The cytoplasmic domain of erythrocyte membrane band 3 (cdb3) serves as a center of membrane organization, interacting with such proteins as ankyrin, protein 4.1, protein 4.2, hemoglobin, several glycolytic enzymes, a tyrosine phosphatase, and a tyrosine kinase, p72syk. The crystallographic structure of the cdb3 dimer has revealed that residues 175–185 assume a β-hairpin loop similar to a putative ankyrin-binding motif at the cytoplasmic surface of the Na+/K+-ATPase. To test whether this hairpin loop constitutes an ankyrin-binding site on cdb3, we have deleted amino acids 175–185 and substituted the 11-residue loop with a Gly-Gly dipeptide that bridges the deletion without introducing strain into the structure. Although the deletion mutant undergoes the same native conformational changes exhibited by wild type cdb3 and binds other peripheral proteins normally, the mutant exhibits no affinity for ankyrin. This suggests that the exposed β-hairpin turn indeed constitutes a major ankyrin-binding site on cdb3. Other biochemical studies suggest that ankyrin also docks at the NH2 terminus of band 3. Thus, antibodies to the NH2 terminus of cdb3 block ankyrin binding to the cdb3, and ankyrin binding to cdb3 prevents p72syk phosphorylation of cdb3 at its NH2 terminus (predominantly at Tyr-8). However, a truncation mutant of cdb3 lacking the NH2-terminal 50 residues displays the same binding affinity as wild type cdb3. These data thus suggest that the NH2 terminus of cdb3 is proximal to but not required for the cdb3-ankyrin interaction. The cytoplasmic domain of erythrocyte membrane band 3 (cdb3) serves as a center of membrane organization, interacting with such proteins as ankyrin, protein 4.1, protein 4.2, hemoglobin, several glycolytic enzymes, a tyrosine phosphatase, and a tyrosine kinase, p72syk. The crystallographic structure of the cdb3 dimer has revealed that residues 175–185 assume a β-hairpin loop similar to a putative ankyrin-binding motif at the cytoplasmic surface of the Na+/K+-ATPase. To test whether this hairpin loop constitutes an ankyrin-binding site on cdb3, we have deleted amino acids 175–185 and substituted the 11-residue loop with a Gly-Gly dipeptide that bridges the deletion without introducing strain into the structure. Although the deletion mutant undergoes the same native conformational changes exhibited by wild type cdb3 and binds other peripheral proteins normally, the mutant exhibits no affinity for ankyrin. This suggests that the exposed β-hairpin turn indeed constitutes a major ankyrin-binding site on cdb3. Other biochemical studies suggest that ankyrin also docks at the NH2 terminus of band 3. Thus, antibodies to the NH2 terminus of cdb3 block ankyrin binding to the cdb3, and ankyrin binding to cdb3 prevents p72syk phosphorylation of cdb3 at its NH2 terminus (predominantly at Tyr-8). However, a truncation mutant of cdb3 lacking the NH2-terminal 50 residues displays the same binding affinity as wild type cdb3. These data thus suggest that the NH2 terminus of cdb3 is proximal to but not required for the cdb3-ankyrin interaction. cytoplasmic domain of erythrocyte membrane band 3 nickel-nitrilotriacetic acid glutathione S-transferase Ankyrin mediates the attachment of a diverse set of membrane spanning proteins to spectrin-based membrane skeletons. Depending on the cell type, ankyrin may bridge between the β subunit of spectrin and the anion exchanger (1Bennett V. Stenbuck P.J. Nature. 1979; 280: 468-473Crossref PubMed Scopus (259) Google Scholar), the Na+/K+-ATPase (2Koob R. Zimmermann M. Schoner W. Drenchhahn D. Eur. J. Cell Biol. 1988; 45: 230-237PubMed Google Scholar, 3Nelson W.J. Veshnock P.J. Nature. 