Key points are not available for this paper at this time.
Ferritin is a ubiquitous protein that plays a critical role in regulating intracellular iron homoeostasis by storing iron inside its multimeric shell. It also plays an important role in detoxifying potentially harmful free ferrous iron to the less soluble ferric iron by virtue of the ferroxidase activity of the H subunit. Although excess iron is stored primarily in cytoplasm, most of the metabolically active iron in cells is processed in mitochondria. Little is yet known of how these organelles regulate iron homeostasis and toxicity. Here we report an unusual intronless gene on chromosome 5q23. 1 that encodes a 242-amino acid precursor of a ferritin H-like protein. This 30-kDa protein is targeted to mitochondria and processed to a 22-kDa subunit that assembles into typical ferritin shells and has ferroxidase activity. Immunohistochemical analysis showed that it accumulates in high amounts in iron-loaded mitochondria of erythroblasts of subjects with impaired heme synthesis. This new ferritin may play an important role in the regulation of mitochondrial iron homeostasis and heme synthesis. Ferritin is a ubiquitous protein that plays a critical role in regulating intracellular iron homoeostasis by storing iron inside its multimeric shell. It also plays an important role in detoxifying potentially harmful free ferrous iron to the less soluble ferric iron by virtue of the ferroxidase activity of the H subunit. Although excess iron is stored primarily in cytoplasm, most of the metabolically active iron in cells is processed in mitochondria. Little is yet known of how these organelles regulate iron homeostasis and toxicity. Here we report an unusual intronless gene on chromosome 5q23. 1 that encodes a 242-amino acid precursor of a ferritin H-like protein. This 30-kDa protein is targeted to mitochondria and processed to a 22-kDa subunit that assembles into typical ferritin shells and has ferroxidase activity. Immunohistochemical analysis showed that it accumulates in high amounts in iron-loaded mitochondria of erythroblasts of subjects with impaired heme synthesis. This new ferritin may play an important role in the regulation of mitochondrial iron homeostasis and heme synthesis. H ferritin L ferritin mitochondrial mitochondrial ferritin recombinant polymerase chain reaction untranslated region green fluorescent protein group of overlapping clones polyacrylamide gel electrophoresis The biological advantages of iron in redox reactions and as an oxygen carrier are offset by the interaction of ferrous ions with reactive oxygen species to produce harmful radicals that damage membranes, proteins, and nucleic acids and have been implicated in neurodegenerative diseases and in apoptosis (reviewed in Ref. 1Christen Y. Am. J. Clin. Nutr. 2000; 71: 621S-629SCrossref PubMed Scopus (972) Google Scholar). With the exception of yeast, most organisms rely on ferritin to buffer free cytosolic iron. This highly conserved protein consists of large multimeric shells that accommodate up to 4500 atoms of iron (reviewed in Ref. 2Harrison P. M. Arosio P. Biochim. Biophys. Acta. 1996; 1275: 161-203Crossref PubMed Scopus (2328) Google Scholar). Iron is taken up in the ferrous form and deposited as ferric hydroxides after oxidation by catalytic ferroxidase sites. Release of iron is effected by reducing agents without shell breakdown (3Mazur A. Litt I. Shorr E. J. Biol. Chem. 1950; 187: 473-478Abstract Full Text PDF PubMed Google Scholar, 4Drysdale J. W. Munro H. N. J. Biol. Chem. 1966; 241: 3630-3636Abstract Full Text PDF PubMed Google Scholar). Mammalian ferritins consist of variable amounts of two subunit types, H and L, in a 24-subunit shell (5Arosio P. Adelman T. G. Drysdale J. W. J. Biol. Chem. 1978; 253: 4451-4458Abstract Full Text PDF PubMed Google Scholar). The H chain has the ferroxidase activity that is responsible for the cytoprotective action of ferritin and its central role in cellular processes (2Harrison P. M. Arosio P. Biochim. Biophys. Acta. 1996; 1275: 161-203Crossref PubMed Scopus (2328) Google Scholar). Up-regulation of the H chain reduces free iron levels with a consequent reduction in proliferation rate and increased resistance to oxidative damage (6Cozzi A. Corsi A. Levi S. Santambrogio P. Albertini A. Arosio P. J. Biol. Chem. 2000; 275: 25122-25126Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Down-regulation increases free iron and is associated with increased apoptosis and cell proliferation and is also critical for cell transformation by c-MYC (7Wu K. -J. Polack A. Dalla-Favera R. Science. 