Functional Map of a Placenta-specific Enhancer of the Human Leukemia Inhibitory Factor Receptor Gene

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (−4625/−4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (−4617/−4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (−4549/−4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (−4464/−4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of ∼160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in humanLIFR gene. We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (−4625/−4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (−4617/−4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (−4549/−4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (−4464/−4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of ∼160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in humanLIFR gene. leukemia inhibitory factor receptor interleukin leukemia inhibitory factor placenta-specific element PSE-binding protein trophoblast specific element TSE-binding protein chorionic somatomammotropin enhancer factor 1 cyclic AMP-response element upstream regulatory element transcription enhancer factor fetal bovine serum electrophoretic mobility shift assay polyacrylamide gel electrophoresis nucleotide adenosine deaminase chorionic somatomammotropin B humanCS-B base pair(s) kilobase pair(s). The leukemia inhibitory factor receptor (LIFR),1 a member of the hematopoietic cytokine receptor family, includes receptors for cytokines functioning in immune and hematopoietic systems such as interleukins 2–7 and 9, erythropoietin, granulocyte macrophage colony-stimulating factor, and granulocyte colony-stimulating factor (1Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6934-6938Crossref PubMed Scopus (1887) Google Scholar, 2Miyajima A. Kitamura T. Harada N. Yokota T. Arai K.I. Annu. Rev. Immunol. 1992; 10: 295-331Crossref PubMed Scopus (542) Google Scholar, 3Taga T. Kishimoto T. FASEB J. 1992; 6: 3387-3396Crossref PubMed Scopus (246) Google Scholar). Additional receptors for factors normally functioning outside the immune and hematopoietic systems, such as growth hormone, prolactin, ciliary neurotropic factor, and leptin are also members of this group (1Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6934-6938Crossref PubMed Scopus (1887) Google Scholar, 4Davis S. Aldrich T.H. Valenzuela D.M. Wong V. Furth M.E. Squinto S.P. Yanocopoulos G.D. Science. 1991; 253: 59-63Crossref PubMed Scopus (542) Google Scholar, 5Tartaglia L.A. Dembski M. Weng X. Deng N. Culpepper I. Devos R. Richards G.J. Campfield L.A. Clark F.T. Deeds J. Muir C. Sanker S. Moriarty A. Moore K.J. Smutko J.S. Mays G.G. Woolf E.A. Monroe C.A. Tepper R.I. Cell. 1995; 83: 1271-1363Abstract Full Text PDF Scopus (3264) Google Scholar). The LIFR was found to contain 1097 amino acid residues (a 44-residue signal sequence, a 789-residue extracellular domain, a 26-residue transmembrane domain, and a 238-residue cytoplasmic domain) (6Gearing D.P. Thut C.J. VandenBos T. Gimpel S.D. Delaney P.B. King J. Price V. Cosman D. Beckman M.P. EMBO J. 1991; 10: 2839-2848Crossref PubMed Scopus (523) Google Scholar), and exhibits the characteristic structure of this receptor family, including two folding domains in the extracellular region and a Trp-Ser-X-Trp-Ser motif in the C-terminal (1Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6934-6938Crossref PubMed Scopus (1887) Google Scholar). The LIFR heterodimerizes with gp130 to mediate intracellular signaling of interleukin-6 (IL-6) cytokine family members and is a substrate for mitogen-activated protein kinase (7Pennica D. Shaw K.J. Swanson T.A. Moore M.W. Shelton D.L. Zioncheck K.A. Rosenthal A. Taga T. Paoni N.F. Wood W.I. J. Biol. Chem. 1995; 270: 10915-10922Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar, 8Ip N.Y. Nye S.H. Boulton T.G. Davis S. Taga T. Li Y. Birren S.J. Yasukawa K. Kishimoto T. Anderson D.J. Stahl N. Yancopoulos G.D. Cell. 1992; 69: 1121-1132Abstract Full Text PDF PubMed Scopus (611) Google Scholar, 9Gearing D.P. Comeau M.R. Friend D.J. Gimpel S.D. Thut C.J. McGourty J. Brasher K.K. King J.A. Gillis S. Mosley B. Ziegler S.F. Cosman D. Science. 1992; 255: 1434-1437Crossref PubMed Scopus (799) Google Scholar, 10Davis S. Aldrich T.H. Stahl N. Nan L. Taga T. Kishimoto T. Ip N.Y. Yancopoulos G.D. Science. 1993; 260: 1805-1808Crossref PubMed Scopus (594) Google Scholar, 11Kishimoto T. Taga T. Akira S. Cell. 1994; 76: 253-262Abstract Full Text PDF PubMed Scopus (1253) Google Scholar, 12Schiemann W. Graves L.M. Baumann H. Morella K.K. Gearing D.P. Nielsen M.D. Krebs E.G. Nathanson N.