CCAAT/Enhancer-binding Proteins Are Mediators in the Protein Kinase A-dependent Activation of the Decidual Prolactin Promoter

In the course of decidualization, human endometrial stromal cells (ESC) activate the alternative upstream promoter of the decidual prolactin (dPRL) gene. The dPRL promoter is induced by the protein kinase A pathway in a delayed fashion via the region −332/−270 which contains two overlapping consensus binding sequences, B and D, for CCAAT/enhancer-binding proteins (C/EBP). Here we show that sites B and D both bind C/EBPβ and -δ from ESC nuclear extracts. When decidualization of cultured ESC was induced by treatment with 8-Br-cAMP, complex formation on sites B and D was enhanced. Western blot analysis revealed an elevation of both C/EBPβ isoforms, liver-enriched activator protein and liver-enriched inhibitory protein, with a delayed onset between 8 and 24 h of cAMP treatment, while C/EBPδ expression remained unaffected. Cyclic AMP-mediated activation of dPRL promoter construct dPRL-332/luc3 was abrogated by mutation of sites B and D at −310/−285. An expression vector for liver-enriched activator protein potently induced transcription of dPRL-332/luc3 and further enhanced cAMP-mediated induction, while liver-enriched inhibitory protein expression vector abolished the cAMP response, implying that C/EBPs serve as mediators in the delayed cAMP signal transduction to the dPRL promoter. The ratio between activating and repressing isoforms is likely to dictate the transcriptional output. In the course of decidualization, human endometrial stromal cells (ESC) activate the alternative upstream promoter of the decidual prolactin (dPRL) gene. The dPRL promoter is induced by the protein kinase A pathway in a delayed fashion via the region −332/−270 which contains two overlapping consensus binding sequences, B and D, for CCAAT/enhancer-binding proteins (C/EBP). Here we show that sites B and D both bind C/EBPβ and -δ from ESC nuclear extracts. When decidualization of cultured ESC was induced by treatment with 8-Br-cAMP, complex formation on sites B and D was enhanced. Western blot analysis revealed an elevation of both C/EBPβ isoforms, liver-enriched activator protein and liver-enriched inhibitory protein, with a delayed onset between 8 and 24 h of cAMP treatment, while C/EBPδ expression remained unaffected. Cyclic AMP-mediated activation of dPRL promoter construct dPRL-332/luc3 was abrogated by mutation of sites B and D at −310/−285. An expression vector for liver-enriched activator protein potently induced transcription of dPRL-332/luc3 and further enhanced cAMP-mediated induction, while liver-enriched inhibitory protein expression vector abolished the cAMP response, implying that C/EBPs serve as mediators in the delayed cAMP signal transduction to the dPRL promoter. The ratio between activating and repressing isoforms is likely to dictate the transcriptional output. endometrial stromal cells prolactin decidual PRL cyclic AMP response element CRE-like element CCAAT/enhancer-binding protein liver-enriched activator protein liver-enriched inhibitory protein electrophoretic mobility shift assay activation domain DNA-binding domain protein kinase A CRE-binding protein interleukin activation domain reverse transcriptase-polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase Decidualization is a differentiation process of the endometrium in preparation for blastocyst implantation. In humans this process is independent of the presence of a blastocyst and is first apparent in the stromal cells surrounding the spiral arteries in the second half of the luteal phase. The key stimulus for decidualization in vivo is progesterone acting on an estrogen-primed uterus, however, in vitro in cultured endometrial stromal cells (ESC),1 progesterone only acts as a weak inducer of decidualization (1Daly D.C. Maslar I.A. Riddick D.H. Am. J. Obstet. Gynecol. 