1999; 83: 676-679Crossref Scopus (284) Google Scholar, 8Polyak K. Xia Y. Zweier J. L. Kinzler K. W. Vogelstein B. Nature. 1997; 389: 300-305Crossref PubMed Scopus (2270) Google Scholar). Inactivation of H ferritin (HF) 1 in knockout mice is lethal at early stages of embryogenesis (9Ferreira C. Bucchini D. Martin M. E. Levi S. Arosio P. Grandchamp B. Beaumont C. J. Biol. Chem. 2000; 275: 3021-3024Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Mitochondrial iron toxicity should be a particular concern in erythroid cells that have to process >80% of body iron flux, but it is not yet known how this iron is maintained in a nontoxic form. Massive increases in mitochondrial iron occur when heme synthesis is blocked in sideroblastic anemia (10Bottomley S. S. Lee G. R. Lee G. R. Wintrobe's Clinical Hematology. Williams and Wilkins, Baltimore1999: 1071-1108Google Scholar, 11Bessis M. C. Breton-Gorius J. Blood. 1962; 14: 423-428Crossref Google Scholar, 12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar) and yet the mitochondria survive. Much of this iron has the characteristic electron microscopic appearance of ferritin (11Bessis M. C. Breton-Gorius J. Blood. 1962; 14: 423-428Crossref Google Scholar), but this material does not stain with antibodies to cytoplasmic H and L ferritins (12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar), and its form has remained an enigma. Here we describe an unusual gene that encodes a mitochondrial ferritin (MtF) that has ferroxidase activity. The levels of MtF increase dramatically in sideroblastic anemia, suggesting that this new ferritin is likely to be important in the trafficking of iron in mitochondria as well as its detoxification. The following primers derived fromAA469940 were used to amplify fragments from human genomic DNA or human cDNA libraries: T1, TATTTCCTTCACCAGTCCCGG (372) ; T2, TGAAGATGGGGGCCCCGGATG (672) ; T1R, GCAGGAGACAGCTGACTTTGG (824) ; and T3R, TTGGAGGAATAGTATAACAG (875). PCR conditions were 94 °C for 2 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s. Southern analysis of DNA from normal human lymphocytes digested with EcoRI or XbaI was performed as described (13Boyd D. Vecoli C. Belcher D. M. Jain S. K. Drysdale J. W. J. Biol. Chem. 1985; 260: 11755-11761Abstract Full Text PDF PubMed Google Scholar). The blot was probed with the α-32P-labeled 3′-UTR from MtF generated from AA469940 by PCR amplification using primers T2/T3R. A human poly (A) + RNA Northern blot from Origene (Rockville, MD) was hybridized with the 3′-UTR probe (above). After overnight hybridization using the ultrahyb buffer (Ambion) at 66 °C, the blot was washed twice with 0. 5× SSC, 0. 1% SDS at 68 °C and exposed to Kodak Biomax Ms for 8 h. The DNA encoding the entire precursor protein was cloned into pcDNA3 vector (Invitrogen). The DNA fragment encoding the first 67 N-terminal amino acids was subcloned and linked to the N terminus of the green fluorescent protein in the pEGFP-N vector (CLONTECH). Cell culture, transfection, and immunoprecipitation were all carried out as described (14Santambrogio P. Cozzi A. Levi S. Rovida E. Magni F. Albertini A. Arosio P. Protein Expression Purif. 2000; 19: 212-218Crossref PubMed Scopus (99) Google Scholar). GFP expression was visualized in living cells on a fluorescence microscope (Axiovert S100TV, Zeiss) with a 507-nm filter. To localize mitochondria, cells were preincubated with MitoTracker Orange (Molecular Probes) following the manufacturer's instructions and visualized with a 576-nm filter. Cells transfected with pcDNA3MtF were incubated with MitoTracker Green FM (Molecular Probes) for 45 min and then fixed and permeabilized (12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar). The preparations were then overlaid with anti-rΔ9MtF antiserum at 1: 200 dilution, followed by rhodamine-conjugated anti-rabbit IgG. Fluorescence was visualized on an Axiophot microscope (Zeiss) with a 554-nm filter for rhodamine and with a 516-nm filter for MitoTracker Green. Erythroid cells from normal marrow donors and patients with sideroblastic anemia were analyzed for cytoplasmic HF using a monoclonal mouse antibody as described (12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar) and for MtF with polyclonal rabbit antibody anti-rΔ9MtF