Muscle Specificity Encoded by Specific Serum Response Factor-binding Sites

Serum response factor (SRF) is a MADS box transcription factor that regulates muscle-specific and growth factor-inducible genes by binding the consensus sequence CC(A/T)6GG, known as a CArG box. Because SRF expression is not restricted solely to muscle, its expression alone cannot account for the muscle specificity of some of its target genes. To understand further the role of SRF in muscle-specific transcription, we created transgenic mice harboring lacZ transgenes linked to tandem copies of different CArG boxes with flanking sequences. CArG boxes from the SM22 and skeletal α-actin promoters directed highly restricted expression in developing smooth, cardiac, and skeletal muscle cells during early embryogenesis. In contrast, the CArG box and flanking sequences from the c-fos promoter directed expression throughout the embryo, with no preference for muscle cells. Systematic swapping of the core and flanking sequences of the SM22 and c-fos CArG boxes revealed that cell type specificity was dictated in large part by sequences immediately flanking the CArG box core. Sequences that directed widespread embryonic expression bound SRF more strongly than those that directed muscle-restricted expression. We conclude that sequence variations among CArG boxes influence cell type specificity of expression and account, at least in part, for the ability of SRF to distinguish between growth factor-inducible and muscle-specific genes in vivo. Serum response factor (SRF) is a MADS box transcription factor that regulates muscle-specific and growth factor-inducible genes by binding the consensus sequence CC(A/T)6GG, known as a CArG box. Because SRF expression is not restricted solely to muscle, its expression alone cannot account for the muscle specificity of some of its target genes. To understand further the role of SRF in muscle-specific transcription, we created transgenic mice harboring lacZ transgenes linked to tandem copies of different CArG boxes with flanking sequences. CArG boxes from the SM22 and skeletal α-actin promoters directed highly restricted expression in developing smooth, cardiac, and skeletal muscle cells during early embryogenesis. In contrast, the CArG box and flanking sequences from the c-fos promoter directed expression throughout the embryo, with no preference for muscle cells. Systematic swapping of the core and flanking sequences of the SM22 and c-fos CArG boxes revealed that cell type specificity was dictated in large part by sequences immediately flanking the CArG box core. Sequences that directed widespread embryonic expression bound SRF more strongly than those that directed muscle-restricted expression. We conclude that sequence variations among CArG boxes influence cell type specificity of expression and account, at least in part, for the ability of SRF to distinguish between growth factor-inducible and muscle-specific genes in vivo. serum response factor muscle creatine kinase serum response element ternary complex factor phosphate-buffered saline base pair The MADS box transcription factor, serum response factor (SRF),1 was first identified on the basis of its ability to confer serum inducibility to the c-fos gene through a sequence known as the serum response element (SRE) (reviewed in Ref. 1Treisman R. EMBO J. 1995; 14: 4905-4913Crossref PubMed Scopus (345) Google Scholar). Paradoxically, SRF also regulates muscle-specific genes, which are expressed specifically in post-mitotic muscle cells, thus representing a gene regulatory program incompatible with expression of growth-regulated genes. Several mechanisms have been shown to regulate SRF activity, including association with positive and negative cofactors (reviewed in Ref. 2Treisman R. Curr. Opin. Genet. & Dev. 1994; 4: 96-101Crossref PubMed Scopus (618) Google Scholar), phosphorylation-dependent changes in DNA binding (3Manak J.R. Prywes R. Mol. Cell. Biol. 1991; 11: 3652-3659Crossref PubMed Scopus (72) Google Scholar), alternative RNA splicing (4Belaguli N.S. Zhou W. Trinh T.