR1, and BUB3), which in turn inhibit APC/C-CDC20. This mechanism maintains high levels of active cyclin B1-CDK1 and locks the cell in prometaphase (reviewed in Ref. 6Musacchio A. Salmon E.D. Nat. Rev. Mol. Cell Biol. 2007; 8: 379-393Crossref PubMed Scopus (1721) Google Scholar). The mitotic block triggered by the spindle-assembly checkpoint is not permanent, and cells can exit mitosis aberrantly by a process known as mitotic slippage (also known as adaptation) (reviewed in Ref. 7Weaver B.A. Cleveland D.W. Cancer Cell. 2005; 8: 7-12Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). During mitotic slippage, cyclin B1-CDK1 is inactivated, and the cells enter G1 phase without first going through chromosome segregation and cytokinesis, yielding tetraploid G1 cells. DNA re-replication in these cells is prevented by a p53-dependent mechanism that arrests cells in postmitotic G1 phase, often referred to as the postmitotic checkpoint (8Cross S.M. Sanchez C.A. Morgan C.A. Schimke M.K. Ramel S. Idzerda R.L. Raskind W.H. Reid B.J. Science. 1995; 267: 1353-1356Crossref PubMed Scopus (675) Google Scholar, 9Di Leonardo A. Khan S.H. Linke S.P. Greco V. Seidita G. Wahl G.M. Cancer Res. 1997; 57: 1013-1019PubMed Google Scholar, 10Khan S.H. Wahl G.M. Cancer Res. 1998; 58: 396-401PubMed Google Scholar, 11Lanni J.S. Jacks T. Mol. Cell. Biol. 1998; 18: 1055-1064Crossref PubMed Scopus (447) Google Scholar, 12Casenghi M. Mangiacasale R. Tuynder M. Caillet-Fauquet P. Elhajouji A. Lavia P. Mousset S. Kirsch-Volders M. Cundari E. Exp. Cell Res. 1999; 250: 339-350Crossref PubMed Scopus (92) Google Scholar, 13Sablina A.A. Agapova L.S. Chumakov P.M. Kopnin B.P. Cell Biol. Int. 1999; 23: 323-334Crossref PubMed Scopus (29) Google Scholar). The detailed molecular mechanism of this postmitotic checkpoint is unclear. It was previously believed that this checkpoint is triggered by the presence of tetraploid DNA content (14Andreassen P.R. Lohez O.D. Lacroix F.B. Margolis R.L. Mol. Biol. Cell. 2001; 12: 1315-1328Crossref PubMed Scopus (336) Google Scholar). More recent studies, however, refute this idea and indicate that there is no specific tetraploidy checkpoint that directly count DNA or centrosomes (reviewed in Ref. 15Ganem N.J. Pellman D. Cell. 2007; 131: 437-440Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). Nevertheless, it is generally accepted that p53 does play an important role in preventing re-replication after mitotic slippage. For example, p53–/– mouse embryonic fibroblasts can spontaneously become tetraploids during culturing (16Borel F. Lohez O.D. Lacroix F.B. Margolis R.L. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 9819-9824Crossref PubMed Scopus (155) Google Scholar). Furthermore, tetraploids induced in mouse mammary epithelial cells by cytokinesis failure (4Fujiwara T. Bandi M. Nitta M. Ivanova E.V. Bronson R.T. Pellman D. Nature. 2005; 437: 1043-1047Crossref PubMed Scopus (790) Google Scholar) or in human cells by virally induced cell fusion (17Duelli D.M. Hearn S. Myers M.P. Lazebnik Y. J. Cell Biol. 2005; 171: 493-503Crossref PubMed Scopus (72) Google Scholar) can be propagated in the absence of p53. The G1 arrest of the postmitotic checkpoint is at least in part because of the cyclin-dependent kinase inhibitor p21CIP1/WAF1, a transcriptional target of p53 (10Khan S.H. Wahl G.M. Cancer Res. 1998; 58: 396-401PubMed Google Scholar, 11Lanni J.S. Jacks T. Mol. Cell. Biol. 1998; 18: 1055-1064Crossref PubMed Scopus (447) Google Scholar, 18Stewart Z.A. Leach S.D. Pietenpol J.A. Mol. Cell. Biol. 1999; 19: 205-215Crossref PubMed Scopus (155) Google Scholar). It is possible that other p53-independent mechanisms also contribute to the postmitotic checkpoint. Expression of HPV 3The abbreviations used are: HPV, human papillomavirus; GFP, green fluorescent protein; siRNA, small interfering RNA; GFP, green fluorescent protein. 