Regulation of Peroxisome Proliferator-activated Receptor γ Activity by Mitogen-activated Protein Kinase

Adipocyte differentiation is regulated both positively and negatively by external growth factors such as insulin, platelet-derived growth factor (PDGF), and epidermal growth factor (EGF). A key component of the adipocyte differentiation process is PPARγ, peroxisomal proliferator-activated receptor γ. To determine the relationship between PPARγ activation and growth factor stimulation in adipogenesis, we investigated the effects of PDGF and EGF on PPARγ1 activity. PDGF treatment decreased ligand-activated PPARγ1 transcriptional activity in a transient reporter assay.In vivo 32Porthophosphate labeling experiments demonstrated that PPARγ1 is a phosphoprotein that undergoes EGF-stimulated MEK/mitogen-activated protein (MAP) kinase-dependent phosphorylation. Purified PPARγ1 protein was phosphorylated in vitro by recombinant activated MAP kinase. Examination of the PPARγ1 sequence revealed a single MAP kinase consensus recognition site at Ser82. Mutation of Ser82 to Ala inhibited both in vitro andin vivo phosphorylation and growth factor-mediated transcriptional repression. Therefore, phosphorylation of PPARγ1 by MAP kinase contributes to the reduction of PPARγ1 transcriptional activity by growth factor treatment. Adipocyte differentiation is regulated both positively and negatively by external growth factors such as insulin, platelet-derived growth factor (PDGF), and epidermal growth factor (EGF). A key component of the adipocyte differentiation process is PPARγ, peroxisomal proliferator-activated receptor γ. To determine the relationship between PPARγ activation and growth factor stimulation in adipogenesis, we investigated the effects of PDGF and EGF on PPARγ1 activity. PDGF treatment decreased ligand-activated PPARγ1 transcriptional activity in a transient reporter assay.In vivo 32Porthophosphate labeling experiments demonstrated that PPARγ1 is a phosphoprotein that undergoes EGF-stimulated MEK/mitogen-activated protein (MAP) kinase-dependent phosphorylation. Purified PPARγ1 protein was phosphorylated in vitro by recombinant activated MAP kinase. Examination of the PPARγ1 sequence revealed a single MAP kinase consensus recognition site at Ser82. Mutation of Ser82 to Ala inhibited both in vitro andin vivo phosphorylation and growth factor-mediated transcriptional repression. Therefore, phosphorylation of PPARγ1 by MAP kinase contributes to the reduction of PPARγ1 transcriptional activity by growth factor treatment. Peroxisome proliferator-activated receptors (PPARs) 1The abbreviations used are: PPAR, peroxisomal proliferator-activated receptor; MAP, mitogen-activated protein; RXR, retinoic acid-like receptor; EGF, epidermal growth factor; PDGF, platelet-derived growth factor; MEK, MAP kinase kinase; CA-MEK, constitutively active MEK; MBP, maltose-binding protein; TK, thymidine kinase; PPRE, peroxisome proliferator response element; ARE7, adipocyte regulatory factor response element. are members of the nuclear hormone receptor superfamily (1Evans R.M. Science. 1988; 240: 889-895Crossref PubMed Scopus (6341) Google Scholar). These receptors heterodimerize with retinoic acid-like receptor, RXR, and become transcriptionally active when bound to ligand. The three PPAR isoforms (α, δ, and γ) differ in their C-terminal ligand binding domains, and each appears to bind and respond to a specific subset of agents including hypolipidemic drugs, long chain fatty acids, aracadonic acid metabolites, and antidiabetic thiazolidinediones (2Issemann I. Green S. Nature. 