-H.T. Majesky M.W. Schwartz R.J. Mol. Cell. Biol. 1999; 19: 4582-4591Crossref PubMed Scopus (86) Google Scholar, 5Kemp P.R. Metcalfe J.C. Biochem. J. 2000; 345: 445-451Crossref PubMed Google Scholar), and regulated nuclear translocation (6Camoretti-Mercado B. Liu H.W. Halayko A.J. Forsythe S.M. Kyle J.W. Li B. Fu Y. McConville J. Kogut P. Vieira J.E. Patel N.M. Hershenson M.B. Fuchs E. Sinha S. Miano J.M. Parmacek M.S. Burkhardt S.K. Solway J. J. Biol. Chem. 2000; 275: 30387-30393Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). However, the exact mechanisms that enable SRF to distinguish between growth factor-inducible and muscle-specific genes have not been fully explained. SRF binds as a homodimer to the DNA consensus sequence CC(A/T)6GG, referred to as a CArG box (7Minty A. Kedes L. Mol. Cell. Biol. 1986; 6: 2125-2136Crossref PubMed Scopus (271) Google Scholar, 8Grichnik J.M. Bergsma D.J. Schwartz R.J. Trans. Contr. Mech. Alan R. Liss, Inc., New York1987: 57-69Google Scholar). CArG boxes are essential for expression of numerous cardiac, skeletal, and smooth muscle-specific genes (9Mohun T. Taylor M. Garrett N. Gurdon J.B. EMBO J. 1989; 8: 1153-1161Crossref PubMed Scopus (91) Google Scholar, 10Walsh K. Mol. Cell. Biol. 1989; 9: 2191-2201Crossref PubMed Scopus (80) Google Scholar, 11Chow K.L. Schwartz R.J. Mol. Cell. Biol. 1990; 10: 528-538Crossref PubMed Google Scholar, 12Boxer L.M. Prywes R. Roeder R.G. Kedes L. Mol. Cell. Biol. 1989; 9: 515-522Crossref PubMed Scopus (116) Google Scholar, 13Lee T. Chow C. Fang K.L. Schwartz R.J. Mol. Cell. Biol. 1991; 11: 5090-5100Crossref PubMed Google Scholar, 14Miwa T. Kedes L. Mol. Cell. Biol. 1987; 7: 2803-2813Crossref PubMed Scopus (106) Google Scholar, 15Bergsma D.J. Grichnik J.M. Gossett L.M.A. Schwartz R.J. Mol. Cell. Biol. 1986; 6: 2462-2475Crossref PubMed Scopus (63) Google Scholar, 16Grichnik J.M. French B.A. Schwartz R.J. Mol. Cell. Biol. 1988; 8: 4587-4597Crossref PubMed Scopus (27) Google Scholar, 17Li L. Liu Z.-C. Mercer B. Overbeek P. Olson E.N. Dev. Biol. 1997; 187: 311-321Crossref PubMed Scopus (144) Google Scholar, 18Kim S. Ip H.S. Lu M.M. Clendenin C. Parmacek M.S. Mol. Cell. Biol. 1997; 17: 2266-2278Crossref PubMed Scopus (189) Google Scholar, 19Katoh Y. Loukianov E. Kopras E. Zilberman A. Periasamy M. J. Biol. Chem. 1994; 269: 30538-30545Abstract Full Text PDF PubMed Google Scholar, 20Obata H. Hayashi K. Nishida W. Momiyama T. Uchida A. Ochi T. Sobue K. J. Biol. Chem. 1997; 272: 26643-26651Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 21Herring B.P. Smith A.F. Am. J. Physiol. 1997; 272: C1394-C1404Crossref PubMed Google Scholar, 22Blank R.S. McQuinn T.C. Yin K.C. Thompson M.M. Takeyasu K. Schwartz R.J. Owens G.K. J. Biol. Chem. 1992; 267: 984-989Abstract Full Text PDF PubMed Google Scholar, 23Mack C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (203) Google Scholar, 24Miano J.M. Carlson M.J. Spencer J.A. Misra R.P. J. Biol. Chem. 2000; 275: 9814-9882Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). During embryogenesis, SRF is highly expressed in muscle cell lineages (25Croissant J.D. Kim J.H. Eichele G. Goering L. Lough J. Prywes R. Schwartz R.J. Dev. Biol. 1996; 177: 250-264Crossref PubMed Scopus (154) Google Scholar, 26Belaguli N.S. Schildmeyer L.A. Schwartz R.J. J. Biol. Chem. 1997; 272: 18222-18231Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 27Vogel A.M. Gerster T. Mech. Dev. 1999; 81: 217-221Crossref PubMed Scopus (10) Google Scholar), but it is not muscle-specific. Thus, SRF expression alone cannot account for the muscle specificity of certain of its target genes. The possibility that cell specificity might be encoded in the sequence of the CArG box itself has been suggested by transfection assays in which CArG boxes from muscle-specific genes were shown to be preferentially active in muscle cells, whereas the c-fos SRE was active in a wider range of cell types (28Santoro I.M. Walsh K. Mol. Cell. Biol. 1991; 11: 6296-6305Crossref PubMed Scopus (26) Google Scholar). However, other studies have concluded that CArG boxes from muscle-specific and serum-inducible genes were functionally interchangeable (29Taylor M. Treisman R. Garrett N. Mohun T. Development. 1989; 106: 67-78Crossref PubMed Google Scholar, 30Tuil D. Clergue N. Montarras D. Pinset C. Kahn A. Tuy F.P.