Key points are not available for this paper at this time.
Functional characterization of chemosensory receptors is usually achieved by heterologous expression in mammalian cell lines. However, many chemoreceptor genes, including bitter taste receptors (TAS2Rs), show only marginal cell surface expression. Usually, these problems are circumvented by using chimeric receptors consisting of “export tags” and the receptor sequence itself. It seems likely that chemoreceptor cells express factors for cell surface targeting of native receptor molecules in vivo. For TAS2Rs, however, such factors are still unknown. The present study investigates the influence of RTP and REEP proteins on the functional expression of human TAS2Rs in heterologous cells. We expressed hTAS2Rs in HEK 293T cells and observed dramatic differences in responsiveness to agonist stimulation. By immunocytochemistry we show accumulation of the bitter β-glucopyranoside receptor hTAS2R16 in the Golgi compartment. Coexpression of RTP and REEP proteins changed the responses of some hTAS2Rs upon agonist stimulation, which is likely due to efficient cell surface localization as demonstrated by cell surface biotinylation experiments. The coimmunoprecipitation of hTAS2R16 and RTP3 or RTP4 suggests that the mechanism by which these cofactors influence hTAS2R16 function might involve direct protein-protein interaction. Finally, expression analyses demonstrate RTP and REEP gene expression in human circumvallate papillae and testis, both of which are sites of TAS2R gene expression. Functional characterization of chemosensory receptors is usually achieved by heterologous expression in mammalian cell lines. However, many chemoreceptor genes, including bitter taste receptors (TAS2Rs), show only marginal cell surface expression. Usually, these problems are circumvented by using chimeric receptors consisting of “export tags” and the receptor sequence itself. It seems likely that chemoreceptor cells express factors for cell surface targeting of native receptor molecules in vivo. For TAS2Rs, however, such factors are still unknown. The present study investigates the influence of RTP and REEP proteins on the functional expression of human TAS2Rs in heterologous cells. We expressed hTAS2Rs in HEK 293T cells and observed dramatic differences in responsiveness to agonist stimulation. By immunocytochemistry we show accumulation of the bitter β-glucopyranoside receptor hTAS2R16 in the Golgi compartment. Coexpression of RTP and REEP proteins changed the responses of some hTAS2Rs upon agonist stimulation, which is likely due to efficient cell surface localization as demonstrated by cell surface biotinylation experiments. The coimmunoprecipitation of hTAS2R16 and RTP3 or RTP4 suggests that the mechanism by which these cofactors influence hTAS2R16 function might involve direct protein-protein interaction. Finally, expression analyses demonstrate RTP and REEP gene expression in human circumvallate papillae and testis, both of which are sites of TAS2R gene expression. Humans can detect and distinguish the five basic taste qualities salty, sour, sweet, umami, and bitter (1.Lindemann B. Nature. 2001; 413: 219-225Crossref PubMed Scopus (509) Google Scholar). Gustatory stimuli are detected by taste receptor cells, which are organized in groups of 60-100 cells forming a taste bud. One to multiple taste buds are embedded within morphologically different types of taste papillae distributed over the tongue surface. Each taste bud exhibits a single apical porus exposing the microvilli of the receptor cells to the oral cavity (2.Miller I.J.J. Doty R.L. Handbook of Olfaction and Gustation. Dekker, New York1995: 521-547Google Scholar). The human TAS2R gene family of bitter receptors belongs to the G protein-coupled receptor superfamily and consists of ∼25 members (3.Meyerhof W. Rev. Physiol. Biochem. Pharmacol. 2005; 154: 37-72PubMed Google Scholar). The identification of activating bitter compounds for hTAS2R4, -10, -14, -16, -38, -43, -44, and -47 using functional expression assays revealed that they are tuned to detect many structurally related compounds or even a variety of diverse chemical structures (4.Behrens M. Brockhoff A. Kuhn C. Bufe B. Winnig M. Meyerhof W. Biochem. Biophys. Res. Commun. 