1990; 347: 645-650Crossref PubMed Scopus (3059) Google Scholar, 3Forman B. Tontonoz P. Chen J. Brun R. Spiegelman B. Evans R. Cell. 1995; 83: 803-812Abstract Full Text PDF PubMed Scopus (2740) Google Scholar, 4Kliewer S. Lenhard J. Willson T. Patel I. Morris D. Lehmann J. Cell. 1995; 83: 813-819Abstract Full Text PDF PubMed Scopus (1872) Google Scholar). PPARγ is expressed predominantly in mouse white and brown fat, with lower levels in liver, whereas PPARα is present in heart, kidney, and liver (5Chawla A. Lazar M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1786-1790Crossref PubMed Scopus (218) Google Scholar, 6Tontonoz, P., Hu, E., Graves, R., Budavari, A., and Spiegelman, B. (1994) Genes 91: 7355-7359Crossref PubMed Scopus (1281) Google Scholar, 8Amri E.Z. Bonino F. Ailhaud G. Abumrad N.A. Grimaldi P.A. J. Biol. Chem. 1995; 270: 2367-2371Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar). Ectopic expression of either PPARα or PPARγ in NIH-3T3 cells is sufficient to induce adipocyte differentiation in the presence of PPARγ activators (9Tontonoz P. Hu E. Spiegelman B. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3132) Google Scholar, 10Brun R. Tontonoz P. Forman B. Ellis R. Chen J. Evans R. Spiegelman B. Genes 10: 974-984Crossref PubMed Scopus (411) Google Scholar). The rapid induction of PPARγ during adipocyte differentiation and its enriched expression in adipose tissues suggest that PPARγ is responsible for the initiation and maintenance of the adipocyte phenotype in vivo (9Tontonoz P. Hu E. Spiegelman B. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3132) Google Scholar). Previously two isotypes of PPARγ (PPARγ1 and PPARγ2) have been identified in 3T3-L1 adipocytes (11Tontonoz P. Graves R. Budavari A. Erdjument-Bromage M. Hu E. Tempst P. Spiegelman B. Nucleic Acids Res. 1994; 22: 5623-5634Crossref Scopus (330) Google Scholar). Zhu et al. (12Zhu Y. Qi C. Korenberg J. Chen X. Noya D. Rao S. Reddy J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7921-7925Crossref PubMed Scopus (606) Google Scholar) have demonstrated that these two isotypes are derived from a single PPARγ gene by alternative promoter usage and RNA splicing. However, thus far, no functional difference has been found between the two isotypes. Adipogenesis is a complex process; multiple hormones and factors regulate the conversion of progenitor cells to adipocytes. Insulin and/or insulin-like growth factor enhance the ability of PPAR ligand to induce differentiation of both 3T3-L1- and PPARγ-overexpressing cell lines (9Tontonoz P. Hu E. Spiegelman B. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3132) Google Scholar, 13Tafuri S.R. Endocrinology. 1996; 137: 4706-4712Crossref PubMed Scopus (146) Google Scholar). In contrast, growth factors such as epidermal growth factor (EGF), platelet-derived growth factor (PDGF), and fibroblast growth factor inhibit adipocyte conversion (14Serrero G. Biochem. Biophys. Res. Commun. 1987; 146: 194-202Crossref PubMed Scopus (64) Google Scholar, 15Navre M. Ringold G.M. J. Cell Biol. 1989; 109: 1857-1863Crossref PubMed Scopus (54) Google Scholar, 16Serrero G. Mills D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3912-3916Crossref PubMed Scopus (75) Google Scholar, 17Adachi H. Kurachi H. Homma H. Adachi K. Imai T. Morishige K. Matxuzawa Y. Miyake A. Endocrinology. 