-D. J. Mol. Biol. 1990; 213: 677-686Crossref PubMed Scopus (38) Google Scholar). We and others have examined the role of SRF in the regulation of theSM22 gene. SM22, which encodes a structural protein related to troponin, is expressed specifically in developing smooth, skeletal, and cardiac muscle during embryogenesis, before becoming restricted to smooth muscle postnatally (31Takahashi K. Nadal-Ginard B. J. Biol. Chem. 1991; 266: 13284-13288Abstract Full Text PDF PubMed Google Scholar, 32Solway J. Seltzer J. Samaha F.F. Kim S. Alger L.E. Niu Q. Morrisey E.E. Ip H.S. Parmacek M.S. J. Biol. Chem. 1995; 270: 13460-13469Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 33Li L. Miano J.M. Cserjesi P. Olson E.N. Circ. Res. 1996; 78: 188-195Crossref PubMed Scopus (332) Google Scholar). Transcription of SM22 is controlled by a proximal promoter region that contains two CArG boxes; the more 3′ CArG box (referred to as CArG-near) is essential for promoter activity in transgenic mice (17Li L. Liu Z.-C. Mercer B. Overbeek P. Olson E.N. Dev. Biol. 1997; 187: 311-321Crossref PubMed Scopus (144) Google Scholar, 18Kim S. Ip H.S. Lu M.M. Clendenin C. Parmacek M.S. Mol. Cell. Biol. 1997; 17: 2266-2278Crossref PubMed Scopus (189) Google Scholar, 34Li L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (284) Google Scholar). To understand further the mechanism whereby SRF regulates muscle-specific transcription, we investigated whether CArG boxes from the SM22 and skeletal α-actinpromoters and their immediate flanking sequences were sufficient to direct muscle-specific expression of a lacZ reporter gene in transgenic mouse embryos. We show that these transgenes are expressed specifically in smooth, cardiac, and skeletal muscle during early embryogenesis, in a pattern similar to that of the endogenousSM22 and skeletal α-actin genes. In contrast, a lacZ transgene linked to tandem copies of the c-fos SRE showed widespread embryonic expression. Through creation of chimeric CArG boxes containing different combinations of the SM22 and c-fos core and flanking sequences, we found that sequences immediately surrounding the CArG box specify the expression pattern and that CArG boxes with muscle specificity bind SRF with reduced affinity compared with those that direct ubiquitous expression. These results are consistent with a model in which sequence variations among CArG boxes account for differences in gene expression patterns. Oligonucleotides containing the appropriate CArG box core (10 bp) and flanking sequences (15 bp each side) withHindIII sites on both ends were phosphorylated, phenol-extracted, and annealed. Correct multimers were subcloned into the hsp68lacZ vector (35Kothary R. Clapoff S. Darling S. Perry M.D. Moran L.A. Rossant J. Development. 1989; 105: 707-714Crossref PubMed Google Scholar) for generation of transgenic mice. The number and orientations of the CArG repeats were determined by DNA sequencing. Sequences of top strand oligonucleotides containing HindIIIsites (with CArG boxes underlined) were as follows: SM22, AGCTTACTTGGTGTCTTTCCCCAAATATGGAGCCTGTGTGGAGTGA; skeletal α-actin, AGCTTTCTAGTGCCCGACACCCAAATATGGCTTGGGAAGGGCAGCA; c-fos, AGCTTCTTTACACAGGATGTCCATATTAGGACATCTGCGTCAGCAA; SFS, AGCTTACTTGGTGTCTTTCCCCATATTAGGAGCCTGTGTGGAGTGA; FSF, AGCTTCTTTACACAGGATGTCCAAATATGGACATCTGCGTCAGCAA; FFS, AGCTTCTTTACACAGGATGTCCATATTAGGAGCCTGTGTGGAGTGA; SFF, AGCTTACTTGGTGTCTTTCCCCATATTAGGACATCTGCGTCAGCAA; FSS, AGCTTCTTTACACAGGATGTCCAAATATGGAGCCTGTGTGGAGTGA; and SSF, DNA was and a DNA mice were created by of DNA into and expression was in as J. Olson E.N. J. Cell Biol. 1992; PubMed Scopus Google Scholar). were in in on for with and at in in in were in two in were and for each and in were for in in at and with W. G. 1994; PubMed Scopus Google Scholar). SRF was in with a The SM22, c-fos, and CArG box oligonucleotides for the of the CArG transgenes were as in Sequences of the top strand oligonucleotides (with CArG boxes underlined) for the Res. 1988; PubMed Scopus Google Scholar) and G. Perry M.W. D. T. Olson E.N. Mol. Cell. Biol. 1988; 8: PubMed Scopus Google Scholar) genes were as oligonucleotides were and with and of was for at SRF and in as Olson E.N. Dev. 1990; 4: PubMed Scopus Google Scholar). were with were by on a in DNA was at and DNA binding was determined by the with a and The SM22 promoter is sufficient to direct expression of a lacZ reporter in developing smooth, cardiac, and skeletal muscle cells during mouse studies showed that a CArG box in the proximal referred to as is essential for muscle-specific expression of SM22 (17Li L. Liu Z.