3The abbreviations used are: HPV, human papillomavirus; GFP, green fluorescent protein; siRNA, small interfering RNA; GFP, green fluorescent protein. E6 oncoprotein, which targets p53 for degradation, can abolish the postmitotic checkpoint without affecting the spindle-assembly checkpoint. Interestingly, E6 mutant defective in p53 degradation can also partially induce polyploidy, suggesting the presence of a p53-independent postmitotic checkpoint mechanism (19Liu Y. Heilman S.A. Illanes D. Sluder G. Chen J.J. Cancer Res. 2007; 67: 2603-2610Crossref PubMed Scopus (41) Google Scholar). Moreover, proper function of the spindle-assembly checkpoint is required for the postmitotic G1 checkpoint (20Vogel C. Kienitz A. Hofmann I. Muller R. Bastians H. Oncogene. 2004; 23: 6845-6853Crossref PubMed Scopus (130) Google Scholar). Vogel et al. (20Vogel C. Kienitz A. Hofmann I. Muller R. Bastians H. Oncogene. 2004; 23: 6845-6853Crossref PubMed Scopus (130) Google Scholar) shows that spindle-assembly checkpoint-compromised HCT116 cells failed to arrest at the postmitotic checkpoint after nocodazole treatment. What is the molecular mechanism underlying the linkage between the spindle-assembly checkpoint and the postmitotic checkpoint? We hypothesize that the spindle-assembly checkpoint may directly control the activation of the p53 pathway. Alternatively, the checkpoint may act independently of p53 activation, but a defective checkpoint may somehow desensitize the cell cycle to p53-mediated inhibition. In this study, we present observations that unequivocally show that the disruption of the spindle-assembly checkpoint does not influence the activation of p53. We found that after prolonged nocodazole exposure, the postmitotic checkpoint was facilitated by p53 and p21CIP1/WAF1 after mitotic slippage as well as after the cells were released into G1 phase. Curtailing the duration of the spindle-assembly checkpoint by either ectopic expression of MAD2L1BP or a CDK1 inhibitor abolished the postmitotic checkpoint. This was achieved through an acceleration of S phase entry, as reflected by the premature accumulation of cyclin E1, relative to the activation of p53/p21CIP1/WAF1. These results indicate that the spindle-assembly checkpoint does not directly control p53 activation, but the shortening of the mitotic arrest after uncoupling of the checkpoint allows cyclin E1-CDK2 to be activated before the accumulation of sufficient levels of p21CIP1/WAF1. Materials—All reagents were obtained from Sigma unless stated otherwise. DNA Constructs and siRNA—MAD2L1BP cDNA (IMAGE 3945348) was amplified by PCR with the primers 5′GCCATGGCGGCGCCGGAGGCGG3′ and the PCR was with and into R.W. Mol. Cell. Biol. 1999; 19: PubMed Scopus (72) Google Scholar) to in was into the to in for A. Mol. Cell. Biol. 2004; PubMed Scopus Google cyclin T. A. PubMed Scopus Google and J. Biol. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar) were or obtained from as The cyclin cDNA was amplified by PCR with the primers and the PCR was with and into to in HPV was the from and control were obtained from Cell cell and cells were obtained from the cell was obtained from was a cell with the expression of p53 control Chen Cancer Cell Int. 2005; 5: PubMed Scopus Google Scholar) and was a from of and p53–/– mouse embryonic fibroblasts were from obtained from at of as previously Dev. 2004; 18: PubMed Scopus Google Scholar). were in with or to the stated cells were with the reagents at the inhibitor from nocodazole and were with the and in Scholar). of was were as previously H. T. Mol. Biol. Cell. 1995; PubMed Scopus Google Scholar). was as previously T. A. PubMed Scopus Google Scholar). For of cell cells were with in and in of were and propagated in the absence of and were as previously T. Exp. Cell Res. 1999; 250: PubMed Scopus Google Scholar). by J. Biol. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar) and A. T. Mol. Cancer 2004; 3: Google Scholar) were as and cyclin D. Proc. Natl. Acad. Sci. U. S. A. 2001; PubMed Scopus Google CDK1 A. T. Mol. Cancer 2004; 3: Google R.W. Mol. Cell. Biol. 1999; 19: PubMed Scopus (72) Google A. J. Biol. 2002; Full Text Full Text PDF PubMed Scopus Google and A. T. Mol. Cancer 2004; 3: Google Scholar) were obtained from as cyclin cyclin cyclin p53 p21CIP1/WAF1 and were obtained from was obtained from and were obtained from and were as H. T. Mol. Biol. Cell. 1995; PubMed Scopus Google Scholar). of the during the the relationship between mitotic slippage and p53 activation, cells were with nocodazole for to The shows that cyclin and after of the The of the activation of the spindle-assembly checkpoint Z. H. S. J. Chen J. V. Cell 1999; Google Scholar). slippage further and which was reflected by the of cyclin and of and to The p53 was with the slippage, as by the accumulation of p53 and p21CIP1/WAF1. that cells a DNA content after slippage, the cells were in results were obtained with cell cell is that cell after prolonged nocodazole as by the of the cell cycle to This is in with the that tetraploid cells because of mitotic slippage were to and M. A. S. I. A. P. A. S. E. V. C. G. J. PubMed Scopus Google Scholar, Y. Cancer Cell. 2005; 8: Full Text Full Text PDF PubMed Scopus Google Scholar). also to a as by the accumulation of of after nocodazole in cell and was because of but not DNA Ivanova J. Biol. 1998; Full Text Full Text PDF PubMed Scopus Google Scholar, C. F. F. T. Z. Mol. Cell. 23: Full Text Full Text PDF PubMed Scopus Google because the be abolished by a inhibitor the that the cells did of replication but a inhibitor was with nocodazole to inhibit shows that although the inhibitor cell no re-replication was mitotic slippage p53 activation was by the inhibitor was during slippage, and were in the cell cycle with a DNA The current paradigm states that replication after slippage is by p53. In with re-replication can be after nocodazole and inhibitor in a p53-null The of p53 during and after whether p53 is during mitosis or after slippage, the expression of p53 and was with The level was by the as well as by a p53-null cell after nocodazole p53 to in mitotic and cells. the of mitotic cells the cells after of the cells was found in the cells that slippage in the mitotic cells. et al. M. Mangiacasale R. M. M. M. S. Lavia P. Cundari E. J. Biol. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar) reported that p53 is in cells and cells after a to preventing G1 cells from into S phase after the of the level of p53 induced during mitotic block was sufficient to a cell cycle cells were with nocodazole before in This well cells as to through the cell cycle the of cyclin E1, cyclin and cyclin through the cell cells as not be after activation of the spindle-assembly checkpoint. Although the of cells a DNA content after to only of the cells were released into G1 phase Furthermore, and cells failed to enter S phase with in and cyclin after an and cyclin did not increase during the of the In with the cell cycle we found that p53 and p21CIP1/WAF1 in and from the spindle-assembly checkpoint. between p21CIP1/WAF1 and was by to the DNA re-replication in the presence of replication after from nocodazole block was also by the p53 of p53 into the p53-null cell DNA replication after from nocodazole block disruption of p53 allows replication after nocodazole block whether p53 was in G1 cells with or DNA expression of p53 in cells was by shows that at after from a nocodazole p53 was in and these data show that after a activation of the spindle-assembly the in G1 and tetraploid G1 was by an accumulation of p53. The for Cell but for the relationship between the spindle-assembly checkpoint and the postmitotic a cell that MAD2L1BP (also called MAD2-binding protein or a inhibitor of G. T. J. T. H. J. 2004; 23: PubMed Scopus Google Scholar, T. S.H. J. T. J. 2002; PubMed Scopus Google was the spindle-assembly checkpoint was compromised in the presence of as reflected by the of of nocodazole This is also by the absence of MAD2L1BP triggered re-replication nocodazole that MAD2L1BP also the postmitotic checkpoint Intriguingly, p53 and p21CIP1/WAF1 were in cells. This was when cells were with either the cells or with the same cells when the expression of the protein was by the absence of a MAD2L1BP did not the p53 in the absence of rate of p21CIP1/WAF1 accumulation relative to mitotic slippage the postmitotic checkpoint. kinetics of mitotic slippage after the expression of cells were with with either or for were released from the block and with or without was to the spindle-assembly checkpoint. The cells were at the and for