antiserum. Bound antibody was detected by an immunoalkaline phosphatase method. For negative controls nonimmune mouse or rabbit serum was substituted for the primary antibody. rΔ9MtF was produced inE. coli by subcloning the DNA encoding amino acids 70–242 of the predicted precursor into pET expression vector (Novagen). Cell transformation and protein expression were performed as described (15Corsi B. Perrone F. Bourgeois M. Beaumont C. Panzeri M. C. Cozzi A. Sangregorio R. Santambrogio P. Albertini A. Arosio P. Levi S. Biochem. J. 1998; 330: 315-320Crossref PubMed Scopus (42) Google Scholar). Antibodies to electrophoretically pure rΔ9MtF were raised in rabbits. The pcDNA3MtF was transcribed and translated in the TNT T7/T3-coupled reticulocyte lysate system L5010 obtained from Promega (Madison, WI) in the presence of 35Smethionine, according to the manufacturer's instructions. Ferritin was labeled in vivo by incubating transfected HeLa cells with 35Smethionine for 18 h and was isolated as described (14Santambrogio P. Cozzi A. Levi S. Rovida E. Magni F. Albertini A. Arosio P. Protein Expression Purif. 2000; 19: 212-218Crossref PubMed Scopus (99) Google Scholar). Apoferritins (1 μmfinal concentration) were incubated aerobically with 1 mmferrous ammonium sulfate in 0. 1 m HEPES buffer, pH 7. 0, for 2 h at room temperature. The proteins were separated on 7% native polyacrylamide gels and stained for protein or iron (14Santambrogio P. Cozzi A. Levi S. Rovida E. Magni F. Albertini A. Arosio P. Protein Expression Purif. 2000; 19: 212-218Crossref PubMed Scopus (99) Google Scholar). BLAST searches of the GenBankTM human EST data base with the cDNA for human HF, pHF16 (13Boyd D. Vecoli C. Belcher D. M. Jain S. K. Drysdale J. W. J. Biol. Chem. 1985; 260: 11755-11761Abstract Full Text PDF PubMed Google Scholar), identified clonesAA469940, AI024273, and AI149710 from a testis library with about 80% homology to human HF. The extended and corrected sequences indicated that all represent the same mRNA and have the same predicted C terminus as HF. Although none has a complete coding sequence, that in AI49710 extended above the N terminus of HF. BLAST searches of the high throughput gene sequence data base of GenBankTM with this cDNA contig identified an identical 754-nt sequence in the BAC clone (AC011181), which is now contained in Hs5₂3264 mapping at 5q21. 3. 2 The initiating codon in this genomic sequence was predicted to be 60 residues above that of HF and was located about 30 nt downstream from the initiation site of transcription of the H gene. Two mouse cDNAs (AK0105400 andAK015346) from a testis library have recently been reported3 that are similar to the new human ferritin (see below). There is no corresponding gene yet in public mouse data bases. Amplification of human genomic DNA with primers T1/T1R from the cDNA produced a single 452-base pair fragment with the same sequence as the published genomic sequence. Southern analyses ofEcoRI and XbaI digests of human genomic DNA with a probe from the predicted 3′-UTR gave single hybridizing bands of about 5. 5 and 10. 5 kb, respectively (Fig. 1 A), consistent with the restriction map of the BAC. These results confirm that this is a single copy intronless gene. The genomic sequence has a short poly (A) sequence in the 3′-UTR in the same position as in the cDNA. This is immediately followed by a sequence, AAAGTTTTGCCCA, which has a possible counterpart, TCAGTTTCCCCA, 25 nt above the initiating ATG and close to the transcription initiation site of the H gene. Both features are characteristics of a processed pseudogene (18Vanin E. F. Biochim. Biophys. Acta. 1984; 782: 231-241Crossref PubMed Scopus (81) Google Scholar, 19Dugast I. Papadopoulos P. Zappone E. Theriault K. Handelman G. J. Drysdale J. W. Genomics. 1990; 6: 204-211Crossref PubMed Scopus (25) Google Scholar). However, the mouse cDNA has a similar sequence TCAGTTTCCCCT in the same position above the ATG. This region therefore seems more likely to be part of the human transcript than a flanking genomic repeat. There is no apparent iron-responsive element (IRE) for translational control by iron (20Hentze M. W. Kuhn L. C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8175-8182Crossref PubMed Scopus (1145) Google Scholar) in the 400-nt region above the coding region or in the mouse orthologs. However, there is weak homology with the IRE of the H mRNA in the Mt sequence immediately after the initiating AUG (AUGCUGUCCUGCUUCAGGCUCCUCUCCAGGCACATC versusGGGGUUUCCUGCUUCAACAGUGCUUGGACGGAACCC). 