-C. Mercer B. Overbeek P. Olson E.N. Dev. Biol. 1997; 187: 311-321Crossref PubMed Scopus (144) Google Scholar). To whether CArG box might be sufficient to confer muscle we created a transgene containing tandem copies of with of flanking sequence on each The CArG boxes were linked in a of reporter of the protein which is in mouse (35Kothary R. Clapoff S. Darling S. Perry M.D. Moran L.A. Rossant J. Development. 1989; 105: 707-714Crossref PubMed Google Scholar). The SM22 element directed expression in a highly restricted pattern in transgenic mouse at expression were in transgenic harboring are shown in B. with the SM22 promoter expression directed by the SM22 CArG box was throughout the and as as in the and in the and to that of the SM22 The SM22 CArG box directed expression at throughout the and of the at is in to the which is active specifically in the L. Miano J.M. Mercer B. Olson E.N. J. Cell Biol. 1996; 132: 849-859Crossref PubMed Scopus (284) Google Scholar). The was also expressed in the region of the the promoter is not was no expression of the transgene of these cell The expression pattern of the transgene is similar to that of which is in muscle cells and the during (25Croissant J.D. Kim J.H. Eichele G. Goering L. Lough J. Prywes R. Schwartz R.J. Dev. Biol. 1996; 177: 250-264Crossref PubMed Scopus (154) Google Scholar, 26Belaguli N.S. Schildmeyer L.A. Schwartz R.J. J. Biol. Chem. 1997; 272: 18222-18231Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 27Vogel A.M. Gerster T. Mech. Dev. 1999; 81: 217-221Crossref PubMed Scopus (10) Google Scholar). To the muscle-restricted activity of the SM22 CArG box a of CArG we examined the expression pattern of the linked to copies of the CArG boxes from the and c-fos the the skeletal α-actin CArG box transgene expression in cardiac, skeletal, and smooth muscle cell as as in the at In to the highly expression of theSM22 and skeletal α-actin CArG the c-fos CArG box directed widespread embryonic expression transgene was expressed in the and but was also throughout the embryo, that the c-fos CArG element was active in a wider range of cell types than the SM22 α-actin CArG The expression pattern of the transgene that the c-fos CArG box is active in cells that SRF at of transgenic harboring the CArG and c-fos CArG box transgenes the differences in their expression patterns. was expressed specifically in the and in harboring the whereas expression was throughout the with transgene We to the DNA sequences for the different of transgene expression directed by the SM22 and c-fos CArG We created chimeric CArG by swapping the core sequences and surrounding of the two CArG copies of these chimeric CArG were linked to reporter and in transgenic at with the SM22, c-fos, α-actin CArG of the CArG were in a CArG box was to the of the core and with to SM22 and to c-fos The number of CArG boxes in each transgene is shown in least transgenic were examined with each shown for the in the expression pattern was similar in different harboring a but the of expression of differences in transgene number sites of We also examined the expression of different transgenes containing between and tandem copies of the different CArG but we no differences in expression pattern for a that the number of copies of CArG boxes not influence the pattern of expression. with each transgene are shown in of CArG harboring the chimeric CArG boxes were for lacZ expression at two transgenic were The number of copies of each CArG box in each transgene and the number of transgenic examined are in a of linked to chimeric CArG transgenic mouse harboring linked to the CArG boxes were for expression. Sequences of the CArG boxes are shown in The of tandem copies of the each CArG box are shown in with the number of transgenic harboring the chimeric CArG boxes were for lacZ expression at two transgenic were The number of copies of each CArG box in each transgene and the number of transgenic examined are The CArG box element SFS, containing the sequences and the c-fos core directed expression in a pattern similar to that of the SM22 CArG box and that the of expression was suggested that the core CArG sequence was not for the specificity of the box expression the CArG box FSF, containing the c-fos flanking sequences and the SM22 core showed a