2004; 319: 479-485Crossref PubMed Scopus (176) Google Scholar, 5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar, 6.Bufe B. Breslin P.A. Kuhn C. Reed D.R. Tharp C.D. Slack J.P. Kim U.K. Drayna D. Meyerhof W. Curr. Biol. 2005; 15: 322-327Abstract Full Text Full Text PDF PubMed Scopus (538) Google Scholar, 7.Chandrashekar J. Mueller K.L. Hoon M.A. Adler E. Feng L. Guo W. Zuker C.S. Ryba N.J. Cell. 2000; 100: 703-711Abstract Full Text Full Text PDF PubMed Scopus (1067) Google Scholar, 8.Kuhn C. Bufe B. Winnig M. Hofmann T. Frank O. Behrens M. Lewtschenko T. Slack J.P. Ward C.D. Meyerhof W. J. Neurosci. 2004; 24: 10260-10265Crossref PubMed Scopus (285) Google Scholar, 9.Pronin A.N. Tang H. Connor J. Keung W. Chem. Senses. 2004; 29: 583-593Crossref PubMed Scopus (140) Google Scholar). This might explain how humans are able to detect thousands of bitter compounds with only ∼25 hTAS2Rs. Because of insufficient cell surface targeting of native TAS2Rs in heterologous cells (7.Chandrashekar J. Mueller K.L. Hoon M.A. Adler E. Feng L. Guo W. Zuker C.S. Ryba N.J. Cell. 2000; 100: 703-711Abstract Full Text Full Text PDF PubMed Scopus (1067) Google Scholar), which applies to other chemoreceptor families as well (odorant receptors (10.McClintock T.S. Landers T.M. Gimelbrant A.A. Fuller L.Z. Jackson B.A. Jayawickreme C.K. Lerner M.R. Brain Res. Mol. Brain Res. 1997; 48: 270-278Crossref PubMed Scopus (76) Google Scholar), pheromone receptors (V2Rs) (11.Loconto J. Papes F. Chang E. Stowers L. Jones E.P. Takada T. Kumanovics A. Fischer Lindahl K. Dulac C. Cell. 2003; 112: 607-618Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar)), chimeric receptors containing the amino termini of either bovine rhodopsin (7.Chandrashekar J. Mueller K.L. Hoon M.A. Adler E. Feng L. Guo W. Zuker C.S. Ryba N.J. Cell. 2000; 100: 703-711Abstract Full Text Full Text PDF PubMed Scopus (1067) Google Scholar) or rat somatostatin receptor subtype 3 (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar) were used to improve functional expression. Whereas odorant receptors (ORs) 2The abbreviations used are: OR, odorant receptor; RT, reverse transcription; PBS, phosphate-buffered saline; TBS, Tris-buffered saline; HA, hemagglutinin; ER, endoplasmic reticulum.2The abbreviations used are: OR, odorant receptor; RT, reverse transcription; PBS, phosphate-buffered saline; TBS, Tris-buffered saline; HA, hemagglutinin; ER, endoplasmic reticulum. in heterologous cells are retained within the ER (12.Gimelbrant A.A. Stoss T.D. Landers T.M. McClintock T.S. J. Neurochem. 1999; 72: 2301-2311Crossref PubMed Scopus (59) Google Scholar), expression analyses in odora cells, a cell line derived from rat olfactory epithelium (13.Murrell J.R. Hunter D.D. J. Neurosci. 1999; 19: 8260-8270Crossref PubMed Google Scholar), indicates a multistep mechanism for plasma membrane targeting (14.Gimelbrant A.A. Haley S.L. McClintock T.S. J. Biol. Chem. 2001; 276: 7285-7290Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar) probably involving several auxiliary factors. A growing number of diverse proteins involved in cell surface targeting of chemoreceptors is being identified (11.Loconto J. Papes F. Chang E. Stowers L. Jones E.P. Takada T. Kumanovics A. Fischer Lindahl K. Dulac C. Cell. 2003; 112: 607-618Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar, 15.Dwyer N.D. Troemel E.R. Sengupta P. Bargmann C.I. Cell. 1998; 93: 455-466Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 16.Hague C. Uberti M.A. Chen Z. Bush C.F. Jones S.V. Ressler K.J. Hall R.A. Minneman K.P. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 13672-13676Crossref PubMed Scopus (100) Google Scholar, 17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar). The present study investigates the functional expression of hTAS2Rs in HEK 293T cells by calcium imaging experiments, the subcellular distribution of hTAS2R16, and the influence of RTP (receptor transporting protein) and REEP (receptor expression enhancing protein) (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar) coexpression on hTAS2R function and localization. Gene expression of RTP and REEP genes in tissues expressing hTAS2R was analyzed by RT-PCR and in situ hybridization. Generation of Receptor Constructs—A fusion construct coding for the rat somatostatin receptor subtype 3 amino terminus, the hTAS2R16 open reading frame, and a HSV tag (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar) was used to generate the construct sst3-hTAS2R16FLAGhsv. By PCR-mediated recombination (18.Fang G. Weiser B. Visosky A. Moran T. Burger H. Nat. Med. 1999; 5: 239-242Crossref PubMed Scopus (48) Google Scholar) a FLAG epitope was integrated into the second extracellular loop essentially as described before (19.Behrens M. Bufe B. Schmale H. Meyerhof W. Cell. Mol. Life Sci. 2004; 61: 2866-2877Crossref PubMed Scopus (12) Google Scholar). The amino-terminal subfragment was generated using a forward primer corresponding to a sequence of the cytomegalovirus promoter of the vector and oligonucleotide A (5′-CTTGTCATCGTCATCCTTGTAGTCAGTTACAGTGCTG-3′). The carboxyl-terminal subfragment was amplified with a primer specific for the BGH poly(A) site of the vector and oligonucleotide B (5′-GACTACAAGGATGACGATGACAAGTATCAGTTCCAGGC-3′). The subfragments were fused by PCR, and the resulting hTAS2R16 sequence showing an exchange of amino acids 168-175 (DKLENFHQ to DYDDDDK) was cloned into the vector pcDNA5FRT (Invitrogen). Subsequently, the rat sst3 amino terminus was removed by PCR with oligonucleotide C (5′-GGCCAATTGGAATTCGCCACCATGATACCCATCCAACTCACTGTCTTCT-3′), followed by subcloning into the same vector. This construct was named hTAS2R16FLAG-hsv. Preparation of rat sst3 tag-free hTAS2R10, hTAS2R14, hTAS2R38, and hTAS2R43 was done accordingly. Forward primer sequences were (5′ to 3′): hTAS2R10, TCTGAATTCCACCATGCTACGTGTAGTGGAAGG; hTAS2R14, TCTGAATTCCACCATGGGTGGTGTCATAAAGAG; hTAS2R38, TCTGAATTCCACCATGTTGACTCTAACTCGCATC; and hTAS2R43, TCTGAATTCCACCATGATAACTTTTCTACCCATC. cDNA Cloning of Human RTP1-4 and REEP1-6—The coding sequences of human RTP and REEP cDNAs were cloned by RT-PCR from RNA of brain (RTP1, REEP1-3), fungiform papillae (REEP4-5), spleen (RTP4), and testis and RNA from fungiform papillae was from using the other were from cDNA was done as before M. G. Reed J. Neurosci. 2000; PubMed Scopus Google Scholar). sequences (5′ to are and calcium imaging were done as before (4.Behrens M. Brockhoff A. Kuhn C. Bufe B. Winnig M. Meyerhof W. Biochem. Biophys. Res. Commun. 2004; 319: 479-485Crossref PubMed Scopus (176) Google Scholar, 6.Bufe B. Breslin P.A. Kuhn C. Reed D.R. Tharp C.D. Slack J.P. Kim U.K. Drayna D. Meyerhof W. Curr. Biol. 2005; 15: 322-327Abstract Full Text Full Text PDF PubMed Scopus (538) Google Scholar, 8.Kuhn C. Bufe B. Winnig M. Hofmann T. Frank O. Behrens M. Lewtschenko T. Slack J.P. Ward C.D. Meyerhof W. J. Neurosci. 2004; 24: 10260-10265Crossref PubMed Scopus (285) Google Scholar, M. Bufe B. Meyerhof W. Neurosci. 2005; PubMed Scopus Google Scholar). HEK 293T cells expressing the G T. S. H. S. J. Neurosci. 2003; PubMed Google Scholar) were with taste receptors and before the functional Each well of the of in corresponding to of hTAS2R construct and of construct the human taste receptor is a of of and of the For were with an of the corresponding vector. the cells were with hTAS2R16, (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google hTAS2R14, (4.Behrens M. Brockhoff A. Kuhn C. Bufe B. Winnig M. Meyerhof W. Biochem. Biophys. Res. Commun. 2004; 319: 479-485Crossref PubMed Scopus (176) Google hTAS2R38, B. Breslin P.A. Kuhn C. Reed D.R. Tharp C.D. Slack J.P. Kim U.K. Drayna D. Meyerhof W. Curr. Biol. 2005; 15: 322-327Abstract Full Text Full Text PDF PubMed Scopus (538) Google hTAS2R43, C. Bufe B. Winnig M. Hofmann T. Frank O. Behrens M. Lewtschenko T. Slack J.P. Ward C.D. Meyerhof W. J. Neurosci. 2004; 24: 10260-10265Crossref PubMed Scopus (285) Google M. Bufe B. Meyerhof W. Neurosci. 