1987; 328: 533-536Crossref PubMed Scopus (342) Google Scholar), a voltage-dependent Na+ channel (4Malhotra J.D. Kazen-Gillespie K. Hortsch M. Isom L.L. J. Biol. Chem. 2000; 275: 11383-11388Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar), or the Na+/Ca2+ exchanger (5Li Z.P. Burke E.P. Frank J.S. Bennett V. Philipson K.D. J. Biol. Chem. 1993; 268: 11489-11491Abstract Full Text PDF PubMed Google Scholar). Cell adhesion molecules such as CD44 (6Kalomiris E.L. Bourguignon L.Y. J. Cell Biol. 1988; 106: 319-327Crossref PubMed Scopus (128) Google Scholar) and L1CAM family members (7Davis J.Q. Bennett V. J. Biol. Chem. 1994; 269: 27163-27166Abstract Full Text PDF PubMed Google Scholar, 8Dubreuil R.R. Macvicar G. Dissanayake S. Liu C. Homer D. Hortsch M. J. Cell Biol. 1998; 133: 647-655Crossref Scopus (112) Google Scholar), as well as calcium-release channels such as IP3 receptor (9Bourguignon L.Y. Jin H. Iida N. Brandt N.R. Zhang S.H. J. Biol. Chem. 1993; 268: 7290-7297Abstract Full Text PDF PubMed Google Scholar) and ryanodine receptor (10Bourguignon L.Y. Chu A. Jin H. Brandt N.R. J. Biol. Chem. 1995; 270: 17917-17922Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) are also known to associate with ankyrin. Ankyrin is folded into three independent domains that include an 89-kDa NH2-terminal membrane-binding domain, followed by a 62-kDa spectrin-binding domain and a COOH-terminal regulatory domain. The membrane-binding domain of ankyrin consists of 24 tandem repeats of a 33-amino acid motif known as the ankyrin repeat that is involved in protein recognition (11Lux S.E. John K.M. Bennett V. Nature. 1990; 344: 36-42Crossref PubMed Scopus (410) Google Scholar, 12Bork P. Proteins. 1993; 17: 363-374Crossref PubMed Scopus (447) Google Scholar, 13Sedgwick S.G. Smerdon S.J. Trends Biochem. Sci. 1999; 24: 311-316Abstract Full Text Full Text PDF PubMed Scopus (666) Google Scholar, 14Michaely P. Bennett V. J. Biol. Chem. 1993; 268: 22703-22709Abstract Full Text PDF PubMed Google Scholar). Because ankyrin interacts with a highly diverse group of membrane proteins, much effort has been devoted to identifying the structural features that mediate these interactions (15Devarajan P. Scaramuzzino D.A. Morrow J.S. Proc. Natl. Aacd. Sci. U. S. A. 1994; 91: 2965-2969Crossref PubMed Scopus (134) Google Scholar, 16Srinivasan Y. Lewallen M. Angelides K.J. J. Biol. Chem. 1992; 276: 7483-7489Google Scholar, 17Bennett V. Baines A.J. Physiol. Rev. 2001; 81: 1353-1391Crossref PubMed Scopus (800) Google Scholar, 18Zhang X. Davis J.Q. Carpenter S. Bennett V. J. Biol. Chem. 1998; 273: 30785-30794Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). The major linkage between the membrane bilayer and spectrin-based cortical skeleton in erythrocytes is mediated by ankyrin binding to band 3. Because previous studies (19Thevinin B.J.-M. Willardson B.M. Low P.S. J. Biol. Chem. 1989; 264: 15886-15892PubMed Google Scholar, 20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar, 21Davis L. Lux S.E. Bennett V. J. Biol. Chem. 1989; 264: 9665-9672Abstract Full Text PDF PubMed Google Scholar, 22Ding Y. Kobayashi S. Kopito R. J. Biol. Chem. 1996; 271: 22494-22498Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar) aimed at mapping the docking site(s) of ankyrin on the cytoplasmic domain of erythrocyte membrane band 3 (cdb3)1 were conducted without the benefit of the crystal structure of cdb3, these investigations of necessity led to inexact conclusions regarding regions or linear sequences of cdb3 implicated in ankyrin binding. Thus, modification of Cys-201 and/or Cys-317 of the cytoplasmic domain of band 3 was found to compromise ankyrin binding (19Thevinin B.J.-M. Willardson B.M. Low P.S. J. Biol. Chem. 1989; 264: 15886-15892PubMed Google Scholar). Monoclonal antibodies against residues 190–203 (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar) or 174–186 (21Davis L. Lux S.E. Bennett V. J. Biol. Chem. 1989; 264: 9665-9672Abstract Full Text PDF PubMed Google Scholar) were also shown to block the ankyrin interaction. Ankyrin association was further found to protect residues 175–186 of cdb3 from proteolysis (21Davis L. Lux S.E. Bennett V. J. Biol. Chem. 1989; 264: 9665-9672Abstract Full Text PDF PubMed Google Scholar), and chimera analysis also implicated participation of residues 155–195 (22Ding Y. Kobayashi S. Kopito R. J. Biol. Chem. 1996; 271: 22494-22498Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Similar