widespread expression of the c-fos CArG box with and was in the The other chimeric SSF, SFF, and directed expression in that to be between the highly pattern with theSM22 CArG and the widespread pattern with the c-fos CArG these that the differences in expression pattern of different CArG element multimers are determined by the flanking on both of the core CArG To whether might be a between DNA binding affinity and expression we assays with in SRF and the different chimeric CArG shown in the element bound SRF more than the SM22 CArG element and in SRF binding to be to the flanking sequences of these CArG the chimeric CArG bound SRF with a reduced affinity similar to that of theSM22 whereas bound SRF the c-fos CArG box. The with flanking sequences SSF, SFF, and showed SRF binding between that of the other CArG The complex in assays was to SRF by with SRF To further the of SRF for theSM22 and c-fos CArG we with each of the chimeric CArG sequences for the SM22 and c-fos CArG from are in B. of SRF to theSM22 CArG was by the and sequences. The and sequences were the least and other chimeric CArG sequences showed to for SRF similar of in for SRF DNA binding by the different CArG sequences was with the c-fos CArG Thus, those CArG sequences that the and directed widespread expression in showed the binding of those CArG sequences that theSM22 flanking and directed muscle-restricted expression in showed binding of The revealed a between of SRF binding and specificity of expression. a further of we examined the binding of SRF to CArG boxes from other muscle-specific and expressed genes α-actin CArG which directed a muscle expression pattern similar to that of SM22 bound SRF the CArG box in the skeletal muscle-specific of the muscle creatine gene also bound SRF In contrast, SRF bound strongly to the CArG box from c-fos, is SRF is of both growth factor-inducible and muscle-specific genes, but the mechanisms whereby SRF between these two of genes, which show different expression are not fully results that different CArG boxes with flanking sequences direct expression during mouse embryogenesis. CArG boxes from the SM22 and promoters direct muscle-restricted transcription, the c-fos SRE widespread embryonic expression. The different of these CArG boxes with their for CArG boxes that direct muscle-restricted expression bind SRF compared with as the c-fos that direct widespread expression. might different CArG boxes for cell type mechanism consistent with results is that CArG boxes with affinity for SRF are to of SRF in a range of cell whereas muscle-specific CArG which reduced affinity for are to the of SRF that in muscle cells as in certain cell to the transgenes with CArG boxes to SRF with different in different expression patterns. with SRF expression is highly in developing muscle cell lineages and in a of during (25Croissant J.D. Kim J.H. Eichele G. Goering L. Lough J. Prywes R. Schwartz R.J. Dev. Biol. 1996; 177: 250-264Crossref PubMed Scopus (154) Google Scholar, 26Belaguli N.S. Schildmeyer L.A. Schwartz R.J. J. Biol. Chem. 1997; 272: 18222-18231Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 27Vogel A.M. Gerster T. Mech. Dev. 1999; 81: 217-221Crossref PubMed Scopus (10) Google Scholar), the expression of the SM22 and skeletal α-actin The possibility that the CArG boxes in transgenes SRF in is also suggested by the in expression pattern with the skeletal α-actin CArG During embryogenesis, the SM22 and skeletal α-actin genes show different expression in developing muscle cell lineages J. Seltzer J. Samaha F.F. Kim S. Alger L.E. Niu Q. Morrisey E.E. Ip H.S. Parmacek M.S. J. Biol. Chem. 1995; 270: 13460-13469Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 33Li L. Miano J.M. Cserjesi P. Olson E.N. Circ. Res. 1996; 78: 188-195Crossref PubMed Scopus (332) Google Scholar, Schwartz R.J. J. Cell Biol. 1988; PubMed Scopus Google Scholar, Development. 1991; PubMed Google Scholar). The that the and skeletal α-actin CArG boxes direct the expression in skeletal, cardiac, and smooth muscle also that SRF is not solely for the expression of those genes. to the first of the of CArG boxes in transgenic mice. However, studies of other CArG boxes in transfection assays have suggested a between affinity DNA binding of SRF and muscle-restricted of the proximal CArG box in the skeletal α-actin promoter with the in expression of the promoter in cells (28Santoro I.M. Walsh K. Mol. Cell. Biol. 1991; 11: 6296-6305Crossref PubMed Scopus (26) Google Scholar). of two CArG boxes from muscle α-actin promoter with the a in expression in cells M.B. C.P. Owens G.K. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). results that different CArG boxes confer cell specificity through differences in affinity for not the of SRF cofactors in are numerous of positive and negative cofactors for SRF transcription through the c-fos SRE by ternary complex factor transcription factor that the immediately of the CArG box A. 1991; PubMed Scopus Google Scholar, H. 1992; PubMed Scopus Google Scholar). binding to the widespread expression with multimers of the c-fos However, the SM22 and skeletal boxes are not by consensus binding it is that a positive role in muscle-specific expression from these sequences. Several cofactors for SRF have also been the cardiac protein and the transcription factor with SRF to certain genes Schwartz R.J. Mol. Cell. Biol. 1996; PubMed Google Scholar, N. M. Schwartz R.J. Mol. Cell. Biol. PubMed Scopus Google Scholar), and have been to with SRF to regulate skeletal muscle genes R. H. P. D. A. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). Because these cofactors with SRF binding to not be to distinguish between different CArG box sequences. However, it is that binding of SRF to CArG boxes might influence its with The protein also with SRF to its affinity for certain CArG boxes S. C. 1992; PubMed Scopus Google Scholar, K. M. Mol. Cell. Biol. 1995; PubMed Scopus Google Scholar) and has been to confer smooth muscle specificity to a CArG box from the smooth muscle α-actin gene M.B. Thompson M.M. Olson E.N. Owens G.K. Circ. Res. 1997; 81: PubMed Scopus (106) Google Scholar). type of to the specificity of CArG expression in certain cell but is expressed in cells the and P. B. L. Y. Olson E.N. Development. 1992; PubMed Google Scholar), it cannot account for the muscle-restricted expression of the SM22 and skeletal α-actin CArG sequences in in the was to the activity of CArG boxes and sequences the of their of of the regulatory that the activity of these sequences in not the of other regulatory that bind sites surrounding the CArG boxes in their is also for complex among CArG boxes with the smooth muscle α-actin gene that in of transcription in muscle cell types C.P. Owens G.K. Circ. Res. 1999; 84: 852-861Crossref PubMed Scopus (203) Google Scholar). Spencer and E. N. in The transgenes in the be of type of which range in In it is to that SRF with the in J. Olson E.N. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar). the SM22 and skeletal α-actin CArG multimers direct a highly restricted expression pattern at and in embryogenesis, these sequences direct more widespread expression during and postnatally not Thus, the mechanisms that regulate the activity of these sequences to during studies concluded that the cardiac α-actin CArG and c-fos SRE were functionally interchangeable in (29Taylor M. Treisman R. Garrett N. Mohun T. Development. 1989; 106: 67-78Crossref PubMed Google Scholar). we transgenic mice harboring binding sites for the MADS box transcription factor which with the DNA binding and of SRF C. J.A. Overbeek P. Olson E.N. Development. 1999; PubMed Google Scholar). During embryogenesis, these mice showed highly expression of in developing muscle and cell lineages C. J.A. Overbeek P. Olson E.N. Development. 1999; PubMed Google the cell types in which is expressed at the transgene was in skeletal and cardiac muscle, of protein in these but it be in response to R. H. N. Overbeek P. J.A. Olson E.N. J. 2000; 105: PubMed Scopus Google Scholar, H. T. Mercer B. R. Olson E.N. R.S. EMBO J. 2000; 19: PubMed Scopus Google Scholar). sites from the which is the which is growth direct similar expression in C. J.A. Overbeek P. Olson E.N. Development. 1999; PubMed Google Scholar). these that SRF and different mechanisms to confer cell type specificity through their target sequences. In the results of the that SRF between different target genes on affinity for CArG binding is to to the specificity of expression of genes in and is to be by and We R. Schwartz for and M. Parmacek for results to We also A. for J. and of for with and of for and