Werner Syndrome Protein

In addition to its DNA helicase activity, Werner syndrome protein (WRN) also possesses an exonuclease activity (Shen, J.-C. , Gray, M. D., Kamath-Loeb, A. S., Fry, M., Oshima, J., and Loeb, L. A. (1998) J. Biol. Chem. 273, 34139–34144). Here we describe the properties of nearly homogeneous WRN exonuclease. WRN exonuclease hydrolyzes a recessed strand in a partial DNA duplex but does not significantly digest single-stranded DNA, blunt-ended duplex, or a protruding strand of a partial duplex. Although DNA is hydrolyzed in the absence of nucleoside triphosphates, nuclease activity is markedly stimulated by ATP, dATP, or CTP. WRN exonuclease digests DNA with a 3′ → 5′ directionality to generate 5′-dNMP products, and DNA strands terminating with either a 3′-OH or 3′-PO4 group are hydrolyzed to similar extents. A recessed DNA strand with a single 3′-terminal mismatch is hydrolyzed more efficiently by WRN than one with a complementary nucleotide, but the enzyme fails to hydrolyze a DNA strand terminating with two mismatched bases. WRN exonuclease is distinguished from known mammalian DNA nucleases by its covalent association with a DNA helicase, preference for a recessed DNA strand, stimulation by ATP, ability to equally digest DNA with 3′-OH or 3′-PO4 termini, and its preferential digestion of DNA with a single 3′-terminal mismatch. In addition to its DNA helicase activity, Werner syndrome protein (WRN) also possesses an exonuclease activity (Shen, J.-C. , Gray, M. D., Kamath-Loeb, A. S., Fry, M., Oshima, J., and Loeb, L. A. (1998) J. Biol. Chem. 273, 34139–34144). Here we describe the properties of nearly homogeneous WRN exonuclease. WRN exonuclease hydrolyzes a recessed strand in a partial DNA duplex but does not significantly digest single-stranded DNA, blunt-ended duplex, or a protruding strand of a partial duplex. Although DNA is hydrolyzed in the absence of nucleoside triphosphates, nuclease activity is markedly stimulated by ATP, dATP, or CTP. WRN exonuclease digests DNA with a 3′ → 5′ directionality to generate 5′-dNMP products, and DNA strands terminating with either a 3′-OH or 3′-PO4 group are hydrolyzed to similar extents. A recessed DNA strand with a single 3′-terminal mismatch is hydrolyzed more efficiently by WRN than one with a complementary nucleotide, but the enzyme fails to hydrolyze a DNA strand terminating with two mismatched bases. WRN exonuclease is distinguished from known mammalian DNA nucleases by its covalent association with a DNA helicase, preference for a recessed DNA strand, stimulation by ATP, ability to equally digest DNA with 3′-OH or 3′-PO4 termini, and its preferential digestion of DNA with a single 3′-terminal mismatch. Werner syndrome dithiothreitol adenosine 5′-O-(thiotriphosphate) 4-nitroquinoline 1-oxide. Werner Syndrome (WS)1 is a recessive inherited disease characterized by genetic instability and aging in early adulthood (1Epstein C.J. Martin G.M. Schultz A.L. Motulsky A.G. Medicine. 1966; 45: 177-221Crossref PubMed Scopus (745) Google Scholar, 2Goto M. Miller R.W. Ishikawa Y. Sugano H. Cancer Epidemiol. Biomark. Prev. 1996; 5: 239-246PubMed Google Scholar). The gene defective in WS,WRN, encodes a 3′ → 5′ RecQ-like DNA helicase that unwinds DNA in an ATP-dependent manner (3Yu C.-E. Oshima J. Fu Y.-H. Wijsman E.M. Hisama F. Nakura J. Miki T. Ouais S. Martin G.M. Mulligan J. Schellenberg G.D. Science. 1996; 272: 258-262Crossref PubMed Scopus (1489) Google Scholar, 4Suzuki N. Shimamoto A. Imamura O. Kuromitsu J. Kitao S. Goto M. Furuichi Y. Nucleic Acids Res. 1997; 25: 2973-2978Crossref PubMed Scopus (195) Google Scholar, 5Gray M.D. Shen J.-C. Kamath-Loeb A.S. Blank A. Sopher B.L. Martin G.M. Oshima J. Loeb L.A. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (519) Google Scholar). Mutations inWRN are invariably found in patients exhibiting the clinical symptoms of WS (6Oshima J. Yu C.E. Piussan C. Klein G. Jabkowski J. Balci S. Miki T. Nakura J. Ogihara T. Ells J. Smith M. Melaragno M.I. Fraccaro M. Scappaticci S. Matthews J. Ouais S. Jarzebowicz A. Schellenberg G.D. Martin G.M. Hum. Mol. Genet. 1996; 12: 1909-1913Crossref Scopus (92) Google Scholar, 7Yu C.E. Oshima J. Wijsman E.M. Nakura J. Miki T. Piussan C. Matthews S. Fu Y.H. Mulligan J. Martin G.M. Schellenberg G.D. Am. J. Hum. Genet. 1997; 60: 330-341PubMed Google Scholar). These include atherosclerosis, osteoporosis, diabetes mellitus, and bilateral cataracts, as well as an unusually high incidence of tumors of non-epithelial cell origin. At the cellular level, WS cells are characterized by chromosomal translocations, large DNA deletions, elevated rates of homologous recombination, defective maintenance of telomeres, and a prolonged S-phase of DNA synthesis (8Salk D. Au K. Hoehn H. Martin G.M. Cytogenet. Cell Genet. 1981; 30: 92-107Crossref PubMed Scopus (212) Google Scholar, 9Gebhardt E. Bauer R. Raub U. Schinzel M. Ruprecht K.W. Jonas J.B. Hum. Genet. 1988; 80: 135-139Crossref PubMed Scopus (138) Google Scholar, 10Fukuchi K. Martin G.M. Monnat Jr., R.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5893-5897Crossref PubMed Scopus (390) Google Scholar, 11Cheng R.Z. Murano S. Kurz B. Shmookler-Reis R.J. Mutat. Res. 1990; 237: 259-269Crossref PubMed Scopus (59) Google Scholar, 12Schulz V.P. Zakian V.A. Ogburn C.E. McKay J. Jarzebowicz A.A. Edland S.D. Martin G.M. Hum. Genet. 1996; 97: 750-754Crossref PubMed Scopus (209) Google Scholar, 13Tahara H. Tokutake Y. Maeda S. Kataoka H. Watanabe T. Satoh M. Matsumoto T. Sugawara M. Ide T. Goto M. Furuichi Y. Sugimoto M. Oncogene. 1997; 16: 1911-1920Crossref Scopus (124) Google Scholar, 14Poot M. Hoehn H. Runger T.M. Martin G.M. Exp. Cell. Res. 1992; 202: 267-273Crossref PubMed Scopus (187) Google Scholar, 15Fujiwara Y. Higashikawa T. Tatsumi M. J. Cell. Physiol. 1977; 92: 365-374Crossref PubMed Scopus (130) Google Scholar). In the preceding paper (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar), we reported the identification of a novel exonuclease activity in WRN. We used molecular genetic, biochemical, and immunochemical methods to establish that the exonuclease, like the DNA helicase, is integral to WRN. Although the two activities are expressed in the same polypeptide in the wild-type protein, they can be uncoupled from each other by introducing mutations separately in each of the two domains. In patients, mutations in WRN are not necessarily located in the helicase domain. They are found throughout the gene and invariably introduce stop codons or deletions (6Oshima J. Yu C.E. Piussan C. Klein G. Jabkowski J. Balci S. Miki T. Nakura J. Ogihara T. Ells J. Smith M. Melaragno M.I. Fraccaro M. Scappaticci S. Matthews J. Ouais S. Jarzebowicz A. Schellenberg G.D. Martin G.M. Hum. Mol. Genet. 1996; 12: 1909-1913Crossref Scopus (92) Google Scholar, 7Yu C.E. Oshima J. Wijsman E.M. Nakura J. Miki T. Piussan C. Matthews S. Fu Y.H. Mulligan J. Martin G.M. Schellenberg G.D. Am. J. Hum. Genet. 1997; 60: 330-341PubMed Google Scholar). It has been argued that many mutations obliterate the nuclear localization signal and that lack of localization may be important in the pathogenesis of WS (17Matsumoto T. Shimamoto A. Goto M. Furuichi Y. Nat. Genet. 