1994; 135: 1824-1830Crossref PubMed Scopus (34) Google Scholar, 18Brauer-Krieger H.I. Kather H. Biochem. J. 1995; 307: 549-556Crossref PubMed Scopus (119) Google Scholar). In this report, we find that activation of EGF and PDGF receptors and subsequent phosphorylation of PPARγ1 by the MAP kinase signaling pathway decreases PPARγ1 transcriptional activity. This repression is mediated by MAP kinase phosphorylation of Ser82 on PPARγ1. These studies identify PPARγ1 as a substrate of MAP kinase and provide evidence for regulation of PPARγ1 activity by phosphorylation. Cell culture reagents were purchased from Life Technologies, Inc. The ECL detection system and carrier-free 32Porthophosphate were obtained from Amersham Corp. The PDGF was purchased from Intergen, while EGF was from Harlan. PD98059 and BRL49653 were synthesized at Parke-Davis Pharmaceutical Research Division of Warner-Lambert Co. For eukaryotic expression of PPARγ1 and RXRα, the entire PPARγ1 or RXRα cDNA was inserted 3′ to the cytomegalovirus promoter in pSG5 (Stratagene). Constitutively active MAP kinase kinase (CA-MEK), which contains mutations at Ser218 to Glu and Ser222to Glu was obtained from Dr. S. Decker (Parke-Davis). Site-directed mutagenesis of PPARγ1/pSG5 was conducted using the MORPH site-specific plasmid DNA mutagenesis system (5 Prime → 3 Prime, Inc., Boulder, CO). The oligonucleotide used in mutagenesis was CAAAGTAGAACCTGCAGCTCCACCTTATTATTCTGAAAAGACCC and changed Ser82 to Ala. The reporter construct used in the transfections contained three copies of the PPRE site from the aP2 enhancer (ARE7) inserted upstream of a minimal thymidine kinase (TK) promoter in the pGL3 basic luciferase vector (a gift from Dr. R. Wyborski). All constructs were sequenced prior to use. For the transient transfection, NIH 3T3 cells were grown in 10% fetal calf serum/Dulbecco's modified Eagle's medium and co-transfected with various expression plasmids and pCMV β-galactosidase plasmid (Clontech) using Lipofectamine (Life Technologies, Inc.). After recovery, cells were placed in 0.5% bovine serum albumin/Dulbecco's modified Eagle's medium for 5 h and then treated with 25 μm BRL49653 and/or 100 ng/ml PDGF for 16 h. Luciferase and β-galactosidase activities were determined using a Luciferase assay (Promega) and the Galacto-light system (Tropix, Inc.). To express the maltose-binding protein (MBP) fusion proteins in Escherichia coli, the coding regions of PPARγ1, PPARδ, and RXRα were inserted downstream of the isopropyl-β-d-thiogalactopyranoside-inducible MalE-lacZα gene fusion in the pMAL-C2 plasmid (New England Biolabs). Protein expression was induced with isopropyl-β-d-thiogalactopyranoside, and the fusion proteins were partially purified by amylose affinity chromatography (19Maina C.V. Riggs P.D. Grandea A.G. Slatko B.E. Moran L.S. Tagliamonte J.A. McReynolds L.A. Guan C.D. Gene (Amst.). 1988; 74: 365-373Crossref PubMed Scopus (462) Google Scholar). In vitro phosphorylation of MBP, MBP-PPARγ1, and MBP-PPARδ by MAP kinase was performed as described previously (20Dudley D. Pang L. Decker S. Bridges A. Saltiel A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7686-7689Crossref PubMed Scopus (2595) Google Scholar) using a bacterially expressed glutathione S-transferase fusion protein of 44-kDa MAP kinase (GST-MAP kinase) and the 45-kDa MEK (GST-MEK1). Using a PPARγ-specific polyclonal antibody (produced using the MBP-PPARγ fusion protein), 2H. Camp, A. L. Whitton, and S. T. Tafuri, submitted for publication. in vitro translated PPARγ1 and the mutant PPARγ1 (S82A) were immunoprecipitated and phosphorylated by active GST-MAP kinase as described above. Approximately 0.5 μg of the partially pure MBP-PPARγ1, phosphorylated or unphosphorylated, and 0.5 μg of MBP-RXRα protein were preincubated for 15 min in 1 × mobility shift assay buffer (15 mm Hepes, pH 7.0, 80 mm KCl, 10% glycerol, 1 μg of poly(dI-dC), 0.2 mm EDTA, and 0.4 mm dithiothreitol) to allow heterodimer formation, or MBP-PPARγ1 was phosphorylated prior to heterodimerization with MBP-RXRα. Approximately 20 fmol