Identification of an Androgen Response Element in Intron 8 of the Sterol Regulatory Element-binding Protein Cleavage-activating Protein Gene Allowing Direct Regulation by the Androgen Receptor

Sterol regulatory element-binding proteins (SREBPs) are transcription regulators that play a pivotal role in intracellular lipid homeostasis. They are synthesized as inactive precursor proteins in the endoplasmic reticulum, where they are retained by SREBP cleavage-activating protein (SCAP), a sterol sensing protein that in turn is linked to a retention protein complex. Low intracellular sterol concentrations weaken the interaction of SCAP with its retention proteins and allow translocation of the SREBP·SCAP complex to the Golgi compartment where SREBP is proteolytically cleaved and activated. Previous studies on the mechanisms by which androgens provoke a coordinated activation of lipogenic pathways in prostate cancer cells have suggested an alternative pathway of activation in which androgens increase the expression of SCAP and favor translocation of the SREBP·SCAP complex to the Golgi apparatus by disturbing the balance between SCAP and its retention proteins. Here we show that the SCAP gene contains an androgen-responsive region located in intron 8. This region interacts directly with the androgen receptor and confers androgen responsiveness to promoter-reporter constructs transfected in LNCaP cells. It contains a noncanonical androgen response element GGAAGAaaaTGTACC that interacts not only with the androgen receptor but also with the glucocorticoid receptor and that also confers glucocorticoid responsiveness. The identification of a steroid response element in intron 8 of the SCAP gene further supports the contention that SCAP is a direct target for steroid hormone action. Sterol regulatory element-binding proteins (SREBPs) are transcription regulators that play a pivotal role in intracellular lipid homeostasis. They are synthesized as inactive precursor proteins in the endoplasmic reticulum, where they are retained by SREBP cleavage-activating protein (SCAP), a sterol sensing protein that in turn is linked to a retention protein complex. Low intracellular sterol concentrations weaken the interaction of SCAP with its retention proteins and allow translocation of the SREBP·SCAP complex to the Golgi compartment where SREBP is proteolytically cleaved and activated. Previous studies on the mechanisms by which androgens provoke a coordinated activation of lipogenic pathways in prostate cancer cells have suggested an alternative pathway of activation in which androgens increase the expression of SCAP and favor translocation of the SREBP·SCAP complex to the Golgi apparatus by disturbing the balance between SCAP and its retention proteins. Here we show that the SCAP gene contains an androgen-responsive region located in intron 8. This region interacts directly with the androgen receptor and confers androgen responsiveness to promoter-reporter constructs transfected in LNCaP cells. It contains a noncanonical androgen response element GGAAGAaaaTGTACC that interacts not only with the androgen receptor but also with the glucocorticoid receptor and that also confers glucocorticoid responsiveness. The identification of a steroid response element in intron 8 of the SCAP gene further supports the contention that SCAP is a direct target for steroid hormone action. Sterol regulatory element-binding proteins (SREBPs) 1The abbreviations used are: SREBP, sterol regulatory element-binding protein; SCAP, SREBP cleavage-activating protein; SRE, sterol-responsive element; ARE, androgen response element; FCS, fetal calf serum; GR, glucocorticoid receptor; AR, androgen receptor; DBD, DNA-binding domain; EMSA, electrophoretic mobility shift assay. represent an important family of transcription regulators (SREBP-1a, -1c, and -2) controlling intracellular lipid homeostasis (1Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1105) Google Scholar). SREBPs are synthesized as 125-kDa inactive precursor proteins, and immediately upon their synthesis they are inserted into the membranes of the endoplasmic reticulum where they form tight complexes with an escort protein known as the SREBP cleavage-activating protein (SCAP). SCAP plays a pivotal role in the control of SREBP signaling. In fact, SCAP does not only bind SREBP but, through its amino-terminal sterol-sensing domain, it also interacts with a retention protein complex consisting of at least two endoplasmic reticulum proteins (designated insulin-induced gene 1 and 2; Insig 1 and 2) that serve to retain the SREBP·SCAP complex into the membranes of the endoplasmic reticulum. In the “classical” SREBP activation pathway, a decrease in the intracellular concentration of sterols changes the conformation of the sterol-sensing part of SCAP, weakens its interaction with the retention proteins, and allows translocation of the SREBP·SCAP complex to the Golgi apparatus where SREBP is proteolytically cleaved and activated. The active 68-kDa SREBP fragment migrates to the nucleus where it increases the transcription of a large set of sterol-responsive element (SRE) containing genes encoding lipogenic enzymes belonging to the pathways of fatty acid and cholesterol synthesis (1Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11041-11048Crossref PubMed Scopus (1105) Google Scholar, 2Yang T. Espenshade P.J. Wright M.E. Yabe D. Gong Y. Aebersold R. Goldstein J.L. Brown M.S. Cell. 2002; 110: 489-500Abstract Full Text Full Text PDF PubMed Scopus (782) Google Scholar, 3Yabe D. Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 12753-12758Crossref PubMed Scopus (423) Google Scholar, 4Yang T. Goldstein J.L. Brown M.S. J. Biol. Chem. 2000; 275: 29881-29886Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 5Brown M.S. Ye J. Rawson R.B. Goldstein J.L. Cell. 2000; 100: 391-398Abstract Full Text Full Text PDF PubMed Scopus (1149) Google Scholar, 6Brown A.J. Sun L. Feramisco J.D. Brown M.S. Goldstein J.L. Mol. Cell. 2002; 10: 237-245Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar, 7Adams C.M. Goldstein J.L. Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10647-10652Crossref PubMed Scopus (90) Google Scholar). Our studies on the mechanisms by which androgens provoke a coordinated activation of lipogenic pathways in androgen-responsive prostate tumor lines have suggested an alternative pathway of SREBP activation in which androgens change the expression rather than the conformation of SCAP (8Swinnen J.V. Ulrix W. Heyns W. Verhoeven G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12975-12980Crossref PubMed Scopus (210) Google Scholar, 9Heemers H. Maes B. Foufelle F. Heyns W. Verhoeven G. Swinnen J.V. Mol. Endocrinol. 2001; 15: 1817-1828Crossref PubMed Scopus (118) Google Scholar). In this pathway, increased expression of SCAP shifts the balance between SCAP and its retention proteins and favors translocation of the SREBP·SCAP complex to the Golgi apparatus. Evidence for the existence of this pathway was derived from several observations (9Heemers H. Maes B. Foufelle F. Heyns W. Verhoeven G. Swinnen J.V. Mol. Endocrinol. 2001; 15: 1817-1828Crossref PubMed Scopus (118) Google Scholar). 1) In two independent prostate tumor lines (LNCaP and MDA-PCa-2a) androgens cause major changes in the expression of SCAP both at the mRNA and at the protein level, whereas no or only minor changes were observed for other critical components of the SREBP pathway (the SREBP precursor proteins SREBP-1a, -1c, and -2; the site 1 and site 2 proteases responsible for SREBP cleavage). 2) The observed increase in SCAP expression was shown to be a cause rather than a consequence of SREBP activation. Induction of SCAP expression coincided with nuclear translocation of SREBP but preceded the increased expression of lipogenic genes involved in cholesterol and triglyceride synthesis. Moreover, activation of SREBP signaling by an alternative route (sterol depletion) did not result in SCAP induction. 3) Overexpression of SCAP could be shown to result in activation of the SREBP pathway. Because experiments with actinomycin D indicated that the stimulatory effects of androgens on SCAP require transcriptional activity (9Heemers H. Maes B. Foufelle F. Heyns W. Verhoeven G. Swinnen J.V. Mol. Endocrinol. 2001; 15: 1817-1828Crossref PubMed Scopus (118) Google Scholar), we wanted to answer the question of whether SCAP is a direct target for androgen action. To this end we performed a systematic search for cis-acting regulatory sequences in the SCAP gene that might mediate the effects of androgens. Here we describe the identification and characterization of an androgen response element (ARE) located within intron 8 of the SCAP gene. Cell Culture—The human prostate carcinoma cell line LNCaP was obtained from the American Type Culture Collection (Manassas, VA) and was routinely maintained in phenol red-free RPMI 1640 medium supplemented with 10% FCS (Invitrogen), 3 mm l-glutamine (Invitrogen), 100 μg/ml streptomycin, and 100 units/ml penicillin (Invitrogen). The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 in air. In experiments assessing the effects of androgens, FCS was pretreated with dextran-coated charcoal (CT-FCS) (10Leake R.E. Freshney R.I. Munir I. Steroid Hormones: A Practical Approach. IRL Press, Washington, D.C.1987: 213-214Google Scholar) to reduce the background levels of steroids. The synthetic androgen R1881 (methyl-trienolone) was purchased from PerkinElmer Life Sciences, dissolved in absolute ethanol, and added to the cultures from a 1000-fold concentrated stock. Control cultures received similar amounts of ethanol only. Final ethanol concentrations did not exceed 0.1% (v/v). Luciferase Reporter Plasmids—The pGL3-SCAP construct was generated by cloning an approximately 1.1-kb