1997; 16: 335-336Crossref PubMed Scopus (160) Google Scholar, 18Matsumoto T. Imamura O. Goto M. Furuichi Y. Int. J. Mol. Med. 1998; 1: 71-76PubMed Google Scholar). This lack of nuclear localization would result in deficits of both helicase and exonuclease activities. To gain a better understanding of the functions of the WRN exonuclease, we have studied its properties in some detail. We report the following characteristic features of the WRN exonuclease: 1) it hydrolyzes DNA in a 3′ → 5′ direction in an ATP-stimulated reaction to generate 5′-deoxynucleoside monophosphate products, 2) its preferred substrate is a recessed strand of a partial DNA duplex that terminates with either a 3′-OH or 3′-PO4 group, and 3) it efficiently digests DNA with a single 3′-terminal mismatched nucleotide but does not degrade DNA with two 3′-terminal mismatches, nor does it hydrolyze single-stranded DNA. γ-32PATP and α-32PdCTP were products of NEN Life Science Products. Bacteriophage T4 polynucleotide kinase and Klenow fragment of E. coli DNA polymerase I were supplied by New England Biolabs. Deoxyribonucleoside triphosphates (dNTPs) were purchased from Perkin-Elmer. Ribonucleoside triphosphates (NTPs) were supplied by Amersham Pharmacia Biotech. High performance liquid chromatography purified oligodeoxynucleotides listed in Table I were provided by Operon Technologies. Dithiothreitol (DTT), Nonidet P-40, AMP, cyclic AMP, and cyclic GMP were purchased from Sigma. DEAE (DE81) and Whatman No. 3MM filter paper were provided by Whatman. Polyethyleneimine-Cellulose F thin layer chromatography plates were purchased from VWR.Table IDNA oligomers used in this studyOligomerNucleotide sequence46-mer5′-d(GCGCGGAAGCTTGGCTGCAGAATATTGCTAGCGGGAAATCGGCGCG)-3′20-mer5′-d(CGCTAGCAATATTCTGCAGC)-3′20-mer 3′-P5′-d(CGCTAGCAATATTCTGCAGC)-3′-PO4Anti-20-mer5′-d(GCTGCAGAATATTGCTAGCG)-3′23-mer5′-d(CGCGCCGAATTCCCGCTAGCAAT)-3′24-mer5′-d(CGCGCCGAATTCCCGCTAGCAATG)-3′25-mer5′-d(CGCGCCGAATTCCCGCTAGCAATGC)-3′ Open table in a new tab Single-stranded DNA oligomers were labeled by 32P at their 5′-end and annealed to complementary unlabeled DNA oligomers as described in the preceding paper (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). To label the 20-mer DNA at its 3′-end, it was annealed to the 46-mer oligonucleotide (Table I), and its 3′-terminus was extended by a single complementary 32PdCMP residue in a reaction catalyzed by the Klenow fragment of E. coli DNA polymerase I. The reaction mixture contained in a final volume of 10 μl, 25 mm Tris-HCl buffer, pH 8.0, 10 mmMgCl2, 40 mm KCl, 5 μm dCTP, 5 μCi of α-32PdCTP, 10 μg of bovine serum albumin, 10 pmol of 20-mer/46-mer hybrid DNA, and 0.5 unit of Klenow DNA polymerase. Following incubation for 10 min at 37 °C, incorporation of 32PdCMP was terminated by the addition of denaturing loading buffer; the samples were boiled, and DNA was electrophoresed through a 14% polyacrylamide-urea gel (19Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The resolved32P-labeled 3′-21-mer DNA band was excised, extracted from the gel, and precipitated by ethanol (20Weisman-Shomer P. Fry M. J. Biol. Chem. 1993; 268: 3306-3312Abstract Full Text PDF PubMed Google Scholar); the isolated DNA was reannealed to the unlabeled complementary 46-mer oligonucleotide as described above. WRN protein purified to near homogeneity by successive steps of ion exchange and affinity chromatography steps (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar) was used throughout this study. In a standard assay for exonuclease activity, WRN was incubated with a32P-labeled 5′-20-mer/46-mer partial duplex substrate (Table I) under the previously described DNA helicase/exonuclease reaction conditions (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). Substrate specificity of the exonuclease was measured using the standard DNA substrate as well as the following oligomers: single-stranded 32P-labeled 5′-20-mer; blunt-ended 32P-labeled 5′-20-mer/unlabeled anti 20-mer duplex, and a 20-mer/32P-labeled 5′-46-mer partial