Evidence That a Phosphatidylinositol 3,4,5-Trisphosphate-binding Protein Can Function in Nucleus

PIP3BP is a phosphatidylinositol 3,4,5-trisphosphate-binding protein (PIP3BP) abundant in brain, containing a zinc finger motif and two pleckstrin homology (PH) domains. Staining of rat brain cells with anti-PIP3BP antibody and determination of localization of PIP3BP fused to the green fluorescent protein (GFP-PIP3BP) revealed that PIP3BP was targeted to the nucleus. Targeting was dependent on a putative nuclear localization signal in PIP3BP. Generation of PIP3 in the nucleus was detected in H2O2-treated 293T cells, nerve growth factor (NGF)-treated PC12 cells, and platelet-derived growth factor (PDGF)-treated NIH 3T3 cells. Translocation of phosphatidylinositol 3-kinase (PI 3-kinase) to the nucleus and enhanced activity of PI 3-kinase in the nucleus fraction were observed after H2O2 treatment of 293T cells, suggesting that PI 3-kinase can be activated in the nucleus as well as in the membrane after appropriate stimulation of the cells. Co-expression of the constitutively active PI 3-kinase with PIP3BP resulted in exportation of the protein from the nucleus to the cytoplasm, suggesting that PIP3BP can function as a PIP3-binding protein in the intact cells. These results imply that there may be an unknown function of PI 3-kinase in the nucleus. PIP3BP is a phosphatidylinositol 3,4,5-trisphosphate-binding protein (PIP3BP) abundant in brain, containing a zinc finger motif and two pleckstrin homology (PH) domains. Staining of rat brain cells with anti-PIP3BP antibody and determination of localization of PIP3BP fused to the green fluorescent protein (GFP-PIP3BP) revealed that PIP3BP was targeted to the nucleus. Targeting was dependent on a putative nuclear localization signal in PIP3BP. Generation of PIP3 in the nucleus was detected in H2O2-treated 293T cells, nerve growth factor (NGF)-treated PC12 cells, and platelet-derived growth factor (PDGF)-treated NIH 3T3 cells. Translocation of phosphatidylinositol 3-kinase (PI 3-kinase) to the nucleus and enhanced activity of PI 3-kinase in the nucleus fraction were observed after H2O2 treatment of 293T cells, suggesting that PI 3-kinase can be activated in the nucleus as well as in the membrane after appropriate stimulation of the cells. Co-expression of the constitutively active PI 3-kinase with PIP3BP resulted in exportation of the protein from the nucleus to the cytoplasm, suggesting that PIP3BP can function as a PIP3-binding protein in the intact cells. These results imply that there may be an unknown function of PI 3-kinase in the nucleus. Phosphatidylinositol 3-kinase (PI 3-kinase) 1The abbreviations used are: PI 3-kinase, phosphatidylinositol 3-kinase; PIP3, phosphatidylinositol 3,4,5-trisphosphate; PI 3, 4-P2, phosphatidylinositol 3,4-bisphosphate; PI 4, 5-P2, phosphatidylinositol 4,5-bisphosphate; GAP, GTPase activating protein; GFP, green fluorescent protein; DMEM, Dulbecco's modified minimal essential medium; BD110, constitutively active PI 3-kinase; BDKN, kinase negative mutant of PI 3-kinase; GFAP, glial fiber acidic protein; PH, pleckstrin homology; PIP3BP, PIP3-binding protein; GST, glutathione S-transferase; TLC, thin layer chromatography; NGF, nerve growth factor; PDGF, platelet-derived growth factor. is an enzyme that is activated immediately after growth factor or differentiation factor stimulation of the cells (1Stephens L.R. Jackson T.R. Hawkins P.T. Biochim. Biophys. Acta. 1993; 1179: 27-75Crossref PubMed Scopus (426) Google Scholar) and that generates second messengers, phosphatidylinositol 3,4,5-trisphosphate (PIP3) and phosphatidylinositol 3,4-bisphosphate (PI 3,4-P2) (2Shibasaki F. Homma Y. Takenawa T. J. Biol. Chem. 1991; 266: 8108-8114Abstract Full Text PDF PubMed Google Scholar, 3Auger K.R. Serunian L.A. Soltoff S.P. Libby P. Cantley L.C. Cell. 1989; 57: 167-175Abstract Full Text PDF PubMed Scopus (682) Google Scholar, 4Carpenter C.L. Duckworth B.C. Auger K.R. Cohen B. Schaffhausen B.S. Cantley L.C. J. Biol. Chem. 1990; 265: 19704-19711Abstract Full Text PDF PubMed Google Scholar, 5Whitman M. Downes C.P. Keeler M. Keller T. Cantley L. Nature. 