promoter fragment of the SCAP gene (bp -1018 to + 42) (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar) into the pGL3 basic vector (Promega, Madison, WI). The pGL3-SCAPmutSRE construct was made by performing site-directed mutagenesis using the primer pair 5′-ctgtggcctcgacctcccgggagacttgtgcactcctacctcagcctcctgag-3′ (forward primer) and 5′-ctcaggaggctgaggtaggagtgcacaagtctcccgggaggtcgaggccacag-3′ (reverse primer). To obtain the entire genomic sequence of SCAP, a human PAC genomic library was screened by PCR (Incyte Genomics, Palo Alto, CA) using both a primer pair targeted at the promoter region of the SCAP gene (designated SCAP promoter) (bp -452 to -173) (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar) and a primer pair amplifying a genomic region encompassing exon 22 (designated SCAP exon 22) (bp 3475–3588; GenBank™ accession number D83782) (Table I). A positive clone, designated PAC-SCAP, was grown according to the supplier's recommendations. PAC-SCAP DNA was purified using a Qiagen plasmid kit (very low copy plasmid purification protocol). KpnI restriction fragments derived from PAC-SCAP and subfragments thereof were cloned into the pGL3 promoter vector or into a vector driven by a minimal promoter (pE1bLUC) (12Sui X. Bramlett K.S. Jorge M.C. Swanson D.A. von Eschenbach A.C. Jenster G. J. Biol. Chem. 1999; 274: 9449-9454Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Following a NCBI human genomic BLAST search, the location and orientation of the genomic DNA fragments were determined in relation to the sequence of the SCAP gene. The oligonucleotides used in band shift assays (see below) were hybridized and cloned into a NheI-digested pES vector (a pGL3-derived plasmid driven by a thymidine kinase-TATA minimal promoter), resulting in the insertion of two copies of the oligonucleotide with alternating orientation upstream of the minimal TATA box. The genomic inserts of all constructs were subjected to nucleotide sequencing using an automated laser fluorescence sequencer (Amersham Biosciences).Table IPrimers used to screen a human PAC genomic library for the genomic sequence of SCAPDNA amplifiedPrimer pairPrimer sequencePCR productsbpSCAP promoter5′gagacggaggtctcctacgttg2793′catgcgtagtcgaaccacattcSCAP exon 225′tggggatgtcacctcccttac1133′tgctgaatggagtagaacttgatgc Open table in a new tab Transient Transfections—LNCaP cells were seeded in 60-mm dishes at a density of 1 × 106 cells/dish in RPMI 1640 medium containing 5% CT-FCS. The next day, transfection mixtures were prepared. For each dish, 2 ml of serum-free Dulbecco's modified Eagle's medium (Invitrogen) was supplemented with 3 μg of promoter-reporter construct. In case of cotransfection experiments, 100 ng of an expression construct encoding the human glucocorticoid receptor was the of of the transfection was for at The cells were with serum-free the transfection was and the cell cultures were for at 37 ml of RPMI medium with 5% was The next day, the medium was with 5% and the cells were with or ethanol for 2 The cells were with and in of of of were for activity by using a kit from and a or was in from plasmid as G. B. Verhoeven G. W. F. J. 1999; PubMed Scopus Google Scholar) and was purified on according to the oligonucleotides used in the band shift assays and were hybridized and were in using the fragment of DNA in the of Life oligonucleotide was with in a containing mm mm mm mm 1 mm for on The complexes were on a 5% in 22 mm 22 mm mm and at The were and to In a of oligonucleotide to was with amounts of receptor The of that was by in each of the to the of in that was the or concentration that was The were using (Amersham To the the was The were to with A 1.1-kb SCAP human SCAP gene is located on 3 and of and 22 (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar). the of only the sequence of the SCAP gene and the nucleotide sequence of a DNA region of located in the region the of transcription of the SCAP gene were (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar). In a search for androgen-responsive the 1.1-kb promoter region was cloned into the pGL3 basic LNCaP cells transfected with the resulting promoter-reporter construct were with R1881 or ethanol for 2 effects of androgens on gene activity were of this 1.1-kb region to androgen responsiveness. of a in this region (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar) expression but did not androgen not of a within 8 of the SCAP no were in the 1.1-kb promoter we to the entire genomic sequence of the gene encoding SCAP for the stimulatory effects of androgens. To this a human PAC genomic library was screened for the genomic sequence of SCAP by a PCR using both a primer set targeted at the promoter region of the SCAP gene and a primer pair amplifying a genomic fragment to exon 22 (designated of the genomic sequence of the SCAP gene. fragments obtained by restriction of DNA from the resulting PAC-SCAP and of the SCAP gene were cloned into the site of the pGL3 promoter which is driven by an Following automated laser fluorescence sequencing of the genomic inserts and using the NCBI human genomic search the of the genomic DNA fragments in the SCAP gene were transfection into LNCaP several of constructs a and increase in activity androgen In the to which gene activity was the observed with the pGL3 promoter-reporter vector not promoter-reporter construct (designated a genomic located in a region of the SCAP gene encompassing a of activity androgen This construct was for further restriction the genomic DNA of was into independent fragments that were cloned into shown in only of the resulting promoter-reporter constructs (designated to androgen with a major increase in the of androgen-responsive within this DNA To the androgen-responsive within this DNA fragment located in a genomic region encompassing exon the DNA of was subjected to Transient transfection experiments using the constructs indicated the of an androgen-responsive within a DNA fragment located in intron 8 of the gene encoding SCAP of transfected LNCaP cells to an increase in gene activity of this fragment into the site of a construct driven by a minimal promoter containing only a TATA (12Sui X. Bramlett K.S. Jorge M.C. Swanson D.A. von Eschenbach A.C. Jenster G. J. Biol. Chem. 1999; 274: 9449-9454Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar) a 3) of gene the of an androgen response within the DNA of an within 8 of the SCAP whether the androgen of gene activity is by a direct interaction between the genomic DNA fragment and the AR, electrophoretic mobility shift assays were set using protein and to DNA fragments encompassing approximately of the fragment (designated oligonucleotide SCAP and To of androgen oligonucleotides were to a with their DNA shown in a complex was observed was added to oligonucleotide SCAP In the no or interaction with oligonucleotide SCAP 1 or oligonucleotide SCAP To whether the observed of to oligonucleotide SCAP 2 to transcriptional activation of the SCAP two copies of each oligonucleotide were cloned in a vector upstream of the thymidine minimal promoter and the androgen responsiveness of the resulting promoter-reporter constructs was in transfection assays in LNCaP cells. A increase in the activity of was observed androgen that the interaction between and oligonucleotide SCAP 2 is with the in the androgen of activity of 1 and 3 constructs was of the within 8 of the SCAP the site of interaction within oligonucleotide SCAP the nucleotide sequence of oligonucleotide SCAP 2 was in This the of a sequence that to the Because an of a of a G. A. F. Mol. Genet. 2003; PubMed Scopus Google Scholar), we that the GGAAGAaaaTGTACC sequence within oligonucleotide SCAP 2 might represent a To this an oligonucleotide to this sequence designated oligonucleotide for oligonucleotide SCAP 2 was generated and used in shift assays shown in a complex was observed oligonucleotide was used in that the oligonucleotide sequence is for of the within the which is a and of G. A. F. Mol. Genet. 2003; PubMed Scopus Google Scholar), by a of Moreover, of the entire the or of this site to an a shift from to not In an of fragment to oligonucleotide in which the within the sequence was into a as as oligonucleotides the entire site were to for In of an of DNA fragments encompassing a U. B. F. W. M. R. G. Cell. Full Text PDF PubMed Scopus Google Scholar) of the to oligonucleotide not The of oligonucleotides no androgen-responsive did not not the of to or oligonucleotides the of the sequences to transcriptional activation to gene activity of a construct containing two copies of oligonucleotide increased androgen whereas or of the sequence an increase in gene activity In the to oligonucleotide sequences the of sequences to androgen responsiveness to genes not To further of the to the SCAP ARE, studies were set and an was To this oligonucleotides were with concentrations of A was and a was to a with of to oligonucleotide is the of of is at of protein and a of and in two independent experiments using two of was the in for the existence of a located within intron 8 of the SCAP gene To further the of this sequence for the androgen of SCAP gene we the of the of this sequence on androgen of gene shown in androgen of LNCaP cells transfected with the construct to an of gene or of the SCAP the the of the of the SCAP for the of gene SCAP a DNA a part of we whether the SCAP gene be also by other steroid hormone or to a of that bind the G. A. F. Mol. Genet. 2003; PubMed Scopus Google Scholar). we whether the GR, known to bind several G. A. F. Mol. Genet. 2003; PubMed Scopus Google and is to with the SCAP gene studies using and the oligonucleotides in to oligonucleotide was the case for the or of the sequence within this sequence In the of an was to obtain of to oligonucleotide not Moreover, an of oligonucleotide was to for whereas of oligonucleotide or oligonucleotide did not To the of LNCaP which not an GR, were with an expression construct encoding the human and promoter-reporter constructs containing two copies of or oligonucleotide shown in to gene activity of the construct. with the observed in or of the SCAP within this construct in a of glucocorticoid responsiveness. were obtained by of the sequence within oligonucleotide not studies that of to oligonucleotide a of at a concentration of with the SCAP at a than a of was and in two independent experiments using two of In studies we that the and coordinated of lipogenic genes by androgens in androgen-responsive prostate tumor cells is the result of activation of the SREBP pathway (8Swinnen J.V. Ulrix W. Heyns W. Verhoeven G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12975-12980Crossref PubMed Scopus (210) Google Scholar). Moreover, using two independent tumor lines we that this activation was by an increase in the expression of SCAP resulting in an between SREBP and its retention proteins, translocation of the SREBP·SCAP complex to the Golgi apparatus and activation of SREBP (9Heemers H. Maes B. Foufelle F. Heyns W. Verhoeven G. Swinnen J.V. Mol. Endocrinol. 2001; 15: 1817-1828Crossref PubMed Scopus (118) Google Scholar). In the we for in the SCAP gene that might mediate transcription by direct interaction with the or through a to androgen-responsive in the SCAP promoter using promoter-reporter constructs containing or of the region of the SCAP gene other components of the SREBP signaling the SCAP promoter contains a (11Nakajima T. Hamakubo T. Kodama T. Inazawa J. Emi M. J. Hum. Genet. 1999; 44: 402-407Crossref PubMed Scopus (25) Google Scholar). of this but no was for its in the effects of androgens on SCAP not In of a PAC the human SCAP gene sequence was and a systematic search for to mediate androgen responsiveness was fragments of the were into the site of the pGL3 promoter driven by a In this of the entire gene could be For the in the pGL3 vector Transient transfection studies in LNCaP cells to a region encompassing as an androgen-responsive region a in further the active region could be to a fragment a in the of a construct driven by a minimal promoter containing only a TATA This region a number of 1) It is located in an intron of the SCAP gene. of androgen-responsive also for the genes encoding the and components of protein F. L. B. Heyns W. Verhoeven G. W. PubMed Scopus Google Scholar, F. L. B. Heyns W. Verhoeven G. W. PubMed Scopus Google Scholar) and for the gene encoding B. R.E. Mol. Cell. Biol. PubMed Google Scholar). 2) studies that the fragment interacts directly with the AR, that it an 3) the of a sequence that to the of This sequence the and is to androgen responsiveness to promoter constructs transfected in Moreover, of critical for the of an or of the of the reduce both and The and also the of the fragment to as an Because be in at least two the which from the also bind other 1 steroid hormone and which are as and the which the and are as direct G. A. F. Mol. Genet. 2003; PubMed Scopus Google Scholar), we also the of SCAP to as a The in that SCAP as a and the with an that is only than that observed for the for the contention that SCAP is a direct target for androgen and that increases in SCAP expression are at least in part the result of a direct interaction of the with an located in intron 8 of the SCAP gene. this it be that to the in prostate tumor cells. SCAP is a pivotal element in the control of SREBP in this signaling pathway and turn to be for androgen action. we could only of the sequences of the SCAP the existence of in of the of the gene be is that of the in the of prostate cancer cells to a androgen response of the SCAP gene not This to the of other in to the to mediate the SCAP response to androgens. The of an in the SCAP gene not only be to in prostate tumor cells. In fact, it that androgens also provoke a coordinated activation of lipogenic pathways involved in cholesterol and triglyceride synthesis in target as the prostate and H. F. T. I. Heyns W. Verhoeven G. Swinnen J.V. Mol. Cell. Endocrinol. 2003; PubMed Scopus Google Scholar) and in A. S. 2003; PubMed Scopus Google Scholar). In the prostate this increase in was shown to be by activation of the SREBP pathway H. F. T. I. Heyns W. Verhoeven G. Swinnen J.V. Mol. Cell. Endocrinol. 2003; PubMed Scopus Google Scholar), and SCAP was to be an gene F. 2003; PubMed Scopus Google Scholar). Moreover, steroid also observed in tumor cells Google Scholar, M. H. D. J. PubMed Scopus Google Scholar). In this case are the active and at least in cell lines to be by SREBPs D. X. I. J. Biol. Chem. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar). the that the in the SCAP gene to the family of response for steroid of it is to that SCAP turn to be a direct target for steroid action.