studies have suggested a contribution from the NH2terminus of cdb3 in the ankyrin interaction (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar). Evidence for NH2-terminal involvement has come from the observation that kidney cdb3, which lacks residues 1–65, exhibits no affinity for ankyrin (23Ding Y. Casey J.R. Kopito R. J. Biol. Chem. 1994; 269: 32201-32208Abstract Full Text PDF PubMed Google Scholar, 24Wang C.C. Moriyama R. Lombardo C.R. Low P.S. J. Biol. Chem. 1995; 270: 17892-17897Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). In addition, ankyrin association inhibits phosphorylation of tyrosine residues (predominantly Tyr-8) at the NH2 terminus of band 3 (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar). It would appear from these considerations that ankyrin may associate with two disparate regions of cdb3, a region near residues 175–190 and sequences near the NH2 terminus. With the recent publication of the crystal structure of cdb3 (25Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar), it has become possible to ask more precise questions regarding the docking site of ankyrin on cdb3. In this study, we have noted that a stem-loop structure, which is conformationally similar to a proposed ankyrin-binding site on the Na+/K+-ATPase (26Zhang Z. Devarajan P. Dorfman A.L. Morrow J.S. J. Biol. Chem. 1998; 1998: 18681-18684Abstract Full Text Full Text PDF Scopus (79) Google Scholar), is located within the general region defined by the earlier mapping studies of Willardson et al. (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar) and Davis et al. (21Davis L. Lux S.E. Bennett V. J. Biol. Chem. 1989; 264: 9665-9672Abstract Full Text PDF PubMed Google Scholar). We have, therefore, decided to evaluate whether this stem-loop structure might constitute a critical conformational motif involved in ankyrin-band 3 association. Because of previous evidence for NH2-terminal involvement, we have also explored the nature of the participation of the region in ankyrin binding in greater detail. Oligonucleotide-directed mutagenesis was performed using a QuikChange mutagenesis kit (Stratagene) according to the manufacturer's instructions. The following oligonucleotides were synthesized and used for site-directed mutagenesis. For deletion of amino acids 175–185 and substitution of 2 glycines in their place, 5′-ggccctggggggtgtgaagggtggacagcctctgctcccccaac3-′ (2 glycine residues are underlined). A His6 tag was introduced at the COOH terminus of cdb3 in a pT7–7 plasmid (27Wang C.C. Badylak J.A. Lux S.E. Moriyama R. Dixon J.E. Low P.S. Protein Sci. 1992; 1: 1206-1214Crossref PubMed Scopus (43) Google Scholar) and used as the template. For deletion of amino acids 1–50, PCR was performed using two primers: forward, 5′-ggaattccatatgcacccgggtacccacgaggtc3-′ (start codon and amino acids 51 are underlined); reverse, 5′-agaaagctttcagtggtggtggtggtggtggaagagctggcctgtctgctg3-′ (stop codon and 6 histidine residues are underlined). The resulting mutant cDNAs were sequenced to verify mutations. Plasmids were then transferred into BL21 (DE3) pLysS cells for expression of the mutated cdb3 proteins. Both wild type and mutant cdb3s with a COOH-terminal His tag were expressed in the pT7–7 bacterial expression system using isopropylthiogalactoside induction for 3 h at 37 °C. The His-tagged proteins were purified by Ni-affinity chromatography (Qiagen). Intact ankyrin was purified and radiolabeled using 125I-Bolton-Hunter reagent as described by Bennett (28Bennett V. Methods Enzymol. 