10 of the first 14 bases of the 5′ stem are conserved, but the canonical CAGUG loop (underlined) and the 3′ stem region are largely substituted. This result suggests that much of the 5′-UTR of an H-like sequence, including the IRE, mutated to form a leader sequence in MtF. The lack of an apparent IRE indicates that the expression of MtF will not be translationally controlled by iron. Northern analysis of mRNA from different human tissues using the 3′-UTR probe showed that the polyadenylated mRNA corresponding to MtF was slightly above 1 kb (Fig. 1 B). This is similar in size to H- and l-mRNAs (21Jain S. K. Barrett K. J. Boyd D. Favreau J. Drysdale J. J. Biol. Chem. 1985; 260: Full Text PDF PubMed Google Scholar). However, in to the ubiquitous H- and MtF has a different expression from EST the transcript is in but levels are in iron as the and and in tissues in this overlapping coding MtF is identical to HF and to The amino acids responsible for the ferroxidase activity in HF are conserved in MtF the coding the mouse is identical to human MtF and identical to mouse HF and human HF and also has a conserved ferroxidase The predicted protein leader of residues with that of for human MtF. The N-terminal a leader sequence. A in with the (Molecular predicted on a characteristic of a mitochondrial sequence. The P. J. Biochem. 1996; 241: PubMed Scopus Google Scholar) also indicated mitochondrial and predicted a site at residues the of the H The DNA fragment encoding the first 67 amino acids was therefore to GFP cDNA and the in HeLa of cells transfected with the GFP the same but without the leader sequence showed a cytoplasmic stain the with the leader showed of GFP in intracellular characteristic of mitochondria, and this with that of a mitochondrial stain This was by a the entire coding region of MtF into HeLa cells and the of the protein with and the new This antiserum MtF but not or (Fig. and showed (Fig. that the of the MtF with that of the mitochondrial and ferroxidase activity of MtF. A of anti-rΔ9MtF antibody. and were in on 7% of the gel was stained with and the was probed with antibody and with 1 and 2 and and were with 1 of for which was with bands in and represent J. W. Biochim. Biophys. Acta. PubMed Scopus Google of MtF. analyses of cytosolic and mitochondrial HeLa cells were transfected with and metabolically labeled with 35Smethionine for 18 h. were first of cytosolic ferritins by with antibodies to human L ferritin and then with antibodies to MtF The in results from in vivo of the precursor obtained by in iron into MtF. rΔ9MtF was incubated with ammonium sulfate or with amounts of or were separated on and stained for protein or for ferric iron To the size of transfected HeLa cells were metabolically labeled with 35Smethionine, with and the separated on This was with that obtained by in of mRNA from the same and in the of mitochondria. These showed that the 30-kDa precursor protein was processed in cells to a 22-kDa The processed subunit was slightly than the H subunit and was not by antibodies to human L ferritin that the cytoplasmic H and L ferritins (Fig. B). that the precursor for the new ferritin (MtF) is targeted to mitochondria and is To its the fragment corresponding to residues of the H was inE. The protein in the soluble as an ferritin (see and be with (14Santambrogio P. Cozzi A. Levi S. Rovida E. Magni F. Albertini A. Arosio P. Protein Expression Purif. 2000; 19: 212-218Crossref PubMed Scopus (99) Google Scholar) used for recombinant H and L ferritins and It was in 8 m when with H or L The rΔ9MtF isolated from E. with that it an of ferroxidase activity (2Harrison P. M. Arosio P. Biochim. Biophys. Acta. 1996; 1275: 161-203Crossref PubMed Scopus (2328) Google Scholar). To this activity with HF and rΔ9MtF was and incubated at pH with ferrous iron in the presence or of amounts of and of the shells showed that rΔ9MtF similar amounts of iron to and much more than (Fig. consistent with the of residues and as iron in the ferroxidase of HF (2Harrison P. M. Arosio P. Biochim. Biophys. Acta. 1996; 1275: 161-203Crossref PubMed Scopus (2328) Google Scholar). MtF sequences were identified in PCR with primers T1/T1R from a cDNA library from the cell This with the electron microscopic from erythroid cells (11Bessis M. C. Breton-Gorius J. Blood. 