of a32P-labeled double-stranded ARE7 PPRE-containing oligonucleotide probe (5′-AATTCAAGGCAGAAAGTGAACTCTGATCCAGTAAGAAG-3′) was added to the protein mix and incubated at room temperature for 20 min. Protein-DNA complexes were analyzed in 5% 1 × TBE polyacrylamide gels. 293T cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum (Life Technologies, Inc.) and transfected using a calcium phosphate transfection protocol according to the manufacturer (Stratagene). For in vivo labeling, transfected cells were serum-starved overnight in 0.5% bovine serum albumin/Dulbecco's modified Eagle's medium, pretreated with phosphate-free medium for 1 h, and subsequently incubated in 0.8 mCi of 32Porthophosphate at 37 °C for 3 h. Cells were preincubated with either BRL49653 (25 μm) or PD98059 (40 μm) for 15 min followed by the addition of EGF (100 ng/ml). EGF stimulation proceeded for 5 or 15 min prior to removal of the media and cell lysis. Cells were harvested in radioimmune precipitation lysis buffer (10% glycerol, 137 mm NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 20 mm Tris, pH 8.0, 2 mm EDTA, complete protease inhibitors, and 20 mm NaVO4). Whole cell extracts were immunoprecipitated with anti-PPARγ antibody and protein A-Sepharose (Life Technologies, Inc.) for 16 h at 4 °C and resolved in 10% SDS-PAGE. To detect MAP kinase activity in 293T cells, whole cell lysates were prepared and subjected to Western blot analysis using the anti-active MAP kinase antibody (Promega) and ECL system (Amersham). Transcription reporter assays were used to determine the effect of growth factors on the transcriptional activity of PPARγ1. The luciferase reporter constructs used in NIH3T3 cells contained the TK promoter (TKpGL3) or three copies of ARE7 PPRE elements upstream of the TK promoter (ARE7-TKpGL3). In the absence of co-transfected PPARγ1 and RXRα expression plasmids, no PPARγ ligand (BRL49653)-dependent transcription was observed from either the TkpGL3 or ARE7-TKpGL3 (Fig. 1 A). In the presence of PPARγ1 and RXRα, a 2-fold increase in transcription was observed from ARE7-TK reporter after 16 h of treatment with BRL49653. The addition of 100 ng/ml PDGF to these cells decreased both the basal and BRL49653-activated transcription from the ARE7. This suggests that at least a fraction of the activity from the ARE7-TKpGL3 plasmid in the absence of exogenously added ligand is due to the activation of the PPARγ1·RXRα heterodimer by endogenous ligands. This activity was also reduced by PDGF treatment. Close examination of the PPARγ amino acid sequence revealed that PPARγ1 contains one serine residue, Ser82, whose surrounding amino acids correspond to the consensus phosphorylation site for MAP kinase (Fig. 2 A) (22Gonzalez F.A. Raden D.L. Davis R.J. J. Biol. Chem. 1991; 266: 22159-22163Abstract Full Text PDF PubMed Google Scholar). This site is absolutely conserved between human and mouse PPARγ1. A variation of the MAP kinase consensus site is also found in mouse PPARα at a similar position in the amino acid sequence. PPARδ lacks this site altogether (Fig. 2 A). Since both EGF and PDGF are known to activate MAP kinase in vivo, a CA-MEK that constitutively activates MAP kinase was co-transfected with ARE7-TKpGL3, PPARγ1, and RXRα expression plasmids. As shown in Fig. 1 B, CA-MEK decreased both the basal and the ligand-dependent PPARγ1 transcriptional activity in a dose-dependent manner. No significant effect was seen with the TKpGL3 parental reporter construct. This suggests that the intracellular signaling pathways activated by PDGF or EGF can modulate transcriptional activity. To determine PPARγ1 can phosphorylated by MAP kinase in partially