2005; PubMed Scopus Google Scholar)), and in were of hTAS2R16 with RTP3 and RTP4 expression were in and experiments. The cells were with 3 and For agonist of with a single was in The cells were with and (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar). Because of observed in cells with and these responses were immunocytochemistry of and subcellular proteins HEK cells were some were with A for to of Golgi before The cells were with and for with in with TBS, the cells were by in The cells were with and with in for before from from from were in and on the cells. the the cells were with TBS, with and for with from from in Finally, with and a with were before the were using a were using a The for to the and for to For of with RTP3 and the cDNAs of RTP3 and RTP4 were fused with amino-terminal by PCR using the and in with a primer specific for the BGH poly(A) site of the vector. The resulting PCR were into the pcDNA5FRT vector. and of HEK cells were done as the cells were and with with was done as of the of receptor proteins present the plasma membrane in the or of RTP biotinylation were HEK 293T cells were either with or in with RTP3 and the cells were with and on for before in was and on the cells for The cells were with to the a second with PBS, was and the cells were the and using a for on the were for to of the were using a For of the of and of were to of the cell and were five with of containing were as before were in and to for and of receptors was as described for the coimmunoprecipitation analyses of and hTAS2R were essentially done as before M. G. Reed J. Neurosci. 2000; PubMed Scopus Google Scholar). sequences (5′ to and of cDNA was done using the same of as used for cDNA of human circumvallate papillae from were used for in situ analyses with RTP3 and RTP4 The and to of the human RTP3 cDNA and to of the human RTP4 situ was as described before M. G. Reed J. Neurosci. 2000; PubMed Scopus Google Scholar), for the of the A which to of the carboxyl-terminal HSV tag was by an FLAG tag to improve of the receptor HEK cells were with and or cells were and the proteins were the cells were on in a containing A using a of on the cell was removed by of were by and of was to using either or with TBS, proteins were for with a the were to and was to a of the were to for and to and to of FLAG and was done using to and with to in with Functional of the of hTAS2R16 function in heterologous cells on the of we functional calcium imaging with hTAS2R16FLAG-hsv. The by cells with different of the agonist demonstrate the different responsiveness of both receptor with the construct is However, agonist to of showing that the receptor is The for with is with the construct of the for the responsiveness of we analyses using for subcellular proteins in with of receptor HEK 293T cells of with the D. D. D. J. Biol. Chem. Full Text PDF PubMed Google Scholar) The of of the receptor with a for O. H. J. J.P. E.P. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), as observed for the human receptor or receptors M. C. J. Neurosci. 2004; 24: PubMed Scopus Google Scholar, B. Mol. Pharmacol. 2004; PubMed Scopus Google Scholar) as the for the localization of the receptor we used for the Golgi is a for the C. T. P. G. J. Biol. PubMed Scopus Google Scholar), the is with the P.A. P. E. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). and and that the receptor within the Golgi compartment. The of cells with or are and we the cells to A This to a of and into the ER, the with J. L. C. M. L. Cell. Full Text PDF PubMed Scopus Google Scholar, Cell. Full Text PDF PubMed Scopus Google Scholar). A in the of and of the cells still show an both The receptor and A in of the cells, that hTAS2R16 within the compartment. The of from the of demonstrate the of of in of in was that members of the RTP and REEP gene families improve cell surface expression of (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar). By RT-PCR of a human which is a site of bitter receptor gene expression (4.Behrens M. Brockhoff A. Kuhn C. Bufe B. Winnig M. Meyerhof W. Biochem. Biophys. Res. Commun. 