1988; 332: 644-646Crossref PubMed Scopus (739) Google Scholar). These 3′-phosphorylated phosphoinositides can activate serine, threonine kinases such as PKB/Akt, PKCs, and PDKs (6Nakanishi H. Brewer K.A. Exton J.H. J. Biol. Chem. 1993; 268: 13-16Abstract Full Text PDF PubMed Google Scholar, 7Akimoto K. Takahashi R. Moriya S. Nishioka N. Takayanagi J. Kimura K. Fukui Y. Osada S. Mizuno K. Hirai S. Kazlauskas A. Ohno S. EMBO J. 1996; 15: 788-798Crossref PubMed Scopus (257) Google Scholar, 8Alessi D.R. James S.R. Downes C.P. Holmes A.B. Gaffney P.R.J. Reese C.B. Cohen P. Curr. Biol. 1997; 7: 261-269Abstract Full Text Full Text PDF PubMed Google Scholar, 9Stokoe D. Stephens L.R. Copeland T. Gaffney P.R.J. Reese C.B. Painter G.F. Holmes A.B. McCormick F. Hawkins P.T. Science. 1997; 277: 567-570Crossref PubMed Scopus (1048) Google Scholar). They are also suggested to be involved in other events such as rearrangement of cytoskeleton and vesicle transport because these phenomena are sensitive to the PI 3-kinase inhibitors and dominant negative mutants of PI 3-kinase (10Fukui Y. Ihara S. Nagata S. J. Biochem. 1998; 124: 1-7Crossref PubMed Scopus (42) Google Scholar). Recently, it was reported that the 3′-phosphorylated phosphoinositides can activate guanine nucleotide exchanging factors of Rac and Arf, small G proteins involved in actin rearrangement and vesicle transport, respectively (11Han J. Luby-Phelps K. Das B. Shu X. Xia Y. Mosteller R.D. Krishna U.M. Falck J.R. White M.A. Broek D. Science. 1998; 279: 558-560Crossref PubMed Scopus (710) Google Scholar, 12Klarlund J.K. Remeh L.E. Cantley L.C. Buxton J.M. Holik J.J. Sakelis C. Patki V. Corvera S. MP C. J. Biol. Chem. 1998; 273: 1859-1862Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). Therefore, G proteins as well as kinases are downstream of PI 3-kinase. We have identified PIP3BP as a PIP3-binding protein, using a PIP3 analogue column (13Tanaka K. Imajoh-Ohmi S. Swada T. Shirai R. Hashimoto Y. Iwasaki S. Kaibuchi K. Kanaho Y. Shirai T. Terada Y. Kimura K. Nagata S. Fukui Y. Eur. J. Biochem. 1997; 245: 512-519Crossref PubMed Scopus (82) Google Scholar). It is abundant in brain, implying that it may be involved in the function of nerve systems. PIP3BP binds to PIP3 but not to PI 3,4-P2 or phosphatidylinositol 4,5-bisphosphate (PI 4,5-P2). It has a zinc finger motif homologous to that of Arf-GTPase activating protein (GAP) and two PH domains. Both PH domains are shown to be involved in binding to PIP3. Another PIP3-binding protein, centaurin α, is highly homologous to PIP3BP (14Hammonds-Odie L.P. Jackson T.R.A. Profit A. Blader I.J. Turck C.W. Prestwich G.D. Teibert A.B. J. Biol. Chem. 1996; 271: 18859-18868Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). No GAP activity to Arf has been detected in either protein. Although the binding of centaurin α and PIP3BP to PIP3 was specific, the role of the protein is unclear. To address this question, we determined the intracellular localization by immunological techniques, using monoclonal antibody to PIP3BP as well as localization of green fluorescent protein (GFP) fusion proteins. Surprisingly, PIP3BP was found to localize in the nucleus, where the generation of PIP3 was detected after stimulation, suggesting a new pathway of signal transduction through PI 3-kinase to PIP3BP in nucleus. PIP3BP was exported out of the nucleus by expression of a constitutively active PI 3-kinase. This suggests that PIP3BP can shuttle between nucleus and cytoplasm depending on the activity of PI 3-kinase. COS-7 cells and 293T cells were cultured in Dulbecco's modified minimal essential medium (DMEM) supplemented with 10% calf serum. Transfection was done by the calcium phosphate method as described by Shirai et al. (15Shirai T. Tanaka K. Terada Y. Sawada T. Shirai R. Hashimoto Y. Nagata S. Iwamatsu A. Okawa K. Li