1983; 145: 672-678Abstract Full Text PDF PubMed Scopus (122) Google Scholar). Its action is synergistically enhanced by a number of factors such as prostaglandin E2, corticotropin releasing factor, and gonadotropin free α-subunit (2Frank G.R. Brar A.K. Cedars M.I. Handwerger S. Endocrinology. 1994; 134 (ss): 258-263Crossref PubMed Scopus (116) Google Scholar, 3Ferrari A. Petraglia F. Gurpide E. J. Steroid Biochem. Mol. Biol. 1995; 54: 251-255Crossref PubMed Scopus (94) Google Scholar, 4Nemansky M. Moy E. Lyons C.D., Yu, I. Blithe D.L. J. Clin. Endocrinol. Metab. 1998; 83: 575-581Crossref PubMed Scopus (34) Google Scholar). In fact, in vitro decidualization of ESC can be triggered in the absence of progesterone by agents that elevate intracellular cAMP levels, including gonadotropins, relaxin, or cAMP analogs (3Ferrari A. Petraglia F. Gurpide E. J. Steroid Biochem. Mol. Biol. 1995; 54: 251-255Crossref PubMed Scopus (94) Google Scholar, 5Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1993; 47: 115-121Crossref PubMed Scopus (124) Google Scholar, 6Huang J.R. Tseng L. Bischof P. Jänne O.A. Endocrinology. 1987; 121: 2011-2017Crossref PubMed Scopus (190) Google Scholar, 7Zhu H.H. Huang J.R. Mazella J. Rosenberg M. Tseng L. J. Clin. Endocrinol. Metab. 1990; 71: 889-899Crossref PubMed Scopus (68) Google Scholar, 8Tabanelli S. Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1992; 42: 337-344Crossref PubMed Scopus (127) Google Scholar, 9Tang B. Guller S. Gurpide E. Endocrinology. 1993; 133: 2197-2203Crossref PubMed Scopus (88) Google Scholar). Induction of prolactin (PRL) gene expression serves as a decidualization marker in human ESC (8Tabanelli S. Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1992; 42: 337-344Crossref PubMed Scopus (127) Google Scholar, 10Irwin J.C. Kirk D. King R.J.B. Quigley M.M. Gwatkin R.B.L. Fertil. Steril. 1989; 52: 761-768Abstract Full Text PDF PubMed Scopus (246) Google Scholar). PRL expressed in the human endometrium is referred to as decidual PRL (dPRL) to distinguish it from pituitary-derived PRL. Transcription of the human PRL gene is driven by two alternative tissue-specific promoters, the dPRL promoter being located approximately 5.7 kilobases upstream of the pituitary promoter at an additional non-coding exon 1A (11DiMattia G.E. Gellersen B. Duckworth M.L. Friesen H.G. J. Biol. Chem. 1990; 265: 16412-16421Abstract Full Text PDF PubMed Google Scholar, 12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (228) Google Scholar, 13Berwaer M. Martial J.A. Davis J.R.E. Mol. Endocrinol. 1994; 8: 635-642Crossref PubMed Scopus (119) Google Scholar). Utilization of the dPRL promoter has been detected in decidualized endometrial stroma, in myometrial smooth muscle cells, and in hematopoietic cells (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (228) Google Scholar, 13Berwaer M. Martial J.A. Davis J.R.E. Mol. Endocrinol. 1994; 8: 635-642Crossref PubMed Scopus (119) Google Scholar, 14Gellersen B. Bonhoff A. Hunt N. Bohnet H.G. Endocrinology. 1991; 129: 158-168Crossref PubMed Scopus (65) Google Scholar, 15Pellegrini I. Lebrun J.J. Ali S. Kelly P.A. Mol. Endocrinol. 1992; 6: 1023-1031Crossref PubMed Scopus (229) Google Scholar), and is specific to humans and primates (16Brown N.A. Bethea C.L. Biol. Reprod. 1994; 50: 543-552Crossref PubMed Scopus (14) Google Scholar). Little is known about the molecular mechanisms governing dPRL promoter control. Cyclic AMP, which is a major decidualization stimulus in vitro, also controls dPRL gene transcription (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (228) Google Scholar). We have shown previously that the cAMP response of the transfected dPRL promoter in ESC occurs in two phases. An early weak induction, mediated by an imperfect cAMP response element (CRE-L) at position −12 relative to the major transcriptional start site, is detectable within 6 h of treatment with 8-Br-cAMP. This is followed by a delayed strong induction which sets in after 12–18 h of stimulation and is dependent on the dPRL promoter region −332/−270 (17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Mutation of the CRE-L abolishes the early, but not the delayed cAMP-mediated induction of promoter activity (17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Computerized search for transcription factor binding sequences revealed two consensus sites for members of the CCAAT/enhancer-binding protein (C/EBP) family in the dPRL-332/-270 promoter fragment. C/EBP factors belong to the superfamily of basic region/leucine zipper DNA-binding proteins (18Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2796) Google Scholar). So far, six members of the C/EBP family have been described: C/EBPα, -β, -δ, -ε, -γ and -ζ (reviewed in Ref. 19Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Abstract Full Text Full Text PDF PubMed Scopus (694) Google Scholar). C/EBPα, -β, and -δ are found in liver, adipose tissue, intestine, lung, cells of the inflammatory system, and in reproductive tissues, while C/EBPε is restricted to myeloid and lymphoid lineages (19Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Abstract Full Text Full Text PDF PubMed Scopus (694) Google Scholar, 20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (348) Google Scholar, 21Seagroves T.N. Krnacik S. Raught B. Gay J. Burgess-Beusse B. Darlington G.J. Rosen J.M. Genes Dev. 1998; 12: 1917-1928Crossref PubMed Scopus (220) Google Scholar, 22Robinson G.W. Johnson P.F. Hennighausen L. Sterneck E. Genes Dev. 1998; 12: 1907-1916Crossref PubMed Scopus (225) Google Scholar, 23Raught B. Warren S.-L.L. Rosen J.M. Mol. Endocrinol. 1995; 9: 1223-1232PubMed Google Scholar, 24Pall M. Hellberg P. Brännström M. Mikuni M. Peterson C.M. Sundfeldt K. Nordén B. Hedin L. Enerbäck S. EMBO J. 1997; 16: 5273-5279Crossref PubMed Scopus (52) Google Scholar, 25Sirois J. Richards J.S. J. Biol. Chem. 1993; 268: 21931-21938Abstract Full Text PDF PubMed Google Scholar, 26Grønning L.M. Dahle M.K. Taskén K.A. Enerbäck S. Hedin L. Taskén K. Knutsen H.K. Endocrinology. 1999; 140: 835-843Crossref PubMed Scopus (0) Google Scholar, 27Chumakov A.M. Grillier I. Chumakova E. Chih D. Slater J. Koeffler H.P. Mol. Cell. Biol. 1997; 17: 1375-1386Crossref PubMed Google Scholar). Specificity of gene control by C/EBPs is ensured through their ability to homo- and heterodimerize and to interact with other transcription factors, together with cell-specific and temporal expression patterns and different transactivation potentials (28Yeh W.-C. Cao Z. Classon M. McKnight S.L. Genes Dev. 1995; 9: 168-181Crossref PubMed Scopus (820) Google Scholar, 29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (268) Google Scholar, 30Roesler W.J. Park E.A. McFie P.J. J. Biol. Chem. 1998; 273: 14950-14957Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 31Chang C.J. Chen Y.L. Lee S.C. Mol. Cell. Biol. 1998; 18: 5880-5887Crossref PubMed Google Scholar, 32Lu M. Seufert J. Habener J.F. J. Biol. Chem. 1997; 272: 28349-28359Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 33Lee Y.-H. Williams S.C. Baer M. Sterneck E. Gonzalez F.J. Johnson P.F. Mol. Cell. Biol. 1997; 17: 2038-2047Crossref PubMed Google Scholar, 34McNagny K.M. Sieweke M.H. Doderlein G. Graf T. Nerlov C. EMBO J. 1998; 17: 3669-3680Crossref PubMed Scopus (107) Google Scholar, 35Chen P.-L. Riley D.J. Chen-Kiang S. Lee W.-H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 465-469Crossref PubMed Scopus (201) Google Scholar, 36Miau L.H. Chang C.J. Tsai W.H. Lee S.C. Mol. Cell. Biol. 1997; 17: 230-239Crossref PubMed Scopus (60) Google Scholar, 37Nerlov C. Ziff E.B. EMBO J. 1995; 14: 4318-4328Crossref PubMed Scopus (135) Google Scholar). C/EBPβ was originally identified as a mediator of interleukin-6 (IL6) signaling and is therefore also known as NF-IL6 (38Akira S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1219) Google Scholar, 39Poli V. J. Biol. Chem. 1998; 273: 29279-29282Abstract Full Text Full Text PDF PubMed Scopus (569) Google Scholar). The related factor C/EBPδ is occasionally designated NF-IL6β (29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (268) Google Scholar). From the single C/EBPβ mRNA, protein isoforms with different functions can be generated by a leaky ribosomal scanning mechanism involving three methionine residues in the intronless C/EBPβ gene, Met1, Met24, and Met199. Proteins initiated at Met1 or Met24 have a calculated molecular mass of about 36 and 33.5 kDa and are referred to as LAP (liver-enriched activator protein) whereas translation initiation at Met199results in the 16-kDa isoform LIP (liver-enriched inhibitory protein) which lacks the transactivation domain of the longer forms. LIP readily heterodimerizes with LAP, counteracting its activation potential in substoichiometric amounts and therefore acts as a potent repressor (40Descombes P. Schibler U. Cell. 1991; 67: 569-579Abstract Full Text PDF PubMed Scopus (886) Google Scholar). Several lines of evidence indicate an important role for C/EBPs as mediators of hormonal signals in reproductive tissues. C/EBPβ is regulated by gonadotropins in the ovary and testis (20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (348) Google Scholar, 24Pall M. Hellberg P. Brännström M. Mikuni M. Peterson C.M. Sundfeldt K. Nordén B. Hedin L. Enerbäck S. EMBO J. 1997; 16: 5273-5279Crossref PubMed Scopus (52) Google Scholar, 25Sirois J. Richards J.S. J. Biol. Chem. 1993; 268: 21931-21938Abstract Full Text PDF PubMed Google Scholar, 26Grønning L.M. Dahle M.K. Taskén K.A. Enerbäck S. Hedin L. Taskén K. Knutsen H.K. Endocrinology. 1999; 140: 835-843Crossref PubMed Scopus (0) Google Scholar, 41Nalbant D. Williams S.C. Stocco D.M. Khan S.A. Endocrinology. 1998; 139: 272-279Crossref PubMed Scopus (75) Google Scholar). Deletion of the C/EBPβ gene in female mice leads to sterility, caused by the inability to form corpora lutea (20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (348) Google Scholar). C/EBPβ is also an essential factor for mammary gland differentiation and proliferation (21Seagroves T.N. Krnacik S. Raught B. Gay J. Burgess-Beusse B. Darlington G.J. Rosen J.M. Genes Dev. 1998; 12: 1917-1928Crossref PubMed Scopus (220) Google Scholar, 22Robinson G.W. Johnson P.F. Hennighausen L. Sterneck E. Genes Dev. 1998; 12: 1907-1916Crossref PubMed Scopus (225) Google Scholar). In this study we demonstrate for the first time the presence of C/EBP transcription factors in human endometrial stroma, an interaction between C/EBP family members and the dPRL promoter, and their involvement in cAMP-induced dPRL gene expression. Primary cultures of purified human ESC were prepared and maintained as described previously (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (228) Google Scholar, 17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Cells of the first passage were used for transfections and for extraction of nuclear and cytoplasmic protein and RNA. Primary cultures of myometrial smooth muscle cells were prepared as detailed elsewhere (42Bonhoff A. Gellersen B. Endocrine. 1996; 5: 241-246Crossref PubMed Google Scholar) and maintained in Dulbecco's modified Eagle's medium/Ham's F-12, 10% fetal calf serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 10−9m 17 β-estradiol. COS-7 cells were kept in the same medium but without estradiol. Transient transfections were performed by the calcium phosphate precipitation method for ESC and myometrial cells and with DOTAP reagent (Roche Molecular Biochemicals) for COS-7 cells overnight as described previously (43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar) in triplicates using 12-well dishes if not indicated otherwise, or 24-well dishes. Medium was replaced the next morning and 0.5 mm 8-Br-cAMP (Biolog, Bremen, Germany) added for stimulation experiments. Cell harvest was performed for ESC and myometrial cultures 48 h and for COS-7 cells 24 h after medium replacement. Luciferase activity was measured with the luciferase reagent kit (Promega) and expressed as relative light units. Transfections were repeated at least three times, and representative experiments are shown (mean ± S.D.). Nuclear and cytoplasmic protein extracts were prepared as described by Schreiber et al. (43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar, 44Schreiber E. Matthias P. Müller M.M. Schaffner W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3968) Google Scholar) with minor modifications and protein concentrations were determined using the DC protein detection kit (Bio-Rad). For RNA isolation the method developed by Gough (45Gough M.N. Anal. Biochem. 