2004; 319: 479-485Crossref PubMed Scopus (176) Google Scholar, 5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar, 6.Bufe B. Breslin P.A. Kuhn C. Reed D.R. Tharp C.D. Slack J.P. Kim U.K. Drayna D. Meyerhof W. Curr. Biol. 2005; 15: 322-327Abstract Full Text Full Text PDF PubMed Scopus (538) Google Scholar, 8.Kuhn C. Bufe B. Winnig M. Hofmann T. Frank O. Behrens M. Lewtschenko T. Slack J.P. Ward C.D. Meyerhof W. J. Neurosci. 2004; 24: 10260-10265Crossref PubMed Scopus (285) Google Scholar), we detected expression of and RTP4 and REEP genes expressing hTAS2R genes is testis, we analyzed for hTAS2R14, -16, and to RTP1-4 and and genes are expressed in testis The of analyzed hTAS2R in testis suggests for these receptors from function in bitter Coexpression of hTAS2Rs and factors in the tissues analyzed indicates a of the corresponding By in situ with specific for RTP3 and RTP4 cells within or to taste buds are in The the and the of these cells that they might cells. Functional hTAS2Rs and Human RTP and REEP proteins improve functional heterologous expression of hTAS2R we calcium imaging experiments. The of HEK cells with either hTAS2R14, hTAS2R43, or the taste receptor G. Hoon M.A. J. Ryba N.J. Zuker C.S. Cell. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar) and followed by calcium imaging is in Whereas for bitter taste receptors differences in the responses agonist were observed upon with the taste receptor was an with hTAS2Rs of the five bitter taste receptors and hTAS2R43 responses and and were The hTAS2R16 is corresponding well to expression of with RTP3 and RTP4 in a in which demonstrated to function (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar), only a of the REEP responsiveness the responses even of the of the receptor or in with of the or revealed that and are by RTP and REEP Whereas the of cells with and RTP3 is for the receptor and in human (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar), the other were RTP4 RTP3 and the observed over a a activating were observed for the of hTAS2R43 only responsiveness to agonist The of for the receptor and with and in and these are to they from for the receptor C. Bufe B. Winnig M. Hofmann T. Frank O. Behrens M. Lewtschenko T. Slack J.P. Ward C.D. Meyerhof W. J. Neurosci. 2004; 24: 10260-10265Crossref PubMed Scopus (285) Google Scholar). to and hTAS2R38, to with RTP and REEP The however, that from the (4.Behrens M. Brockhoff A. Kuhn C. Bufe B. Winnig M. Meyerhof W. Biochem. Biophys. Res. Commun. 2004; 319: 479-485Crossref PubMed Scopus (176) Google Scholar). and by RT-PCR analyses some REEP are present in HEK 293T cells, only the of function the observed for single proteins by and factors. The taste receptor is by of the RTP or REEP proteins as by and for Functional hTAS2R16 and the mechanism by which RTP3 and RTP4 hTAS2R we immunocytochemistry of HEK 293T cells with RTP3 or RTP4 and hTAS2R16FLAG-hsv. of cells with RTP3 and a both proteins the distribution of RTP3 is can for cells with RTP4 and both to demonstrate that both RTP3 and RTP4 with hTAS2R16 multiple the of are observed in containing of hTAS2R16 cells, that of “export hTAS2R16 The by coimmunoprecipitation with and with by and the different of for hTAS2R16 and RTP3 on and hTAS2R16 and RTP4 on the other well to the of the A in cell surface expression of hTAS2R16 by coexpression is demonstrated by cell surface biotinylation the was used to cell surface proteins of cells with and cells that with the receptor and The of proteins was by using and followed by to detect the revealed RTP3 and RTP4 the of hTAS2R16 the cell surface by and of with either RTP3 or RTP4 and with the different and that the agonist of is by coexpression of the receptor with RTP3 and the present study we identified members of the RTP and REEP gene families as cofactors for functional expression of some bitter taste hTAS2Rs problems with as for (14.Gimelbrant A.A. Haley S.L. McClintock T.S. J. Biol. Chem. 2001; 276: 7285-7290Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar), we expressed hTAS2R16, a receptor specific for bitter (5.Bufe B. Hofmann T. Krautwurst D. Raguse J.D. Meyerhof W. Nat. Genet. 