duplex. To measure the relative capacity of WRN exonuclease to digest matched and terminally mismatched DNA substrates, unlabeled 46-mer DNA was annealed to either a fully matched 32P-labeled 5′-23-mer, a 3′-singly mismatched 24-mer, or a 3′-doubly mismatched 25-mer (TableI). Products of exonucleolytic digestion of DNA were resolved by electrophoresis through a 14% polyacrylamide-urea gel and were visualized by autoradiography or quantitated by PhosphorImager analysis. To determine of DNA by WRN nuclease or 5′-dNMP 32P-labeled 3′-21-mer in a partial duplex with unlabeled 46-mer was by and the labeled nucleoside monophosphate was resolved and by thin layer The DNA substrate was incubated with either an of WRN protein for of or with of WRN for 10 min at 37 DNA was terminated by the reaction and each of and nucleoside were were a F thin layer and and were resolved by chromatography using a mixture of A of Whatman No. 3MM filter paper was to the of the to the of and the and of and were visualized by and 32P-labeled was located by To determine the DNA substrate of WRN we the ability of WRN to hydrolyze single-stranded DNA, blunt-ended DNA duplex, and a partial duplex in one of the DNA strands has 3′ and 5′ protruding relative to the A of each of the 32P-labeled DNA was with of the same unlabeled DNA and incubated with WRN as of the exonucleolytic activity of WRN that a recessed strand in a partial DNA duplex was significantly hydrolyzed by the enzyme of the of DNA as a of substrate of WRN nuclease activity was with the other DNA they were used at This that the lack of exonucleolytic activity with is not of WRN helicase was to the partial duplex of the strand that was not This at with the DNA a affinity of WRN for DNA is not for the lack of exonuclease WRN exonuclease is from the large of the known nucleases by its preference for recessed DNA in a partial duplex the helicase activity of WRN is the of we the activity of WRN exonuclease is by nucleoside A partial duplex of 32P-labeled 5′-20-mer/unlabeled 46-mer was incubated with or of WRN protein in the absence or of nucleoside or as In with reported J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; PubMed Scopus Google Scholar), we found that the activity of WRN helicase was and that dATP, or for to a not the other WRN DNA helicase activity was in the of AMP, or not of DNA by WRN exonuclease was in the absence of this activity be by a of the DNA digestion products by WRN nuclease in the of nucleoside and the of the of DNA and of WRN and of the DNA substrate in the absence of nucleoside triphosphates were in DNA by the of WRN and stimulated of the 20-mer DNA substrate by to to the of the WRN exonuclease, it not the of digestion (Table the WRN DNA helicase J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; PubMed Scopus Google Scholar), WRN exonuclease was also stimulated by and or not the activity of WRN helicase not they the nuclease activity using of WRN protein (Table WRN DNA helicase that its nuclease activity was in the absence of nucleoside at protein to DNA of DNA was significantly stimulated by nucleoside triphosphates in the of nucleoside DNA by WRN stimulation of DNA of 32P-labeled that was by and of WRN nuclease in the absence of nucleoside was and protein or was incubated with the 32P-labeled 5′-20-mer/unlabeled 46-mer partial DNA duplex in the absence or of mm of each of the nucleoside at 37 for 10 Products of digestion were resolved by electrophoresis through a 14% polyacrylamide-urea gel as in of hydrolyzed DNA were quantitated by PhosphorImager The of 32P-labeled that was by and of WRN nuclease in the absence of nucleoside was and Open table in a new tab WRN protein or was incubated with the 32P-labeled 5′-20-mer/unlabeled 46-mer partial DNA duplex in the absence or of mm of each of the nucleoside at 37 for 10 Products of digestion were resolved by electrophoresis through a 14% polyacrylamide-urea gel as in of hydrolyzed DNA were quantitated by PhosphorImager analysis. To determine the of DNA digestion by the WRN of the protein were incubated with a partial duplex of unlabeled 46-mer DNA annealed to either a32P-labeled or a 32P-labeled 3′-21-mer for 10 min at 37 In a a of WRN protein was incubated with each DNA substrate for of both were equally by WRN helicase not was a in the of products that with either or DNA. of WRN with the DNA substrate in the of single nucleotide to generate a of DNA labeled at the 5′-end and products were the DNA was incubated with the that to the of enzyme or of incubation was a single 32P-labeled residue from the 3′-terminus The of but not DNA that WRN does not digest DNA and that it as a 3′ → 5′ exonuclease under To determine WRN nuclease DNA to generate or 5′-dNMP a DNA substrate 32P-labeled at its 3′-terminal residue was hydrolyzed by of WRN or with a of the enzyme for of of the reaction were through a thin layer with and in the of 32PdCMP was to the of WRN and to the of DNA The absence of products other than is in with the 3′ → 5′ directionality of DNA digestion and and with the of WRN to DNA of WRN nuclease with the but not with the that WRN to generate 5′-dNMP To the relative capacity of WRN nuclease to degrade DNA that with either a 3′-OH or a 3′-PO4 group, the enzyme was incubated with of a hybrid of the 46-mer DNA and a32P-labeled that with either a 3′-OH or 3′-PO4 (Table DNA were by WRN helicase not the 3′-OH and were to similar by WRN exonuclease. PhosphorImager and of the of DNA as a of substrate similar for both The were and pmol of DNA and were and for the 3′-OH 20-mer and 3′-PO4 The WRN 3′ → 5′ exonuclease is distinguished by its ability to digest DNA that has a 3′-PO4 equally or in a preference DNA that a 3′-OH The of the WRN exonuclease is homologous to the 3′ → 5′ of E. polymerase I Nucleic Acids Res. 1997; 25: PubMed Scopus Google Scholar, P. Sci. 1997; Full Text PDF PubMed Scopus (138) Google Scholar). We the 3′ → 5′ WRN exonuclease is of from the of DNA. WRN nuclease was incubated with DNA that were of the unlabeled 46-mer annealed to either a fully complementary a with a single 3′-terminal or a 25-mer with two at the 3′-terminus Table of the single 3′-terminal mismatched nucleotide was more than that of a complementary 3′-terminal were to digestion by WRN A similar preference for DNA a single mismatch was not the reaction were incubated with a enzyme that the exonuclease (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). These at the and of the DNA WRN exonuclease hydrolyzes DNA with a single 3′-terminal mismatched In the preceding paper (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar), we that WRN possesses an integral exonuclease The this a homogeneous of wild-type we have novel properties of the exonuclease that it from known 3′ → 5′ in molecular that hydrolyze DNA in an manner A. DNA 2nd Ed. H. and New Scholar). The of digest than DNA. The properties of the 3′ → 5′ WRN exonuclease are markedly the WRN exonuclease is a large molecular (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). from the 3′ → 5′ that are to DNA and A. DNA 2nd Ed. H. and New Scholar), other of have been reported to nuclease the WRN exonuclease a recessed strand in a partial DNA duplex to generate 5′-deoxynucleoside and other 3′ → 5′ it fails to hydrolyze single-stranded DNA, a blunt-ended DNA duplex or a DNA strand of a partial duplex used a of DNA The that the helicase activity of WRN unwinds the duplex with the protruding DNA strand that the lack of is not to a affinity of WRN for DNA