purified MBP, MBP-PPARγ1, or MBP-PPARδ fusion proteins were incubated with GST-MAP kinase and that basic a known MAP kinase As shown in Fig. 2 B, MAP kinase phosphorylated PPARγ1 MBP-PPARδ or maltose-binding protein that of proteins were (Fig. 2 To determine Ser82 is the phosphorylated in a was PPARγ1 that changed Ser82 to Ala. the PPARγ1 and the mutant PPARγ1 (S82A) vitro translated and immunoprecipitated with a polyclonal anti-PPARγ The immunoprecipitated were used as in the in vitro MAP kinase Mutation at Ser82 to Ala the MAP kinase-dependent phosphorylation of PPARγ1 that the Ser82 is the amino acid in PPARγ1 that is phosphorylated by MAP kinase. the PPARγ antibody Western blot of vitro translated proteins and that both proteins were expressed in the To determine PPARγ1 is phosphorylated by growth factor 293T cells were transfected with PPARγ1, serum-starved for h, and incubated with To no were added to the cells prior to lysis. Whole cell lysates were prepared after EGF treatment and immunoprecipitated with a PPARγ-specific PPARγ1 was phosphorylated in the absence of and growth treatment with 100 ng/ml of EGF for 5 or 15 min PPARγ1 phosphorylation and 3 and In 293T cells, EGF treatment MAP kinase activity as determined by Western blot analysis with the anti-active MAP kinase antibody B, 1 and To determine the MAP kinase signaling pathway is in the phosphorylation of PPARγ1, the transfected cells were pretreated with μm a specific MEK (20Dudley D. Pang L. Decker S. Bridges A. Saltiel A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7686-7689Crossref PubMed Scopus (2595) Google Scholar) for 15 min prior to EGF treatment. PD98059 EGF-stimulated phosphorylation of PPARγ1 (Fig. 3 that MAP kinase activation is in the phosphorylation of PPARγ1. this PD98059 inhibited MAP kinase activation by EGF (Fig. 3 B, of the cells with 25 for 15 min also reduced the phosphorylation of PPARγ1 (Fig. 3 the ability of EGF to MAP kinase activity (Fig. 3 B, This that of the ligand binding inhibit the ability of MAP kinase to and/or PPARγ1. To determine Ser82 is the in vivo in response to EGF the Ser82 → Ala PPARγ1 mutant was 293T cells, and in vivo labeling was performed in the presence and absence of 100 ng/ml EGF A). phosphorylation of the PPARγ1 was by EGF treatment as phosphorylation of the mutant was of both mutant and protein were expressed in the transfected cells, as shown by Western blot analysis (Fig. 4 Since PPARγ1 phosphorylation was by this this that the MAP kinase site at Ser82 is the phosphorylation site on PPARγ1. To that the regulation of PPARγ1 by growth factors was PPARγ1 NIH 3T3 cells were co-transfected with either the PPARγ1 or Ala PPARγ1 mutant and cells were then treated with BRL49653 in the presence or absence of basal activity was by the Ala In contrast, the activity of the Ser82 → Ala mutant PPARγ1 was to repression To determine phosphorylation PPARγ1 DNA a mobility shift assay was performed on a double-stranded oligonucleotide containing the ARE7 PPRE with vitro phosphorylated and As previously PPARγ1 (Fig. bind to the ARE7 P., Hu, E., Graves, R., Budavari, A., and Spiegelman, B. (1994) Genes 270: Full Text Full Text PDF PubMed Scopus Google Scholar). In the MAP kinase-dependent phosphorylation of on the receptor a increase in transcriptional activation by the S. H. Y. T. S. H. S. Y. E. H. D. P. Science. 1995; 270: PubMed Scopus Google Scholar). these suggest that in phosphorylation of nuclear receptors their transcriptional activity. In contrast, suggest that MAP kinase phosphorylation of PPARγ1 negatively its EGF, PDGF, and fibroblast growth factor inhibit the conversion of 3T3-L1 to adipocytes M. Ringold G.M. J. Cell Biol. 1989; 109: 1857-1863Crossref PubMed Scopus (54) Google Scholar, 17Adachi H. Kurachi H. Homma H. Adachi K. Imai T. Morishige K. Matxuzawa Y. Miyake A. Endocrinology. 