2002; 32: 397-401Crossref PubMed Scopus (348) Google Scholar), tag in HEK 293T cells. We observed a responsiveness to and by with subcellular we the of receptor proteins within the compartment. Whereas the ER is for and of the is to of proteins that the ER C. A. P.A. Biophys. Mol. Biol. 2003; PubMed Scopus Google Scholar). hTAS2R16, which the and even the plasma membrane to a as by functional responses to from from demonstrated that the cell surface targeting for functional expression can by coexpression of and (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar). proteins of the same gene families influence taste receptor we coexpression using different hTAS2R and hTAS2R43 responses upon agonist expressed hTAS2R16 on coexpression with either RTP3 or hTAS2R43 responsiveness seems by the of an tag with hTAS2R16, RTP3 hTAS2R43 the of these molecules as auxiliary factors for the functional expression of some bitter taste The receptors and expressed in coexpression with by RT-PCR analyses some REEP are present in HEK 293T cells, only the of function observed for single proteins by and factors. It that receptors on different cofactors for functional a observed for other chemoreceptors as well (14.Gimelbrant A.A. Haley S.L. McClintock T.S. J. Biol. Chem. 2001; 276: 7285-7290Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 16.Hague C. Uberti M.A. Chen Z. Bush C.F. Jones S.V. Ressler K.J. Hall R.A. Minneman K.P. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 13672-13676Crossref PubMed Scopus (100) Google Scholar, 17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar). that testis, and HEK 293T cells express several genes the of these genes are cell factors for functional hTAS2R gene expression. TAS2R gene expression is to and S.V. M. J. E. Proc. Natl. Acad. Sci. U. S. A. 2002; PubMed Scopus Google and B. A. H. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: PubMed Scopus Google Scholar), which for gene of and human expressed sequence tag revealed a expression of RTP3 and and RTP4 testis, and A expression is for several REEP This indicates that some of these factors might in of a for receptor expression in a variety of tissues and cells. in situ analyses of human circumvallate papillae revealed expression of RTP3 and RTP4 within a cell that to cells. cells to taste receptor cells, which are the R.L. J. Biol. PubMed Scopus Google Scholar). This a hTAS2R expression might RTP3 RTP4 are The by which functional expression of chemoreceptors is achieved might as different as the molecules identified for demonstrated for hTAS2R16 with RTP3 and RTP4 both factors with the receptor and improve hTAS2R16 plasma membrane localization. the other the in agonist of cells with hTAS2R16 and RTP3 indicates a different of RTP3 and RTP4 of hTAS2R16 with RTP3 and demonstrate that receptor and auxiliary factors This observed by (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar) for with or and might the of by which proteins improve chemoreceptor Because different chemoreceptors expressed in heterologous cells subcellular from ER to plasma membrane the of the expression of receptors and auxiliary factors might as for functional as of to the functional of RTP and REEP proteins for (17.Saito H. Kubota M. Roberts R.W. Chi Q. Matsunami H. Cell. 2004; 119: 679-691Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar), several for with hTAS2Rs The identified auxiliary factors might function and in the of the The receptor able to the cell surface to specific The receptor or of a to the receptor the with the to to the plasma for some human RTP and REEP proteins the J. Biol. Chem. Full Text PDF PubMed Google Scholar) are by of the an targeting within the receptor or a The might to the same within which the receptor is and a for This direct the receptor and the auxiliary the a study on the mechanism by which the plasma membrane localization of hTAS2Rs is and on the the different identified factors to how the function of bitter taste receptors is achieved in vivo. We B. Bufe for bitter taste receptor expression and U. Lerner for
Behrens et al. (Wed,) studied this question.