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5361-5375Crossref PubMed Scopus (45) Google Scholar). The phenotype of the LIFR knockout mouse demonstrates that LIFR is essential for animal survival (13Ware C.B. Horowitz M.C. Renshaw B.R. Hunt J.S. Liggitt D. Koblar S.A. Gliniak B.C. Mckenna H.J. Papayannopoulou T. Thomas B. Cheng L. Donovan P.J. Peschon J.J. Bartlett P.F. Willis C.R. Wright B.D. Carpenter M.K. Davison B.L. Gearing D.P. Development. 1995; 121: 1283-1299Crossref PubMed Google Scholar,14Li M. Sendtner M. Smith A. Nature. 1995; 378: 724-727Crossref PubMed Scopus (277) Google Scholar), whereby homozygote animals died within 24 h of birth (13Ware C.B. Horowitz M.C. Renshaw B.R. Hunt J.S. Liggitt D. Koblar S.A. Gliniak B.C. Mckenna H.J. Papayannopoulou T. Thomas B. Cheng L. Donovan P.J. Peschon J.J. Bartlett P.F. Willis C.R. Wright B.D. Carpenter M.K. Davison B.L. Gearing D.P. Development. 1995; 121: 1283-1299Crossref PubMed Google Scholar,14Li M. Sendtner M. Smith A. Nature. 1995; 378: 724-727Crossref PubMed Scopus (277) Google Scholar), and severely affected tissues include placenta, bone, liver, and neurons (13Ware C.B. Horowitz M.C. Renshaw B.R. Hunt J.S. Liggitt D. Koblar S.A. Gliniak B.C. Mckenna H.J. Papayannopoulou T. Thomas B. Cheng L. Donovan P.J. Peschon J.J. Bartlett P.F. Willis C.R. Wright B.D. Carpenter M.K. Davison B.L. Gearing D.P. Development. 1995; 121: 1283-1299Crossref PubMed Google Scholar). Disrupted placental architecture results in poor intrauterine nutrition; and reduced bone volume and increased osteoclast numbers lead to imbalanced bone development and severe perinatal osteopenia, excessive fetal hepatic glycogen storage, and significant neuronal losses (13Ware C.B. Horowitz M.C. Renshaw B.R. Hunt J.S. Liggitt D. Koblar S.A. Gliniak B.C. Mckenna H.J. Papayannopoulou T. Thomas B. Cheng L. Donovan P.J. Peschon J.J. Bartlett P.F. Willis C.R. Wright B.D. Carpenter M.K. Davison B.L. Gearing D.P. Development. 1995; 121: 1283-1299Crossref PubMed Google Scholar, 14Li M. Sendtner M. Smith A. Nature. 1995; 378: 724-727Crossref PubMed Scopus (277) Google Scholar). The ligand for LIFR, leukemia inhibitory factor (LIF), is a member of IL-6 cytokine family currently including IL-6, IL-11, oncostatin M, ciliary neurotropic factor, and cardiotropin (7Pennica D. Shaw K.J. Swanson T.A. Moore M.W. Shelton D.L. Zioncheck K.A. Rosenthal A. Taga T. Paoni N.F. Wood W.I. J. Biol. Chem. 1995; 270: 10915-10922Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar, 11Kishimoto T. Taga T. Akira S. Cell. 1994; 76: 253-262Abstract Full Text PDF PubMed Scopus (1253) Google Scholar, 15Pennica D. Wood W.I. Chien K.R. Cytokine Growth Factor Rev. 1996; 7: 81-91Crossref PubMed Scopus (92) Google Scholar). These cytokines possess pleiotropic and redundant functions (11Kishimoto T. Taga T. Akira S. Cell. 1994; 76: 253-262Abstract Full Text PDF PubMed Scopus (1253) Google Scholar, 16Escary J. Perreau J. Dumenil D. Ezine S. Brlet P. Nature. 1993; 363: 361-364Crossref PubMed Scopus (338) Google Scholar,17Dechiara T.M. Vejsada R. Poueymitou W.T. Acheson A. Suri C. Conover J.C. Friedman B. MaClain J. Pan L. Stahl N. Ip N.Y. Kato A. Yanocopoulos G.D. Cell. 1995; 83: 313-322Abstract Full Text PDF PubMed Scopus (341) Google Scholar) including growth promotion of neuronal (7Pennica D. Shaw K.J. Swanson T.A. Moore M.W. Shelton D.L. Zioncheck K.A. Rosenthal A. Taga T. Paoni N.F. Wood W.I. J. Biol. Chem. 1995; 270: 10915-10922Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar, 8Ip N.Y. Nye S.H. Boulton T.G. Davis S. Taga T. Li Y. Birren S.J. Yasukawa K. Kishimoto T. Anderson D.J. Stahl N. Yancopoulos G.D. Cell. 1992; 69: 1121-1132Abstract Full Text PDF PubMed Scopus (611) Google Scholar, T.M. Proc. Natl. Acad. Sci. U. S. A. 1991; PubMed Scopus Google Scholar, H. P. J. Biol. Chem. 1991; Full Text PDF PubMed Google Scholar). members such as also the of in D.J. S. T.A. Gearing D.P. D. N.M. Nature. PubMed Scopus Google Scholar), and knockout are to in and also J. Perreau J. Dumenil D. Ezine S. Brlet P. Nature. 