1988; 173: 93-95Crossref PubMed Scopus (391) Google Scholar) was applied, using the cytosolic lysate generated during protein extraction as the source. Rabbit antisera against rat C/EBPα (numbers 6 and 247) were kindly provided by Dr. Steve McKnight (University of Texas Southwestern Medical Center, Dallas, TX) and diluted 1:10 for use as a working stock solution. Rabbit antibodies raised against rat C/EBPβ and human C/EBPδ (0.1 μg/μl) were purchased from Santa Cruz Biotechnology. A modified method of Rittenhouse and Marcus (46Rittenhouse J. Marcus F. Anal. Biochem. 1983; 138: 442-448Crossref Scopus (82) Google Scholar) was used for protein analysis. Nuclear and cytosolic proteins were loaded on 12% SDS-polyacrylamide gels and electrophoresed for 1 h at 150 V. Gels were transferred for 1 h at 1.2 mA/cm2in a semi-dry chamber with a three buffer system (cathode buffer: 25 mm Tris-HCl, pH 9.4, 40 mm ε-aminocaproic acid, 20% methanol; anode buffer I: 30 mm Tris-HCl, pH 10.4, 20% methanol; anode buffer II: 300 mm Tris-HCl, pH 10.4, 20% methanol) onto PVDF Immobilon membrane (Millipore) and stained with Fount India Ink (Pelikan) to control for even loading and transfer efficiency. Blots were blocked overnight at 4 °C with Blotto (5% nonfat dry milk in 15 mm Tris-HCl, pH 7.6, 136 mm NaCl), exposed to primary antibodies for 1 h at room temperature (dilution 1:1000 in Blotto), and then incubated with secondary antibody (horseradish peroxidase-conjugated anti-rabbit IgG, Sigma), diluted 1:1000 in Blotto, for 1 h at room temperature. Detection was performed with the ECL system (Pierce). Total RNA was used for oligo(dT)-primed cDNA synthesis with SuperScript RNase H− reverse transcriptase (Life Technologies Inc.). PCR for dPRL and GAPDH cDNAs was performed as described previously (42Bonhoff A. Gellersen B. Endocrine. 1996; 5: 241-246Crossref PubMed Google Scholar, 43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar). For amplification of C/EBPβ cDNA (38Akira S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1219) Google Scholar) Taq DNA polymerase and solution Q (Qiagen) were used. The sense primer TCTCCGACCTCTTCTCCGACGA spans cDNA positions 353–374 relative to the first start codon, and the antisense primer CAGCTGCTTGAASAASTKCCG anneals to the region 982–1002. After transfer of the electrophoresed PCR products to positively charged nylon membrane (Roche Molecular Biochemicals), Southern blot hybridization was performed with internal oligonucleotides labeled with terminal deoxynucleotidyl transferase (Life Technologies) and digoxigenin-11-dUTP (Roche Molecular Biochemicals), and detected with the DIG luminescent detection kit (Roche Molecular Biochemicals). The probe sequences were for GAPDH: TCGTCATGGGTGTGAACCATG; for hPRL: CAAGGGGGCCACGCTCTGGCA; for C/EBPβ: TTGCGCACGGCGATGTTGTTG (antisense to positions 840–860). All luciferase gene reporter constructs were generated in the pGL3-Basic plasmid (Promega). The dPRL promoter/luciferase reporter fusion construct dPRL-332/luc3 contains the wild type dPRL promoter sequence −332 to +65 relative to the major transcriptional start site and has been described previously (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (228) Google Scholar, 17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). The minimal promoter construct dPRL-32/luc3 was generated by PCR using dPRL-332/luc3 as the template. Primers were: CCTGAAGCttGCCATAAAAGAATCCTCTGACGTTTC (sense), annealing at positions −39 to −4 of