1983; 96: 313-324Crossref PubMed Scopus (157) Google Scholar). The 46.5-kDa fragment of ankyrin (residues 403–827) was expressed in Escherichia coli strain BL21 (DE3)/pLysS (the expression vector was a kind gift of Dr. Vann Bennett) and purified as described by Davis and Bennett (29Davis L. Bennett V. J. Biol. Chem. 1990; 265: 10589-10596Abstract Full Text PDF PubMed Google Scholar). The GST-tagged ankyrin was by Dr. at the of and the GST-tagged protein was a gift of Dr. GST-tagged proteins were purified using a The of the of cdb3, which by more between and was as P.S. J. Biol. Chem. 269: Scholar, Low P.S. J. Biol. Chem. Full Text PDF PubMed Google Scholar), the protein chromatography used of The of of cdb3, which more between and was at in of 50 50 to using an at an of and set at 6 His-tagged wild type or mutant cdb3 was with of ankyrin at in and at were with the for at and with the same The of cdb3-ankyrin were with The of ankyrin was then by a using an or by the in the ankyrin was or by for The was to the and the at was to the of J. Biol. Chem. Full Text PDF PubMed Google Scholar). To that of His-tagged wild type and mutant cdb3 were to the were for cdb3 using an of of the domain of protein to cdb3 was by the same the of the was to to residues 175–185 of cdb3 were synthesized by was to the NH2 and COOH of the for of a bridge between the of the in an effort to the hairpin loop in the crystal structure. of were then with ankyrin to of cdb3, and the binding was performed as described noted in the a proposed ankyrin-binding site on the cytoplasmic of the Na+/K+-ATPase (26Zhang Z. Devarajan P. Dorfman A.L. Morrow J.S. J. Biol. Chem. 1998; 1998: 18681-18684Abstract Full Text Full Text PDF Scopus (79) Google Scholar) similar to a β-hairpin loop revealed in the crystal structure of cdb3 To evaluate whether this hairpin loop residues 175–185 of cdb3 might as an ankyrin-binding the residues the hairpin loop were deleted and a bridge was substituted in their Thus, on the amino acids and in the crystal structure, two glycines were to the without introducing strain into the mutated protein This deletion mutant was then expressed in coli and purified to for further To that the of the deletion mutant was not the conformational of native cdb3 was P.S. J. Biol. Chem. 269: Low P.S. J. Biol. Chem. Full Text PDF PubMed Google Scholar). Thus, as the is from to the of native cdb3 by more and the which is highly at more in 2 of the deletion mutant from to the of of the of the mutant and wild type cdb3 as a of the same changes in proteins 2 These data that the deletion mutant the same structural as wild type cdb3. To further that truncation of the β-hairpin loop a in cdb3 structure, the interaction of cdb3 with protein 4.1, a major peripheral protein of cdb3 was For this was expressed and purified in of a His tag purified His-tagged cdb3 was to associate with and the was with the of the affinity of mutated cdb3 for was shown in 2 the of protein with mutant cdb3, as from the in the was the same as the of protein with wild type cdb3, that deletion of the β-hairpin loop no in cdb3 a glycolytic that binds to cdb3 and was also for in interaction with the mutant cdb3. in the J. Biol. Chem. Scholar), wild type and mutant cdb3 were to the with the same not we that of loop deletion on ankyrin binding to a modification of the attachment site of ankyrin and not to a general of cdb3 structure. of ankyrin to wild type and mutant cdb3 was also by a His tag similar to that used for analysis of protein binding. Thus, His-tagged cdb3 was with a of to the domains of the membrane-binding domain of ankyrin of ankyrin ankyrin repeats that has been used to ankyrin-band 3 interactions (29Davis L. Bennett V. J. Biol. Chem. 1990; 265: 10589-10596Abstract Full Text PDF PubMed Google Scholar, Moriyama R. Low P.S. J. Biol. Chem. 1998; 273: Full Text Full Text PDF PubMed Scopus Google Scholar, P. Bennett V. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar, J.A. G. N. Low P.S. J. Biol. Chem. 2001; and were by of the His-tagged cdb3 on The of ankyrin was then by in the shown in 3 the binding for the association of the with His-tagged cdb3 with an of was found to of ankyrin the interaction and of the 46.5-kDa ankyrin association not binding of the 175–185 deletion mutant to ankyrin was not from that the deleted loop is critical for ankyrin association. the same analysis was performed by a using His-tagged cdb3 and ankyrin, a similar was These data suggest that the β-hairpin loop on cdb3 a critical in the ankyrin interaction. Although previous studies have that ankyrin