S. Hattori S. Mano H. Fukui Y. Biochim. Biophys. Acta. 1998; 1402: 292-302Crossref PubMed Scopus (47) Google Scholar) except that pH of the buffer was 7.00 instead of 7.15. Pregnant mice were sacrificed by cervical dislocation on the 18th-day of gestation. After isolation of the embryos from the uterus, by cutting the outer layer of the pelvis, the fetal meninges were removed and the cerebral cortices were placed in DMEM containing 10% fetal bovine serum (Life Technologies, Inc.). Following the mechanical dissociation, cells were passed through a #100 mesh, and were suspended in DMEM supplemented with 10% fetal bovine serum for glial cell culture. For neuronal cell culture, the cells were suspended in neurobasal medium containing 2% B27 supplement (both from Life Technologies, Inc.), 74 μg/ml l-glutamine and 25 μml-glutamate. They were plated in culture dishes coated with poly-l-lysine (100 μg/ml) and cultured in an atmosphere of 95% air and 5% CO2 at 36 °C. A cDNA fragment encoding the full-length PIP3BP or mutant PIP3BPs was subcloned into pEGFP c-1, an expression vector for GFP fusion protein (CLONTECH), to produce pEGFP-PIP3BP, pEGFP-PIP3BP(−NLS), pEGFP(+NLS), and pEGFP-PIP3BP(−PH). PIP3BP-NLS was constructed by deletion of amino acid 1–9 residues using the restriction site,XhoI, in the cDNA. Point mutants in the PH domains in PIP3BP (PIP3BP-PH) were introduced as described previously (13Tanaka K. Imajoh-Ohmi S. Swada T. Shirai R. Hashimoto Y. Iwasaki S. Kaibuchi K. Kanaho Y. Shirai T. Terada Y. Kimura K. Nagata S. Fukui Y. Eur. J. Biochem. 1997; 245: 512-519Crossref PubMed Scopus (82) Google Scholar) by substituting Cys for Arg (residues 149 and 272) of PIP3BP by the Kunkel method (16Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Crossref PubMed Scopus (4900) Google Scholar). To obtain Myc-tagged PIP3BP, an Myc-tag sequence with an initiation codon, ATGGAACAGAAGCTGATCTCAGAAGAAGATCT, was attached at the 5′ end of the cDNA of the PIP3BP. The resulting gene was expressed under the control of SRα promoter by an expression vector pMIKNeo (17Hayashi H. Nishioka Y. Kamohara S. Kanai F. Ishii K. Fukui Y. Shibasaki F. Takenawa T. Kido H. Katsunuma N. J. Biol. Chem. 1993; 268: 7107-7117Abstract Full Text PDF PubMed Google Scholar). The expression vectors for constitutively active PI 3-kinase (BD110) and a kinase negative mutant of PI 3-kinase (BDKN) were described previously (18Kita Y. Kimura K. Kobayashi M. Ihara S. Kaibuchi K. Kuroda S. Ui M. Iba H. Konishi H. Kikkawa U. Nagata S. Fukui Y. J. Cell Sci. 1998; 111: 907-915Crossref PubMed Google Scholar). The BD110 protein has a structure similar to that of p110* reported by Hu et al. (19Hu Q.J. Klippel A. Muslin A.J. Fantl W.J. Williams L.T. Science. 1995; 268: 100-102Crossref PubMed Scopus (517) Google Scholar). The protein has an inter-SH2 domain of p85, which binds to the p110 amino terminus. BDKN protein is a kinase negative counterpart of the BD110 protein with a point mutation in the kinase domain. In situ hybridization was carried out as described previously (20Hirota S. Ito A. Morii E. Wanaka A. Tohyama M. Kitamura Y. Nomura S. Mol. Brain Res. 1992; 15: 47-54Crossref PubMed Scopus (216) Google Scholar). A cDNA fragment encoding the full-length PIP3BP was subcloned into pBluescript SK(+), and the transcripts of T7 or T3 RNA polymerase labeled with digoxigenin were used as antisense or sense probes. A monoclonal antibody, mAb 13–14, was produced. GST fusion protein of PIP3BP (GST-PIP3BP) was expressed in Escherichia coliand purified with a glutathione-Sepharose column. Eight-week-old male mice were injected subcutaneously with the purified protein mixed with complete Freund's adjuvant. Booster injections were given subcutaneously with the antigen mixed with incomplete Freund's adjuvant two times with an interval of two weeks. After the final booster injection, which was given intravenously, spleen cells of the mouse were taken and fused with the SP2/O cells by a polyethylene glycol method (21Nagata S. Yamamoto K. Ueno Y. Kurata T. Chiba J. Hybridoma. 