the dPRL promoter and including two mismatches (lowercase letters) to introduce a Hin dIII site (underlined) at position −32, and CTTTATGTTTTTGGCGTCTTCCA (antisense), corresponding to positions 2–23 relative to the ATG start codon of the luciferase gene in pGL3-Basic. The PCR product was cleaved with Hin dIII and ligated into Hin dIII digested pGL3-Basic. The dPRL-332/-270 was using with the dPRL sequence and (antisense), corresponding to positions The PCR products were digested with and into provided by Dr. N. of with or two were by at with followed by and at with and then ligated into the and sites of dPRL-32/luc3 to the minimal promoter The constructs and the dPRL promoter in was by PCR with polymerase using as upstream primer and the primer (antisense), corresponding to positions and an with sequence The PCR product was digested with and into the Germany) and sites of was generated with the sense primer and the antisense primer with The PCR product was digested with and into and sites of was generated by using dPRL-332/luc3 as template. The upstream primer spans positions to of the dPRL promoter and contains a the antisense primer is in exon positions to relative to the transcription start site, and two mismatches (lowercase letters) to introduce a site (underlined) at position The PCR product was to with to at the site to the of the upstream This a with and which was ligated into pGL3-Basic digested with and Computerized for transcription factor consensus binding sites were performed with by using the T. E. I. H. E.A. O.A. N.A. Nucleic Acids Res. 1998; PubMed Scopus Google Scholar). of consensus sequences were into the dPRL promoter by of dPRL-332/luc3 using the system and polymerase PCR products were and plasmid DNA prepared to the by and it into pGL3-Basic cleaved with the same The sense sequences of the oligonucleotides used for and the constructs are in a reporter control for C/EBP expression was oligonucleotides with were and into the site of the dPRL-32/luc3 minimal promoter The sequence a NF-IL6 response element consensus sequence by sites for transfections were in the promoter. The human C/EBPα cDNA P. Xanthopoulos K.G. Biochem. Res. 1995; PubMed Scopus Google Scholar) was from provided by Dr. G. of TX) with and ligated into cleaved to for human C/EBPβ and C/EBPδ were a from Dr. S. Akira of (29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (268) Google Scholar, S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1219) Google Scholar). were with and into which been with and This and which the C/EBPβ cDNA in the reverse and was used as a control. plasmid was with the region of upstream of the cDNA and the cDNA were and the plasmid with (Promega) and as the the of cDNA from the site upstream of the codon to the the expression vector was to by using the corresponding to positions in the human C/EBPβ cDNA relative to the first indicate codon from to and to and is a Hin dIII site by (antisense to and antisense to positions of human C/EBPβ PCR were performed with polymerase on in the of to the cDNA and and and were used to overlapping of the C/EBPβ the to to and a Hin dIII site within the PCR products were digested with Hin dIII and ligated to to the region from the to the The purified product was cleaved with to an internal the This was used to the wild type in The construct was kindly provided by and Tsai of contains region for the transactivation domain of control of the promoter and was used to The sequence the DNA-binding domain was from by with of the with and with in the to the cDNA The was ligated into which been prepared as the plasmid was with in the to the in with the of DNA polymerase and with and cleaved with The in an fusion of and All and of were by of the dPRL promoter used as or for were: and proteins were from cDNAs into using the system (Promega). binding reaction of nuclear protein or of product and of probe were used. concentrations of in the binding including nuclear were: 15 mm mm mm mm mm mm 1 mm mm