for the of was by for kinetics of re-replication after the expression of were as in A. The cells were for at the the that the was by of the spindle-assembly checkpoint was also activated the protein (also called A. P. M. M. Cell. 1995; Full Text PDF PubMed Scopus Google Scholar). to nocodazole of promoted re-replication in cells but not in the cells Moreover, the expression of p53 and p21CIP1/WAF1 in cell these data indicate that the postmitotic checkpoint also when the spindle-assembly checkpoint is p53 and p21CIP1/WAF1 were induced in the absence of the postmitotic checkpoint. The of of the the between the and the a detailed relationship between the spindle-assembly checkpoint and p53 activation, cells were first with then released into the cell and with nocodazole at the same shows that control cells were in mitosis from with of The activation of the spindle-assembly checkpoint was by the of and the of and slippage, by of mitotic through and and and at E1, the for only after slippage. In cells MAD2L1BP mitotic slippage. of at at least of control cells. that although control cells were with a DNA content after slippage, cells DNA the kinetics of p53 activation was by the expression of p53 and p21CIP1/WAF1 was in the same Interestingly, the of accumulation of p53 and p21CIP1/WAF1 was in the presence or absence of MAD2L1BP the postmitotic checkpoint was in cells because they S phase before p21CIP1/WAF1 to In with this cyclin at in the presence of well before p21CIP1/WAF1 was activated In slippage and cyclin accumulation in control cells when p53 and p21CIP1/WAF1 although the was activated at a rate after the of cells the spindle-assembly checkpoint G1 phase to become to the postmitotic checkpoint. the is we that cells re-replication not high level of p21CIP1/WAF1. this we the of p21CIP1/WAF1 in cells in the MAD2L1BP re-replication shows that p21CIP1/WAF1 was at a level at the of re-replication In re-replication only in cells with p21CIP1/WAF1 expression between and a although cells that were levels of p21CIP1/WAF1, that re-replication levels of p21CIP1/WAF1. These further support the that with a defective spindle-assembly p21CIP1/WAF1 is not activated in a to the postmitotic checkpoint. Another of the is that an increase of the level of p53 the postmitotic checkpoint when the spindle-assembly checkpoint is cells were with p53 to nocodazole shows that the control cells re-replication as In cells were to re-replication In a the postmitotic checkpoint in the cells spindle-assembly was when p53 function was by the expression of HPV E6 protein these results indicate that the of p53 and p21CIP1/WAF1 after mitotic slippage is the for the postmitotic which in turn is by the duration of the spindle-assembly by of B1-CDK1 the p53-mediated are on the disruption of the spindle-assembly checkpoint with It can be that the proper activation of the spindle-assembly checkpoint is required to the of the postmitotic checkpoint on this cells were first in mitosis with nocodazole to the spindle-assembly checkpoint to be slippage was induced by of a specific CDK1 inhibitor called C. Chen S. D. H. Chen Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). of the is in cells that were with nocodazole a DNA content In of the nocodazole block with a of in These data suggested that of cyclin B1-CDK1 induced premature slippage and compromised the function of the postmitotic checkpoint. In support of this was to in control it was after of and was on because its as cyclin and were In with the premature slippage and cyclin treatment. the activation of p53 and p21CIP1/WAF1 they to levels in the presence of levels were at the of slippage and to the by the spindle-assembly checkpoint with these results indicate that premature slippage leads to postmitotic checkpoint failure because the did not have sufficient to and cyclin Finally, we elevating the cyclin level re-replication after checkpoint cyclin E1, cells were with nocodazole by a of as shows that in with re-replication was boosted by the levels of cyclin We demonstrated that p53 is and activated after prolonged activation of the spindle-assembly checkpoint. of the p53 was not to with spindle but also by of results that p53 to during the mitotic block and after mitotic slippage is not required for p53 activation, cells that were released from the mitotic block into G1 also p53 and of the recent is that spindle-assembly checkpoint-compromised cells can DNA re-replication after mitotic slippage they p53 (20Vogel C. Kienitz A. Hofmann I. Muller R. Bastians H. Oncogene. 