the absence of of single-stranded DNA 1) the of a in the DNA terminating with either a 3′-OH or 3′-PO4 group are equally by the as by the similar and for both DNA 3′ recessed with either a matched or with a single mismatch are with two the exonuclease activity of WRN is markedly stimulated by or at enzyme dCTP, and also the activity and Table The for the is that and of in the helicase a of the nuclease in its exonucleolytic characteristic of the WRN exonuclease is its as by the of products and this is not a result of in the of the oligonucleotide was using a 20-mer with a a similar of products, from in is not The is also by the high enzyme and the extended incubation that are to the of the single nucleoside monophosphate and the of the WRN the be in by the of WRN with It is that the of the WRN exonuclease is the of of DNA. helicase and exonuclease activities may the of the WRN exonuclease. of the properties of the WRN exonuclease are similar to of E. coli exonuclease nucleases hydrolyze recessed DNA with a 3′ → 5′ D. A. J. Biol. Chem. Full Text PDF PubMed Google Scholar). both are of a DNA terminating with a 3′-PO4 group 5 and A. J. Biol. Chem. Full Text PDF PubMed Google Scholar). E. coli is an for the of in DNA B. J. Biol. Chem. Full Text PDF PubMed Google Scholar), the WRN nuclease does not activity with of the used in this The exonuclease activity of E. coli has been to a in the of DNA by This is the that an to B. J. S. J. PubMed Google Scholar). The of WS cells to C.E. Oshima J. M. R. Martin G.M. Hum. Genet. 1997; PubMed Scopus Google Scholar), an also known to generate may that the exonuclease activity of WRN is for of DNA by with DNA and also the of that DNA and generate strand that result in recessed DNA strands with either a 3′-OH or 3′-PO4 like WRN exonuclease may be in the of DNA. The identification and of the novel WRN exonuclease an the helicase and exonuclease activities they the of DNA and the At two can be to In the WRN the 3′ of a DNA and of the complementary annealed it the of annealed DNA, it is to At this WRN a that the nuclease in to the 3′ of the strand that is the exonucleolytic than of the terminally The that the DNA, than an the DNA strand that is by WRN were to WRN DNA from one and hydrolyze it from the It is more that the two activities of WRN are at steps of the same In paper (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar) we that DNA does not the exonuclease and In this and other J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; PubMed Scopus Google Scholar), we have that DNA is the of exonucleolytic digestion is These that the two activities of WRN not the known DNA of WS cells M. Hoehn H. Runger T.M. Martin G.M. Exp. Cell. Res. 1992; 202: 267-273Crossref PubMed Scopus (187) Google Y. Higashikawa T. Tatsumi M. J. Cell. Physiol. 1977; 92: 365-374Crossref PubMed Scopus (130) Google Scholar), WRN may in DNA In this the WRN exonuclease may a 3′-terminal nucleotide that is by a DNA polymerase an 3′ → 5′ The WRN helicase the other in strand DNA synthesis by and to digest the strand and DNA to the DNA. the of WS cells to C.E. Oshima J. M. R. Martin G.M. Hum. Genet. 1997; PubMed Scopus Google Scholar) that WRN may be to DNA by other chromosomal can to and other of genetic WS cells are characterized by this of it is to that one of WRN may be the of DNA strand This the of a 3′ → 5′ exonuclease to from the 3′-terminus a and a helicase to DNA synthesis Cell Biol. 1992; PubMed Scopus Google Scholar). in that partial steps of DNA and L.A. J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google Scholar, P. T. Cell. 1988; Full Text PDF PubMed Scopus Google Scholar, 1998; 12: PubMed Scopus Google Scholar) one to the ability of WRN to as a helicase and an exonuclease in