cdb3 with affinity (29Davis L. Bennett V. J. Biol. Chem. 1990; 265: 10589-10596Abstract Full Text PDF PubMed Google Scholar) and band 3 into much ankyrin Moriyama R. Low P.S. J. Biol. Chem. 1998; 273: Full Text Full Text PDF PubMed Scopus Google Scholar), the whether the ankyrin, with its amino acid might on the β-hairpin loop for binding ankyrin, which lacks the of its membrane-binding domain. To this we purified ankyrin from the cell membrane and it with His-tagged cdb3, the resulting were using and ankyrin was by in ankyrin was also in its association with the cdb3 deletion that the with 24 ankyrin on the β-hairpin loop for interaction. To further the that residues 175–185 and in ankyrin the amino acid to residues 175–185 was in this a was to of the to for of the was as a of to the structure of the β-hairpin loop in The resulting was then for its to binding of ankyrin to cdb3. in the was indeed to ankyrin binding at of the using a not the of the to cdb3 binding not that the was not highly in its conformational A ankyrin-binding site proposed in the is to at the NH2 terminus of cdb3 (25Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar, S.E. J. Lux S.E. and of Scholar). Evidence for this from three kidney cdb3, which lacks residues 1–65, no affinity for ankyrin (23Ding Y. Casey J.R. Kopito R. J. Biol. Chem. 1994; 269: 32201-32208Abstract Full Text PDF PubMed Google Scholar, 24Wang C.C. Moriyama R. Lombardo C.R. Low P.S. J. Biol. Chem. 1995; 270: 17892-17897Abstract Full Text Full Text PDF PubMed Scopus (44) Google phosphorylation of cdb3 on tyrosine is of ankyrin (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google and antibodies to the NH2 terminus of cdb3 block ankyrin binding (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar). However, with the of the crystal structure of cdb3 (25Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar), the of at of these no deletion of residues of cdb3 the of a which the of cdb3. to evaluate the proposed involvement of the NH2 terminus of cdb3 in ankyrin a deletion mutant was required that would no in cdb3 For this the crystal structure of cdb3 was and to that the NH2-terminal 50 residues of cdb3 are and without other regions of the (25Zhang D. Kiyatkin A. Bolin J.T. Low P.S. Blood. 2000; 96: 2925-2933Crossref PubMed Google Scholar). residues of cdb3 were and the resulting cdb3 was for ankyrin In to from previous studies (20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar, Y. Casey J.R. Kopito R. J. Biol. Chem. 1994; 269: 32201-32208Abstract Full Text PDF PubMed Google Scholar, 24Wang C.C. Moriyama R. Lombardo C.R. Low P.S. J. Biol. Chem. 1995; 270: 17892-17897Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar), cdb3 lacking residues exhibited the same binding affinity for ankyrin as wild type cdb3 that the NH2 terminus may not for ankyrin association. the previous studies were conducted with ankyrin ankyrin, and the earlier data it was decided to the affinity of the deletion mutant of cdb3, but this for the ankyrin the ankyrin might the NH2 terminus of However, as in similar were to that the studies were not we the using ankyrin of ankyrin and found that three of evidence for NH2-terminal involvement kidney band 3 not ankyrin, ankyrin inhibits tyrosine phosphorylation at the NH2 terminus of cdb3, and antibodies to the NH2 terminus of cdb3 block ankyrin binding not These that residues of cdb3 may not in ankyrin proximal to the ankyrin-binding site on cdb3 that binding to the NH2 terminus prevents ankyrin and ankyrin association at the β-hairpin loop phosphorylation of cdb3 on of the crystal structure of cdb3 that this is We have evidence that the β-hairpin loop residues 175–185 of cdb3 constitutes a major ankyrin-binding site on the erythrocyte Although previous studies (19Thevinin B.J.-M. Willardson B.M. Low P.S. J. Biol. Chem. 1989; 264: 15886-15892PubMed Google Scholar, 20Willardson B.M. Thevenin B.J.