1993; 363: 361-364Crossref PubMed Scopus (338) Google Scholar, V. C.J. S. PubMed Scopus Google Scholar). is increased in the and with the of the P. Smith J. 1994; PubMed Scopus Google Scholar, K. H. M. H. M. T. K. H. J. T. Biol. 1994; PubMed Scopus Google Scholar). the LIFR is in LIFR is in the chorionic the first and in placenta K. H. M. H. M. S. T. Y. T. J. 1995; 10: PubMed Scopus Google Scholar), that LIFR may a regulatory in trophoblast growth and in the human These the important functions of in placental development and and are by the knockout These also that specific gene of the and of specific lead to of the We recently that the human LIFR gene to in placental and nonplacental tissues S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). a placenta-specific enhancer was upstream to the placenta-specific promoter S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). The promoter activity upstream or of the gene in S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). this transcription factor binding were but mutagenesis to two transcription and with enhancer activity K. H. M. H. M. S. T. Y. T. J. 1995; 10: PubMed Scopus Google Scholar). a detailed characterization of this enhancer with three critical elements to the enhancer Oct-1 binding a element and a novel placenta-specific element A human JEG-3 was in with fetal bovine serum a human a human was in essential with a human was in with a human of was in with A mouse and a were in with was in with and were as reported previously S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). Oct-1 and were by to human and and Oct-1 were from for electrophoretic mobility shift assay are in in in a A of mutants in linker analysis were by or J. T. A Scholar). mutagenesis Oct-1 binding or GATA binding and mutagenesis with TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) binding PSE were also The are mutants were by were was as JEG-3 were were in linker with were in the and h were for of and nuclear extracts from and were as previously reported S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). The protein of the nuclear extracts were by assay of nuclear extract from different were in was with of nuclear 1 of in of Oct-1 and the binding was 1 the novel placental the binding was were to the of was of and for 1 h or were polyacrylamide gel electrophoresis residues and their bases in this region were also as to the of Gs to the binding and are in I. of the region of were as in and as was to the binding boundary of placenta-specific element binding The was by a in was with for and were with of JEG-3 nuclear extract in the binding as in for of were and to for 1 was to the the placenta-specific element in was as were A was to J. T. A Scholar). UV oligo was with of JEG-3 nuclear extract and as for The gel was with a UV and the gel in 1 for and with of The protein was in J. T. A Scholar) and a with protein The gel was and that the human LIFR gene enhancer was in JEG-3 and and in from nonplacental tissues such as liver, bone and S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). that not but placental and for of including growth hormone, chorionic somatomammotropin B or placental PubMed Scopus Google Scholar, Y. Smith PubMed Scopus Google Scholar, S.D. M.E. Rev. 1990; PubMed Scopus Google Scholar). We and growth and to the of the gene enhancer and two LIFR The results in the placenta-specific LIFR promoter in the LIFR promoter S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) is in the in placental is not in the three base transcription factor binding within this enhancer region S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), including cyclic AMP-response element and three binding and two binding were S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). and in enhancer mutagenesis to critical bases within the or consensus regions within this but to of enhancer activity S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). that the and binding are to enhancer activity in LIFR gene. this placenta-specific enhancer from a of a linker analysis with the of of the mutants were and their were These mutants with enhancer were JEG-3 and the is as in Four mutants of enhancer 9, and base from to to to and to and their enhancer activities are reduced to 45, 30, 10, and 10%, respectively. and adjacent base results that three elements in this A B and C are critical to the enhancer a base was for three and the is as in transcription factors of binding regions were including Oct-1 and transcription factor binding for regions in the LIFR placenta-specific regions and C are in with factors the consensus binding for transcription factors are A was found to to a known transcription factor Oct-1 consensus binding B. L. W. Nature. PubMed Scopus Google Scholar), a base to a binding in this Oct-1 in bind to region and Oct-1 assay were oligo a region A was as a to assay oligo a specific binding as by including as a Specific binding of the was also a known Oct-1 oligo was as this binding was supershifted with the of Oct-1 These results that the transcription factor Oct-1 to element A. of Oct-1 JEG-3 increased enhancer to that is for enhancer activity and to two elements for enhancer of not enhancer activity P. J.A. I. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). B to the GATA family member consensus binding as in a S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) and a linker GATA family members are in the placenta-specific of and adenosine deaminase D.J. Cell. Biol. 1994; PubMed Google Scholar, D. M.R. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), was important to region B is with showed that the specific binding by oligo region B and JEG-3 nuclear extract was competed by a known GATA oligo specific by the known GATA oligo and JEG-3 nuclear extract could be competed by the oligo that region B is a GATA oligo to the that this element but the element bind to to the GATA oligo was by to and as in and Specific the known GATA oligo with JEG-3 nuclear extract were supershifted by to or indicating the of the known GATA oligo to bind to or are known to be in JEG-3 D.J. Cell. Biol. 1994; PubMed Google Scholar, King M.C. S.H. Cell. Biol. 1993; PubMed Google Scholar). specific the oligo and JEG-3 nuclear extract could not be supershifted by to or indicating that specific a protein other or region B. that of two bases within the GATA consensus binding in binding with GATA family two bases are also critical within this mutagenesis to in region B to and in showed that this enhancer activity to a as the 9, that this is a critical region B and binding The of this protein was by nuclear extracts from of different this protein is also in nuclear extracts that is not to be in placental JEG-3 other nonplacental critical region by linker analysis from to a enhancer activity region A or B. base also to transcription for this the results is that binding for region A and B are in and placenta of the enhancer be to oligo region C as a for with nuclear extracts from including and a specific binding was in placental JEG-3 this specific could not be competed by a previously placenta-specific trophoblast specific element oligo D.J. J. M. 1991; PubMed Scopus Google Scholar) These results that region C a novel and binding with is a major factor to the and activity of gene was to the boundary of the binding protein the enhancer in specific were to and to of the base of oligo a of Gs in and found to be in specific and for specific two bases a of and base for in the assay and and the specific binding 1 that and in and critical as in the region of PSE for specific binding to this a of and as to their to the specific binding. A assay to this region is in C The oligo from to competed specific a oligo from to not the element was as the functioning element for region C. previously reported binding TSE binding protein and chorionic somatomammotropin enhancer factor 1 are to important in placenta-specific and to be in placental to this PSE bind protein is indeed different from or and and binding are two mutants with the PSE region in the enhancer to the TSE and binding sites, respectively. placental JEG-3 and nonplacental were and the results are as in A. of PSE with TSE or binding resulted in and of promoter as with the three showed no promoter in the of in nonplacental We also UV cross-linking to the molecular mass of this in the from showed no signal in UV the placenta-specific binding from a molecular mass of in UV and molecular of and kDa, D. M. 1993; 7: PubMed Scopus Google Scholar, PubMed Scopus Google Scholar), is that PSEB is a novel protein or CSEF-1. two may the promoter as other but placenta-specific or upstream elements as for adenosine deaminase and leptin Y. Smith PubMed Scopus Google Scholar, S.D. M.E. Rev. 1990; PubMed Scopus Google Scholar, D.J. Cell. Biol. 1994; PubMed Google Scholar, E.A. J. Biol. Chem. Full Text PDF PubMed Google S. M. J. Biol. Chem. Full Text Full Text PDF Scopus Google may placenta-specific and as previously for the gene D. M.R. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) and as now show for the LIFR gene. A enhancer of the gene promoter is for placental or S.D. M.E. Rev. 1990; PubMed Scopus Google Scholar). enhancer was of two and upstream regulatory element Cell. Biol. 7: PubMed Scopus Google Scholar, P.J. J.F. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar), could be three sites, and T.A. J. Biol. Chem. 1994; Full Text PDF PubMed Google Scholar). was also found that the element to and element that may bind two and T.A. J. Biol. Chem. 1994; Full Text PDF PubMed Google Scholar, K. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). The promoter for is in J. 1990; PubMed Scopus Google Scholar), enhancer of the placenta-specific J. Biol. Chem. 1990; Full Text PDF PubMed Google Scholar). this four binding and and to be placenta-specific P. C. B. A. A. J.A. Cell. Biol. 1994; PubMed Google Scholar) and may bind with the transcription enhancer P. C. B. A. A. J.A. Cell. Biol. 1994; PubMed Google Scholar). enhancer was to be by binding of and a placenta-specific factor, to binding within the region PubMed Scopus Google Scholar). The gene promoter is in but a enhancer upstream of the placenta-specific this two motifs to TSE were found in a placenta-specific D. M.R. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). GATA two and motif were to be in enhancer activity D. M.R. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). the leptin the promoter is for and placental upstream enhancer functions in JEG-3 and but not in or S. M. J. Biol. Chem. Full Text Full Text PDF Scopus Google Scholar). elements were to in within the enhancer by including two motifs and to be placenta-specific S. M. J. Biol. Chem. Full Text Full Text PDF Scopus Google Scholar). the group of placenta-specific gene is placenta-specific for placental protein is in upstream to placenta-specific increased in and two important elements in this region a TSE consensus and are to bind to K. Harada N. S. Y. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). regulatory elements in placenta-specific transcription include GATA binding and placenta-specific elements such as TSE binding and the binding include binding and and are transcription and are two in the LIFR placenta-specific transcription characteristic of the group as LIFR gene enhancer a different of elements and binding for placenta-specific Oct-1 binding a and a novel PSE were found to be Nevertheless, elements to other placenta-specific and is that not for the specific binding GATA the other the binding protein for element was competed by the known GATA oligo, this novel GATA family member also the to bind with previously GATA motifs in other placenta-specific the Oct-1 binding that to binding in the enhancer B. L. W. Nature. PubMed Scopus Google Scholar) and also element with of the binding in the enhancer B. L. W. Nature. PubMed Scopus Google Scholar). Oct-1 the specific binding was that the binding be from the Oct-1 binding with transcription factor such as I. R. A. P. Cell. Full Text PDF PubMed Scopus Google Scholar) or P. J.A. I. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). The core of the novel placenta-specific element is not to binding or and this be a for of placenta-specific gene in placenta-specific transcription of is that no element to be in their placenta-specific the that placenta is the major that and also the of the human LIFR placenta-specific enhancer and this also to be the acid and element were in the base of JEG-3 showed significant LIFR promoter activity not the analysis of JEG-3 with LIFR not These to be in to the that human LIFR the first and A is that JEG-3 as a of human chorionic hormone, may not a placental is to TSE was found to be in placenta-specific such as and was that TSE be a in placenta that a of placenta-specific gene D. M. 1993; 7: PubMed Scopus Google Scholar). LIFR is not the no TSE motif was gene transcription also not to be TSE These that the placenta may not possess a for placenta-specific gene TSE is in placenta-specific of knockout placenta-specific and transcription factors in their knockout not placental are and and Wood R.I. S.A. 1995; PubMed Scopus Google Scholar). a leptin gene not D.L. PubMed Scopus Google Scholar), but also are M.E. R. 1996; PubMed Scopus Google Scholar), but no placental was in their placenta fetal development M. M.R. R. J. K. S. C.A. A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar), to of from perinatal M. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). knockout severe in the and fetal M.E. A. M.W. 1995; PubMed Scopus Google Scholar), and knockout are in hematopoietic and S.H. PubMed Google Scholar), and knockout not show placental the of other GATA family members functioning in the show in the but not in other including the placenta P. J.A. P. I. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). knockout of no placental are in to the LIFR knockout severe placental (13Ware C.B. Horowitz M.C. Renshaw B.R. Hunt J.S. Liggitt D. Koblar S.A. Gliniak B.C. Mckenna H.J. Papayannopoulou T. Thomas B. Cheng L. Donovan P.J. Peschon J.J. Bartlett P.F. Willis C.R. Wright B.D. Carpenter M.K. Davison B.L. Gearing D.P. Development. 1995; 121: 1283-1299Crossref PubMed Google Scholar). We previously that in placenta placenta-specific transcription are and with the LIFR gene placenta-specific enhancer and to transcription of LIFR to the of this novel PSE in LIFR gene enhancer this and the of the PSEB the specific placental of the