2004; 23: 6845-6853Crossref PubMed Scopus (130) Google Scholar). This indicates that spindle-assembly checkpoint and p53 are required for the postmitotic G1 checkpoint. Vogel et al. (20Vogel C. Kienitz A. Hofmann I. Muller R. Bastians H. Oncogene. 2004; 23: 6845-6853Crossref PubMed Scopus (130) Google Scholar) that the transcriptional of p53 may be in spindle checkpoint-compromised cells. In with this we found that the p53 downstream target p21CIP1/WAF1 was induced at the same rate in cells and in cells in the spindle-assembly checkpoint this does not the data may have an role of the in the postmitotic checkpoint. the because the duration of the mitotic block was in the absence of the spindle-assembly the cells cyclin E and S phase before p21CIP1/WAF1 to These results also that after the of p53 its accumulation rate is irrespective of the duration of the mitotic arrest or slippage. but is p53 is activated after spindle of mechanisms have been but the process and It has been suggested that spindle disruption leads to DNA which a DNA in G1 F. A. M. M. Oncogene. 2007; PubMed Scopus Google Scholar). studies that the postmitotic checkpoint are by the that and in DNA (reviewed in Ref. 15Ganem N.J. Pellman D. Cell. 2007; 131: 437-440Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). We did not evidence of DNA after nocodazole or Although is during prolonged mitotic block and or after from the block we believed that it was a of DNA of DNA was by and R. Y. C. Although is known to be a DNA have that is induced after of DNA C. Y. J. Biol. Full Text Full Text PDF PubMed Scopus Google Scholar) and is required for DNA formation C. F. F. T. Z. Mol. Cell. 23: Full Text Full Text PDF PubMed Scopus Google Scholar). In with these studies, we found that but not mitotic and were for after nocodazole abolish the without affecting p53 activation In support of the role of DNA in the postmitotic has also been suggested to be an of p53 after spindle et al. A. E. M. Mangiacasale R. A. Lavia P. S. Cundari E. Mol. Biol. Cell. 2004; PubMed Scopus Google Scholar) a that during mitosis, is by and is to the of A. E. M. Mangiacasale R. A. Lavia P. S. Cundari E. Mol. Biol. Cell. 2004; PubMed Scopus Google Scholar). disruption the M. Mangiacasale R. M. M. M. S. Lavia P. Cundari E. J. Biol. 2001; Full Text Full Text PDF PubMed Scopus Google preventing the of which are to not postmitotic arrest after nocodazole block and A. E. M. Mangiacasale R. A. Lavia P. S. Cundari E. Mol. Biol. Cell. 2004; PubMed Scopus Google Scholar). In with these Vogel et al. (20Vogel C. Kienitz A. Hofmann I. Muller R. Bastians H. Oncogene. 2004; 23: 6845-6853Crossref PubMed Scopus (130) Google Scholar) found that components of the DNA checkpoint and are not required for the p53 activation. We were also not to after nocodazole and we found that p53 activation the postmitotic checkpoint recent studies have also suggested that centrosomes may the that p53 during the postmitotic checkpoint Y. J. J.J. S. A. Sluder G. J. Cell Biol. 2007; PubMed Scopus Google Scholar, V. A. A. J. Cell Biol. PubMed Scopus Google Scholar, B. P. A. P. S. Nat. Cell Biol. 2007; PubMed Scopus Google Scholar). In this a protein is believed to of p53 Y. J. J.J. S. A. Sluder G. J. Cell Biol. 2007; PubMed Scopus Google Scholar, B. P. A. P. S. Nat. Cell Biol. 2007; PubMed Scopus Google Scholar). Another for is also to the from centrosomes to the it and Y. D. A. H. M. Dev. PubMed Scopus Google Scholar). This allows p53 to which in turn in a that of the cells or the act of may checkpoints in tetraploid cells Y. J. J.J. S. A. Sluder G. J. Cell Biol. 2007; PubMed Scopus Google Scholar, Y. Sluder G. J. Cell Biol. 2004; PubMed Scopus Google further is required to whether these are or not. We and for with