1994; 135: 1824-1830Crossref PubMed Scopus (34) Google Scholar, 18Brauer-Krieger H.I. Kather H. Biochem. J. 1995; 307: 549-556Crossref PubMed Scopus (119) Google Scholar). cells are also inhibited from adipocytes in the presence of EGF (14Serrero G. Biochem. Biophys. Res. Commun. 1987; 146: 194-202Crossref PubMed Scopus (64) Google and of the of adipose G. Mills D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3912-3916Crossref PubMed Scopus (75) Google Scholar). the of this is growth is for is that activation of the intracellular signaling by growth factors with the activity of the factors in suggest that this with the activation of MAP kinase. The activation of MAP kinase by EGF or PDGF the phosphorylation of PPARγ1, which negatively its the of adipocyte The one in this is adipocyte growth MAP kinase activity in 3T3-L1 adipocytes. In two suggest that stimulation induce the PPARγ1, and PPARα phosphorylation A. C. P. A. C. 1996; 137: Scopus Google Scholar, B. J. G. A. S. S. D. D. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar). However, in to both present that the induced phosphorylation the transcriptional activity of the The of growth factors and cell lines this et al. B. J. G. A. S. S. D. D. J. Biol. Chem. 1996; Full Text Full Text PDF PubMed Scopus Google Scholar) that of the phosphorylated serine the activation of PPARγ by In expression of MEK the activity of PPARδ that is phosphorylated by MAP kinase. This suggests that the activation of transcription by in their system a of the MAP phosphorylation of Tontonoz et P. Hu E. Spiegelman B. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3132) Google Scholar) have shown that of the of which lacks Ser82, the ability of PPARγ to induce adipocyte Hu et al. E. P. Spiegelman B.M. Science. 1996; PubMed Scopus Google Scholar) demonstrated that the expression of a mutant (a serine to at position in which is to Ser82 of to These the of the present studies on adipocyte that activates MAP kinase in 3T3-L1 such as and are by the of MAP kinase with the MEK PD98059 R.J. K. P. Saltiel J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar, R.J. Lazar Saltiel J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). In the MEK or 3T3-L1 adipocyte differentiation Since of the effects of in adipocytes the MAP kinase signaling we suggest that signaling induced by during regulate PPARγ activity phosphorylation by MAP kinase. The of of PPARγ phosphorylation is to that DNA binding of recombinant PPARγ1·RXRα complexes is by that heterodimerization of the complex is also This suggests that transcriptional activation by PPARγ1 is regulated by phosphorylation. activation by nuclear receptors is the of the receptors with S. E. G. H. C. M. Science. 1994; PubMed Scopus Google Scholar, S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: PubMed Scopus Google Scholar) and Evans R.M. Nature. 1995; PubMed Scopus Google T. J. B. R. A. Y. M. Nature. 1995; PubMed Scopus Google Scholar, R. M. A. S. M. Nature. 1995; PubMed Scopus Google Scholar). of in the receptor, receptor has a affinity for the the and thus transcription Evans R.M. Nature. 1995; PubMed Scopus Google Scholar, T. J. B. R. A. Y. M. Nature. 1995; PubMed Scopus Google Scholar). Since with BRL49653 decreased receptor phosphorylation in cell we that by ligand binding or in receptor a in the and/or affinity of PPARγ for the S. R. T. K. and A. Saltiel for of the and for Dr. D. for and GST-MAP kinase fusion proteins and Dr. S. Decker for CA-MEK and