-M. Harrison M.L. Kuster W.M. Benson M.D. Low P.S. J. Biol. Chem. 1989; 264: 15893-15899Abstract Full Text PDF PubMed Google Scholar, 21Davis L. Lux S.E. Bennett V. J. Biol. Chem. 1989; 264: 9665-9672Abstract Full Text PDF PubMed Google Scholar, 22Ding Y. Kobayashi S. Kopito R. J. Biol. Chem. 1996; 271: 22494-22498Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar) have suggested the involvement of a of cdb3 in ankyrin a more precise of this binding site not the structure of cdb3 Thus, deletion mutagenesis of the implicated sequences without the of crystallographic would have changes in protein that might have led to of ankyrin association. With to the crystal structure, it was possible to and the loop region on cdb3 without introducing or strain into the of the of ankyrin binding by this deletion with no of the conformational or binding affinity for protein 4.1, then to the critical involvement of the β-hairpin loop in ankyrin binding. This was further by the of the deleted to for ankyrin association with cdb3. mutagenesis of the NH2 terminus of cdb3 further that the 50 residues of the are not involved in ankyrin binding. However, the that of this by prevents ankyrin and ankyrin binding to the β-hairpin loop inhibits phosphorylation of that the NH2 terminus and the ankyrin-binding site near of this would not have been from the crystal structure the residues of cdb3 are to and the β-hairpin loop from the site the NH2-terminal the of a ankyrin also with other peripheral proteins that at the NH2 terminus of band 3 C.R. Willardson B.M. Low P.S. J. Biol. Chem. 1992; Full Text PDF PubMed Google Scholar) H. and P. S. Because the NH2 terminus of cdb3 is not required for interaction with protein C.R. Willardson B.M. Low P.S. J. Biol. Chem. 1992; Full Text PDF PubMed Google Scholar) but also for association with glycolytic J. Biol. Chem. Scholar, Liu H. J. Biol. Chem. Full Text PDF PubMed Google Scholar) and p72syk M.L. C.C. Low P.S. J. Biol. Chem. 1994; 269: Full Text PDF PubMed Google Scholar, D. C. H. PubMed Scopus Google Scholar), it is also that binding of ankyrin to cdb3 might involved in of other protein interactions at the The of a for residues in ankyrin binding the of kidney cdb3, which lacks residues 1–65, to ankyrin. of the crystal structure, that residues constitute a in an β that the of cdb3. Although deletion of residues to have or no on protein of residues of the of the domain. Thus, on crystallographic kidney cdb3 have a from erythrocyte cdb3. with this it has been that interacts with but not erythrocyte band 3 J. S. X. J. Biol. Chem. 1998; 273: Full Text Full Text PDF PubMed Scopus Google Scholar), the glycolytic enzymes, ankyrin, and protein associate with erythrocyte but not kidney band 3 C.C. Moriyama R. Lombardo C.R. Low P.S. J. Biol. Chem. 1995; 270: 17892-17897Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). It is to that the binding of ankyrin to band 3 are well by the binding of ankyrin to cdb3. association at the β-hairpin but to docking with the NH2 are by at this and phosphorylation of studies P. Bennett V. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar) have suggested that ankyrin site on its set of 6 ankyrin repeats and binding site within repeats 3 and the 46.5-kDa ankyrin. on the in binding it is to that of the may between 3 and and cdb3 and that docking with 2 may a more surface of the proposed Na+/K+-ATPase and for ankyrin might suggest that a β-hairpin loop constitutes a ankyrin-binding motif on the cytoplasmic domains of proteins. the loop on cdb3 no with the loop on the cdb3 inhibits the binding of ankyrin to the Na+/K+-ATPase J.S. C. A. J. Cell Biol. 1989; PubMed Scopus Google Scholar). We this to suggest that a conformational at the binding to to compromise ankyrin-binding affinity by residues in the β-hairpin loop not is with the more by conformational in this interaction. other ankyrin-binding become it to whether similar exposed constitute the of association. We for ankyrin.
No takes yet. Share an insight, caveat, or question.
Chang et al. (2003) studied this question.
Synapse has enriched 5 closely related papers on similar clinical questions. Consider them for comparative context: