Proteasome-dependent Degradation of Cyclin D1 in 1-Methyl-4-phenylpyridinium Ion (MPP+)-induced Cell Cycle Arrest

1-Methyl-4-phenylpyridinium ion (MPP+), an active metabolite of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, induces cell death and inhibition of cell proliferation in various cells. However, the mechanism whereby MPP+ inhibits cell proliferation is still unclear. In this study, we found that MPP+ suppressed the proliferation with accumulation in G1 phase without inducing cell death in p53-deficient MG63 osteosarcoma cells. MPP+ induced hypophosphorylation of retinoblastoma protein and rapidly down-regulated the protein but not mRNA levels of cyclin D1 in MG63 cells. The down-regulation of cyclin D1 protein was suppressed by a proteasome inhibitor, MG132. The cyclin D1 down-regulation by MPP+ was also observed in p53-positive PC12, HeLa S3, and HeLa ρ0 cells, which are a subclone of HeLa S3 lacking mitochondrial DNA. Moreover, MPP+ dephosphorylated Akt in PC12 cells, which was rescued by the pretreatment with nerve growth factor. In addition, the pretreatment with nerve growth factor or lithium chloride, a glycogen synthase kinase-3β inhibitor, suppressed the cyclin D1 down-regulation caused by MPP+. Our results demonstrate that MPP+ induces cell cycle arrest independently of its mitochondrial toxicity or the p53 status of the target cells, but rather through the proteasome- and phosphatidylinositol 3-Akt-glycogen synthase kinase-3β-dependent cyclin D1 degradation. 1-Methyl-4-phenylpyridinium ion (MPP+), an active metabolite of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine, induces cell death and inhibition of cell proliferation in various cells. However, the mechanism whereby MPP+ inhibits cell proliferation is still unclear. In this study, we found that MPP+ suppressed the proliferation with accumulation in G1 phase without inducing cell death in p53-deficient MG63 osteosarcoma cells. MPP+ induced hypophosphorylation of retinoblastoma protein and rapidly down-regulated the protein but not mRNA levels of cyclin D1 in MG63 cells. The down-regulation of cyclin D1 protein was suppressed by a proteasome inhibitor, MG132. The cyclin D1 down-regulation by MPP+ was also observed in p53-positive PC12, HeLa S3, and HeLa ρ0 cells, which are a subclone of HeLa S3 lacking mitochondrial DNA. Moreover, MPP+ dephosphorylated Akt in PC12 cells, which was rescued by the pretreatment with nerve growth factor. In addition, the pretreatment with nerve growth factor or lithium chloride, a glycogen synthase kinase-3β inhibitor, suppressed the cyclin D1 down-regulation caused by MPP+. Our results demonstrate that MPP+ induces cell cycle arrest independently of its mitochondrial toxicity or the p53 status of the target cells, but rather through the proteasome- and phosphatidylinositol 3-Akt-glycogen synthase kinase-3β-dependent cyclin D1 degradation. 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) 1The abbreviations used are: MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; Cdk, cyclin-dependent kinase; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; GSK-3β, glycogen synthase kinase-3β; LiCl, lithium chloride; MPP+, 1-methyl-4-phenylpyridinium ion; NGF, nerve growth factor; PI3K, phosphatidylinositol 3-kinase; Rb, retinoblastoma protein. is commonly used in animals to produce an experimental model of Parkinson's disease (1Langston J.W. Irwin I. Clin. Neuropharmacol. 1986; 9: 485-507Crossref PubMed Scopus (214) Google Scholar, 2Bloem B.R. Irwin I. Buruma O.J. Haan J. Roos R.A. Tetrud J.W. Langston J.W. J. Neurol. Sci. 1990; 97: 273-293Abstract Full Text PDF PubMed Scopus (146) Google Scholar). 1-Methyl-4-phenylpyridinium ion (MPP+) (3Tipton K.F. Singer T.P. J. Neurochem. 1993; 61: 1191-1206Crossref PubMed Scopus (517) Google Scholar), an active metabolite of MPTP, induces cell death and inhibition of proliferation not only in neuronal cells but also in other types of cell (4Miyako K. Kai Y. Irie T. Takeshige K. Kang D. J. Biol. Chem. 1997; 272: 9605-9608Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 5Di Monte D. Jewell S.A. Ekstrom G. Sandy M.S. Smith M.T. Biochem. Biophys. Res. Commun. 1986; 137: 310-315Crossref PubMed Scopus (156) Google Scholar, 6Soldner F. Weller M. Haid S. Beinroth S. Miller S.W. Wullner U. Davis R.E. Dichgans J. Klockgether T. Schulz J.B. Exp. Cell Res. 1999; 250: 75-85Crossref PubMed Scopus (50) Google Scholar, 7Bai J. Nakamura H. Hattori I. Tanito M. Yodoi J. Neurosci. Lett. 2002; 321: 81-84Crossref PubMed Scopus (70) Google Scholar). The mechanisms whereby MPP+ induces the inhibition of membrane-bound NADH dehydrogenase in mitochondrial complex I (8Nicklas W.J. Vyas I. Heikkila R.E. Life Sci. 1985; 36: 2503-2508Crossref PubMed Scopus (1092) Google Scholar, 9Ramsay R.R. Salach J.I. Dadgar J. Singer T.P. Biochem. Biophys. Res. Commun. 1986; 135: 269-275Crossref PubMed Scopus (224) Google Scholar, 10Ramsay R.R. Salach J.I. Singer T.P. Biochem. Biophys. Res. Commun. 1986; 134: 743-748Crossref PubMed Scopus (229) Google Scholar), ATP depletion (11Chan P. DeLanney L.E. Irwin I. Langston J.W. Di Monte D. J. Neurochem. 1991; 57: 348-351Crossref PubMed Scopus (202) Google Scholar), and production of the superoxide radicals (12Zang L.Y. Misra H.P. J. Biol. Chem. 1992; 267: 17547-17552Abstract Full Text PDF PubMed Google Scholar, 13Zang L.Y. Misra H.P. J. Biol. Chem. 1993; 268: 16504-16512Abstract Full Text PDF PubMed Google Scholar) have been studied extensively. However, the mechanisms involved in the inhibition of cell proliferation by MPP+ have rarely been examined. Progression and transition in the cell cycle of mammalian cells are governed by cyclin-dependent kinases (Cdks) whose activities are regulated by the binding of their regulatory subunits (called cyclins) or Cdk inhibitors (14Morgan D.O. Nature. 1995; 374: 131-134Crossref PubMed Scopus (2933) Google Scholar). p21 effectively inhibits Cdk2, Cdk3, Cdk4, and Cdk6, which have a direct role in the G1/S transition, but it is a poor inhibitor of other known Cdks (15Harper J.W. Adami G.R. Wei N. Keyomarsi K. Elledge S.J. Cell. 1993; 75: 805-816Abstract Full Text PDF PubMed Scopus (5239) Google Scholar, 16Xiong Y. Hannon G.J. Zhang H. Casso D. Kobayashi R. Beach D. Nature. 1993; 366: 701-704Crossref PubMed Scopus (3177) Google Scholar, 17Harper J.W. Elledge S.J. Keyomarsi K. Dynlacht B. Tsai L.H. Zhang P. Dobrowolski S. Bai C. Connell-Crowley L. Swindell E. Mol. Biol. Cell. 1995; 6: 387-400Crossref PubMed Scopus (860) Google Scholar). Cyclin proteolysis is essential for cell cycle progression (18Murray A. Cell. 1995; 81: 149-152Abstract Full Text PDF PubMed Scopus (275) Google Scholar, 19Hochstrasser M. Cell. 1996; 84: 813-815Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar). Cyclin D1 regulates G1 arrest and the phosphorylation status of retinoblastoma protein (Rb). Cyclin D1 degradation is mediated by phosphorylation-triggered, ubiquitin-dependent proteolysis (20Diehl J.A. Zindy F. Sherr C.J. Genes Dev. 1997; 11: 957-972Crossref PubMed Scopus (648) Google Scholar). Cyclin D1 proteolysis is regulated by glycogen synthase kinase-3β (GSK-3β) (21Diehl J.A. Cheng M. Roussel M.F. Sherr C.J. Genes Dev. 1998; 12: 3499-3511Crossref PubMed Scopus (1861) Google Scholar), which is inactivated by a pathway that sequentially involves Ras, phosphatidylinositol 3-kinase (PI3K), and Akt (22Desbois-Mouthon C. Cadoret A. Blivet-Van Eggelpoel M.J. Bertrand F. Cherqui G. Perret C. Capeau J. Oncogene. 2001; 20: 252-259Crossref PubMed Scopus (267) Google Scholar). The aim of this study was to examine the mechanisms whereby MPP+ inhibits cell proliferation. We show here that MPP+ initiates an efficient p53-independent G1 arrest by the degradation of cyclin D1. Reagents and Cells—MPP+ and MG132 were purchased from Sigma and Peptide Institute, Inc. (Osaka, Japan), respectively. Anti-cyclin D1 mouse monoclonal, anti-Rb mouse monoclonal, and anti-p21 rabbit polyclonal antibodies were purchased from BD Biosciences (San Diego). Anti-phospho-Akt (Ser-473), anti-Akt, and anti-phospho-GSK-3β (Ser-9) rabbit polyclonal antibodies were from Cell Signaling Technology (Beverly, MA). MG63 and HeLa S3 were maintained in DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal calf serum (FCS) and antibiotics (100 IU/ml penicillin and 100 μg/ml streptomycin) at 37 °C in a humid atmosphere containing 5% CO2. PC12 cells were maintained in RPMI (Invitrogen) supplemented with 10% heat-inactivated fetal horse serum and 5% FCS antibiotics (100 IU/ml penicillin and 100 μg/ml streptomycin) at 37 °C in a humid atmosphere containing 5% CO2. Establishment of HeLa ρ0 Cells—As described by King and Attardi (23King M.P. Attardi G. Science. 1989; 246: 500-503Crossref PubMed Scopus (1454) Google Scholar), HeLa S3 cells were maintained in αEU medium (αMEM (Invitrogen) + 4 g/liter glucose + 50 ng/ml ethidium bromide (EtBr) + 0.1 g/liter uridine)+ 10% FCS for half a year. More than 100 colonies were isolated in αGU medium (αEU minus ethidium bromide) + 10% FCS, of which the clone 9A (HeLa ρ0) cell strain was selected by reason of its good growing potential and used in this study. Confirmation of Mitochondrial DNA (mtDNA)—The presence or absence of the mitochondrial genome was confirmed in HeLa S3 and HeLa ρ0 cells with PCR using nine primer sets (24Tallini G. Ladanyi M. Rosai J. Jhanwar S.C. Cytogenet. Cell Genet. 1994; 66: 253-259Crossref PubMed Scopus (79) Google Scholar), which covered the whole mitochondrial genome. No amplification was shown with HeLa ρ0 DNA as template. Irregularly (once every 2-3 months), the absence of mtDNA in HeLa ρ0 cells was confirmed using two primer sets. The sense primer is located at nucleotides 3108-3127 and the antisense primer at 3318-3301 of the published human mtDNA sequence (25Anderson S. Bankier A.T. Barrell B.G. de Bruijn M.H. Coulson A.R. Drouin J. Eperon I.C. Nierlich D.P. Roe B.A. Sanger F. Schreier P.H. Smith A.J. Staden R. Young I.G. Nature. 1981; 290: 457-465Crossref PubMed Scopus (7641) Google Scholar). The product length was 211. Fragments of nuclear DNA were amplified with primers at nucleotides 1437-1456 (GGCCATTGCAGAATTATTGC) and at 1530-1511 (AGCCATTCCAGCATATCGTC) in the APC gene (the product length was 94 bp). The PCR mixture contained four primers (0.5 μm each), 150 μm dNTPs, 10 mm Tris-HCl, pH 8.4, 50 mm KCl, 2 mm MgCl2, 0.1% Triton X-100, and 0.01% gelatin in a final volume of 10 μl. 10 ng of genomic DNA was submitted to PCR amplification (95 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min, 35 cycles) using 0.25 unit of Taq polymerase (Takara, Tokyo). Western Blot Analysis—Cells were collected and washed twice with ice-cold phosphate buffered saline and then lysed with a solubilizing solution (20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% Nonidet P-40, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 1 mm EGTA, 1% Triton X-100, 2.5 mm sodium pyrophosphate, 1 mm Na3VO4, 1 mm β-glycerophosphate, and 1 μg/ml leupeptin) on ice for 30 min. The extracts were cleared by centrifugation. Cell lysates were kept at 95 °C for 5 min and then separated by 12% (for cyclin D1 and p21), 10% (for Akt and GSK-3β), or 8% (for Rb) SDS-PAGE. The separated proteins were transferred to the polyvinylidene difluoride membrane (Millipore Co., Bedford, MA). The membrane was treated with 10% (w/v) skim milk in phosphate-buffered saline containing 0.05% Tween 20 overnight at 4 °C and then incubated with primary antibodies followed by peroxidaseconjugated anti-mouse or anti-rabbit IgG (Amersham Biosciences). The epitope was visualized with an ECL Western blot detection kit (American Biosciences). Cell Cycle Analysis by Flow Cytometry—After the fixation with ethanol, the cells were treated with 50 μg/ml propidium iodide (Calbiochem) and analyzed by flow cytometer (FACSCalibur, BD Biosciences) using CELLQUEST software. Northern Blot Analysis—Total RNA was extracted using TRIzol reagent according to the manufacturer's instructions (26Maruyama T. Kitaoka Y. Sachi Y. Nakanoin K. Hirota K. Shiozawa T. Yoshimura Y. Fujii S. Yodoi J. Mol. Hum. Reprod. 1997; 3: 989-993Crossref PubMed Scopus (46) Google Scholar). 10 μg of total RNA was electrophoresed, and transferred to maximum strength Nytran nylon (Schleicher & Schüll) with a Turbo-Blotter system (Schleicher & Schüll). The filter was hybridized with human cyclin D1 cDNA probe. MPP+Suppresses the Cell Growth of p53-deficient MG63 Cells—A previous study showed that dopamine neurons from p53 knock-out mice are resistant to MPTP neurotoxicity (27Trimmer P.A. Smith T.S. Jung A.B. Bennett Jr., J.P. Neurodegeneration. 1996; 5: 233-239Crossref PubMed Scopus (128) Google Scholar), suggesting that MPP+-induced apoptosis is at least partly mediated by p53 (28Duan W. Zhu X. Ladenheim B. Yu Q.S. Guo Z. Oyler J. Cutler R.G. Cadet J.L. Greig N.H. Mattson M.P. Ann. Neurol. 2002; 52: 597-606Crossref PubMed Scopus (191) Google Scholar). To dissect the p53-independent effect of MPP+, we first examined whether MPP+ suppresses the growth of p53-deficient MG63 osteosarcoma cells. As shown in Fig. 1, MPP+ dose-dependently suppressed the cell proliferation. Under this condition no appreciable cell death occurred by the trypan blue exclusion test, which was confirmed by lactate dehydrogenase release assay (data not shown). Thus, MPP+ inhibited the proliferation of MG63 cells without inducing cell death. MPP+Induces G1Arrest in MG63 Cells—To examine the mechanism whereby MPP+ inhibits cell proliferation, the cell cycle was analyzed using a fluorescence-activated cell sorter. The MG63 cells were incubated in DMEM with 0.5% FCS for 48 h to synchronize cells in G0/G1 (Fig. 2A). Then, these cells were incubated in 10% FCS-supplemented medium in the absence or presence of 2 mm MPP+ for 16 h. The cell cycle analysis showed that MPP+ treatment induced accumulation in G1 phase (Fig. 2C), whereas the control treatment markedly increased the population in S phase (Fig. 2B). We next investigated whether the MPP+-induced G1 arrest was accompanied by changes of Rb phosphorylation status (29Muthukkumar S. Sells S.F. Crist S.A. Rangnekar V.M. J. Biol. Chem. 1996; 271: 5733-5740Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). As expected, hypophosphorylated form of Rb increased after MPP+ treatment (Fig. 3A). However, MPP+ did not increase the p21 protein level in p53-deficient MG63 cells (Fig. 3B), suggesting that MPP+ induces p53, p21-independent G1 arrest in MG63 cells. MPP+Down-regulates Cyclin D1 in a Post-transcriptional Mechanism—Cyclins are essential components of cell cycle machinery. During progression through the G1 phase of the cell cycle, two major types of cyclins are required: D-type cyclins and cyclin E. Progression through G1 depends initially on cyclin D-CDK4/6 protein complexes and later on cyclin E-CDK2. D-type cyclins play a crucial role in the progression through the cell cycle (30Sherr C.J. Roberts J.M. Genes Dev. 1999; 13: 1501-1512Crossref PubMed Scopus (5144) Google Scholar), and the down-regulation of cyclin D1 plays an important role in the cell cycle arrest. Therefore, we focused on the change of cyclin D1 expression levels after MPP+ treatment. Although MPP+ suppressed the protein expression of cyclin D1 in dose-dependent and time-dependent manners (Fig. 4, A and B), MPP+ did not decrease the mRNA levels of cyclin D1 (Fig. 4C). These results indicate that the decrease of cyclin D1 levels is regulated by the post-transcriptional mechanism. Furthermore, MG132, a proteasome inhibitor, suppressed the MPP+-induced decrease in the cyclin D1 protein level (Fig. 4D). These results indicate that MPP+-induced down-regulation of cyclin D1 is mediated by the proteasome-dependent signal pathway. MPP+Induces Cyclin D1 Down-regulation Even in Cells Lacking mtDNA—Next, we analyzed the effect of MPP+ on the level of cyclin D1 in a p53-positive neuronal cell line, PC12, and HeLa ρ0 cells lacking mtDNA. MPP+ down-regulated cyclin D1 in PC12, HeLa S3, and HeLa ρ0 cells (Fig. 5, A-C). These results indicate that MPP+ down-regulates cyclin D1 level in various cells and that its effect is independent of the p53 status or mitochondrial function in target cells. PI3K-Akt-GSK-3β Pathway Regulates MPP+-mediated Cyclin D1 Proteolysis—Ubiquitin-proteaseome-dependent degradation of cyclin D1 requires phosphorylation of the protein by GSK-3β, which is phosphorylated and inactivated by Akt (20Diehl J.A. Zindy F. Sherr C.J. Genes Dev. 1997; 11: 957-972Crossref PubMed Scopus (648) Google Scholar). We therefore examined whether the PI3K-Akt-GSK-3β pathway is involved in MPP+-induced degradation of cyclin D1. Using PC12 cells, we demonstrated that MPP+ dephosphorylated Akt and that the pretreatment with nerve growth factor (NGF) rescued the dephosphorylation (Fig. 6A). The phosphorylation of GSK-3β was augmented by the combined treatment with NGF and MPP+ (Fig. 6A). As shown in Fig. 6B, pretreatment with NGF or lithium chloride (LiCl), an inhibitor of GSK-3β in cells (31Stambolic V. Ruel L. Woodgett J.R. Curr. Biol. 1996; 6: 1664-1668Abstract Full Text Full Text PDF PubMed Google Scholar, 32Klein P.S. Melton D.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8455-8459Crossref PubMed Scopus (2085) Google Scholar, 33.Deleted in proofGoogle Scholar) suppressed the MPP+-induced degradation of cyclin D1. It was also confirmed in MG63 cells that LiCl but not KCl inhibited the cyclin D1 degradation caused by MPP+ (Fig. 6C). These results indicate that MPP+ induces the degradation of cyclin D1 through the PI3K-Akt-GSK-3β pathway. In the present study, we showed that MPP+ inhibits cell proliferation with accumulation in G1 phase and hypophosphorylation of Rb in p53-deficient MG63 cells (Figs. 2C and 3A). In general, G1 cell cycle arrest is induced by p53-dependent or p53-independent accumulation of p21, which inhibits and the G1/S transition T. B. Res. 1995; Google Scholar, P. M. D. D. Res. 1994; Google Scholar). Our results indicate that p53 is not with MPP+-induced growth Although it been that MPP+ inhibits the proliferation of PC12 cells by a pathway F. Weller M. Haid S. Beinroth S. Miller S.W. Wullner U. Davis R.E. Dichgans J. Klockgether T. Schulz J.B. Exp. Cell Res. 1999; 250: 75-85Crossref PubMed Scopus (50) Google Scholar), MPP+ did not increase p21 protein levels in MG63 cells (Fig. These results that MPP+ cell proliferation independently of p53 or Cyclin proteolysis is essential for cell cycle progression R. R. Cell. Full Text Full Text PDF PubMed Scopus Google Scholar). of cyclin D1 expression by antisense or the of the G1 phase and suppresses cell proliferation J.R. Mol. Cell. Biol. 1995; PubMed Scopus Google Scholar, J. W. M.J. C.J. Oncogene. 1994; 9: Google Scholar). Although cyclin D1 protein levels were rapidly down-regulated by MPP+ 4 h (Fig. the mRNA level of cyclin D1 did not decrease (Fig. suggesting that the down-regulation of cyclin D1 is regulated by the post-transcriptional mechanism. We showed that the MPP+-induced decrease in cyclin D1 protein levels was suppressed by proteasome MG132 (Fig. or (data not shown). These that MPP+ down-regulates cyclin D1 through the pathway (20Diehl J.A. Zindy F. Sherr C.J. Genes Dev. 1997; 11: 957-972Crossref PubMed Scopus (648) Google Scholar). MPP+ inhibits NADH dehydrogenase in mitochondrial complex I (8Nicklas W.J. Vyas I. Heikkila R.E. Life Sci. 1985; 36: 2503-2508Crossref PubMed Scopus (1092) Google Scholar, 9Ramsay R.R. Salach J.I. Dadgar J. Singer T.P. Biochem. Biophys. Res. Commun. 1986; 135: 269-275Crossref PubMed Scopus (224) Google Scholar, 10Ramsay R.R. Salach J.I. Singer T.P. Biochem. Biophys. Res. Commun. 1986; 134: 743-748Crossref PubMed Scopus (229) Google Scholar). However, we demonstrated that MPP+ down-regulated cyclin D1 in HeLa and HeLa ρ0 cells (Fig. 5, and that the down-regulation of cyclin D1 is not with the inhibition of mitochondrial complex I by MPP+ and that MPP+ an GSK-3β was to cyclin D1 proteolysis (21Diehl J.A. Cheng M. Roussel M.F. Sherr C.J. Genes Dev. 1998; 12: 3499-3511Crossref PubMed Scopus (1861) Google Scholar). We showed that a inhibitor, LiCl, suppressed the MPP+-induced down-regulation of cyclin D1 protein levels (Fig. and suggesting the of the GSK-3β pathway in the down-regulation of cyclin D1. Akt GSK-3β through in the inhibition of cyclin D1 (21Diehl J.A. Cheng M. Roussel M.F. Sherr C.J. Genes Dev. 1998; 12: 3499-3511Crossref PubMed Scopus (1861) Google Scholar). We demonstrated that MPP+ dephosphorylated Akt in PC12 cells and that the down-regulation of cyclin D1 was suppressed by NGF, a of the pathway or by an inhibitor of GSK-3β, LiCl (Fig. A and The results indicate that MPP+ induces cyclin D1 degradation in various cell through Akt and GSK-3β MPTP is a for the Parkinson's disease model (1Langston J.W. Irwin I. Clin. Neuropharmacol. 1986; 9: 485-507Crossref PubMed Scopus (214) Google Scholar, 2Bloem B.R. Irwin I. Buruma O.J. Haan J. Roos R.A. Tetrud J.W. Langston J.W. J. Neurol. Sci. 1990; 97: 273-293Abstract Full Text PDF PubMed Scopus (146) Google Scholar). MPP+ is an active metabolite of MPTP (3Tipton K.F. Singer T.P. J. Neurochem. 1993; 61: 1191-1206Crossref PubMed Scopus (517) Google Scholar), it is important to the mechanism of GSK-3β been in and apoptosis F. P. R. J. J. 2001; 20: PubMed Scopus Google Scholar). The present study demonstrated that MPP+-induced G1 arrest results from the degradation of cyclin D1 through the which a mechanism of MPP+-induced We for on the and Y. for