1962; 14: 423-428Crossref Google Scholar), that MtF be in erythroid therefore levels of MtF in marrow from donors and from with sideroblastic anemia from in the acid This anemia and mitochondrial iron in marrow erythroblasts (12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar). in normal erythroblasts showed erythroblasts from patients with showed a B). This is consistent with a mitochondrial and is similar to that by by iron (11Bessis M. C. Breton-Gorius J. Blood. 1962; 14: 423-428Crossref Google Scholar, 12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar). with antibodies showed a cytoplasmic as (12Invernizzi R. Cazzola M. De Fazio P. Rosti V. Ruggeri G. Arosio P. Br. J. Haematol. 1990; 76: 427-432Crossref PubMed Scopus (25) Google Scholar). These results that much of the of iron in mitochondria is in this new describe a new human ferritin (MtF) that is as a targeted to mitochondria, and then processed into a protein with a similar to the ferritins in the cytosolic HF, MtF iron in vivo and in consistent with its conserved ferroxidase The is in the the cytosolic ferritins are in mitochondria are the after in the mitochondria. The of MtF iron in mitochondria were identified as ferritin by electron (11Bessis M. C. Breton-Gorius J. Blood. 1962; 14: 423-428Crossref Google Scholar), but this was of negative and it a for mitochondrial of an ferritin with a leader sequence This is the first of a ferritin that is targeted to an it has with ferritins in organisms as the ferritin in ferritin in and ferritin in (2Harrison P. M. Arosio P. Biochim. Biophys. Acta. 1996; 1275: 161-203Crossref PubMed Scopus (2328) Google Scholar). with the ubiquitous HF and MtF to have a high expression in testis does not to the levels of mitochondria, as have MtF does its with cytosolic iron MtF is also in the and in be in expression in different may be to iron trafficking in erythroid iron is into heme by this reaction is the iron in the mitochondrial is for heme synthesis when the is P. Blood. 1997; PubMed Google Scholar). This iron now seems likely to be in Iron mitochondrial ferritin may in play a role in regulating heme a in the control of synthesis P. Blood. 1997; PubMed Google Scholar). iron into ferritin oxygen and its the trafficking of iron to or to ferritin may be by the redox of the mitochondria. The of high levels of MtF in but not in normal erythroblasts suggests that MtF expression increases with mitochondrial iron The to iron is to increased of to of a protein that the IRE in the ferritin mRNA (20Hentze M. W. Kuhn L. C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8175-8182Crossref PubMed Scopus (1145) Google Scholar). However, there is no apparent IRE in the gene for the mitochondrial and seems The of an IRE in the transcript for MtF but not for HF or has with proteins of iron and acid are as with or without but in it is the form that the IRE Martin A. J. PubMed Scopus Google Scholar, R. S. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar). may also be to the mitochondrial iron in linked to in of the of large amounts of iron in and it has been that for ferritin to mitochondrial iron in cells J. F. S. G. Am. J. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar). It will be to levels of MtF are also increased in this and the two proteins are metabolically The of the MtF gene and its to H and L a The human of H- and but of is known to be Both have with similar (21Jain S. K. Barrett K. J. Boyd D. Favreau J. Drysdale J. J. Biol. Chem. 1985; 260: Full Text PDF PubMed Google Scholar). The by Southern analyses with the H- and are intronless and to be processed I. Papadopoulos P. Zappone E. Theriault K. Handelman G. J. Drysdale J. W. Genomics. 1990; 6: 204-211Crossref PubMed Scopus (25) Google Scholar). has a in cDNA data and all are therefore to be Although the MtF gene has characteristics of a processed it is not an expression be by transfection, we expression of the protein in It be derived from a precursor of mitochondria, but its sequence is more similar to ferritins than to known ferritin This suggests that it is more likely to have from an H-like sequence that a The presence of MtF in indicates that it is and the of and about S. Nature. 1998; PubMed Scopus Google Scholar). analyses of the region for as and but the of these to be the of different ferritins in different cellular and different for cellular iron G. for M. Cazzola and S. for marrow and M. for a of a cDNA
Levi et al. (Mon,) studied this question.