1991; 10: 317-322Crossref PubMed Scopus (8) Google Scholar). Ten days after fusion, culture supernatant of the hybridomas were examined for the reactivity to purified GST-PIP3BP protein by enzyme-linked immunosorbent assay. After several cycles of cloning, a hybridoma clone producing mAb 13–14 was established. The epitope for mAb 13–14 was determined to be the region between amino acid position 42–109, which is within the zinc finger motif. Immunostaining was carried out as described previously (22Yoshida Y. Tsutsumi T. Makita T. Nagata S. Tashiro F. Yoshida F. Sekijima M. Shin-ichi T. Harada T. Keizo M. Ueno Y. Toxicol. Pathol. 1998; 26: 411-418Crossref PubMed Scopus (66) Google Scholar) The cells were collected by centrifugation and resuspended in a buffer containing 20 mmTris-Cl (pH 7.5), 10 mm CaCl2. After homogenization in a Dounce homogenizer, they were centrifuged at 1,000 × g for 5 min. After removal of the supernatant, two cycles of the same procedure were done to remove any non-nuclear membranes from the nucleus. The resulting pellet was used as a nuclear fraction. The supernatant was further ultracentrifugated at 100,000 × g for 30 min. The supernatant and the pellet were used as cytosolic and membrane fractions, respectively. Cells were labeled with 32Porthophosphate (1 mCi/ml) for 4 h in a phosphate-free MEM supplemented with 25 mmHepes-NaOH and treated with various stimuli. After fractionation of the cells, the lipids were extracted as described previously (23Fukui Y. Saltiel A.R. Hanafusa H. Oncogene. 1991; 6: 407-411PubMed Google Scholar) and analyzed by TLC as described previously (24Kabuyama Y. Nakatsu N. Homma Y. Fukui Y. Eur. J. Biochem. 1996; 238: 350-356Crossref PubMed Scopus (12) Google Scholar). High performance liquid chromatography analysis using SAX5 column (Whatman) was done to confirm the result of TLC (25Kobayashi M. Nagata S. Kita Y. Nakatsu N. Ihara S. Kaibuchi K. Kuroda S. Ui M. Iba H. Konishi H. Kikkawa U. Saitoh I. Fukui Y. J. Biol. Chem. 1997; 272: 16089-16092Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). In situ hybridization and immunostaining was carried out to determine the expression of PIP3BP in rat brain with mAb 13–14, anti-PIP3BP monoclonal antibody. In the rat brain section, roughly two types of the cells are clearly seen: large and round-shaped neuronal cells, and small and sharp-shaped glial cells (Fig.1 A). In situhybridization revealed that only the neuronal cells were stained by the antisense probe in cerebral cortex, whereas the sense probe did not give clear signals (Fig. 1 A, a and b). Consistent with this, immunostaining analysis suggested the same expression pattern (Fig. 1 A, c and d). Interestingly, the staining of mAb 13–14 appeared to be restricted within the hematoxylin-stained areas, suggesting that PIP3BP might be located in the nucleus. Similar results were obtained in the hippocampus and the cerebellum (data not shown). Primary neuronal and glial cultures were prepared separately from embryonic day 18 rat brains. Cell fractionation was correctly done because neuron-specific enolase (NSE) was specifically found in neuronal fraction, and the glial fiber acidic protein (GFAP) was found in the glial fraction (Fig. 1 B, bottom part). Expression of PIP3BP was examined by immunoblotting using mAb 13–14. As shown in Fig. 1 B, PIP3BP was detected exclusively in neuronal cells. No detectable amounts of PIP3BP were observed in glial cells. These results suggest that PIP3BP is localized in nucleus of the neuronal cells in rat brain. Immunostaining using mAb 13–14 showed that native PIP3BP was also detected in nucleus of neuroblastoma, Neuro2A cells (Fig. 1 C). To confirm the nuclear localization of PIP3BP, COS-7 cells were transfected with a construct coding for PIP3BP fused to the green fluorescent protein (GFP-PIP3BP), and the localization of the protein in the intact cells was analyzed. The GFP-PIP3BP fusion protein was almost exclusively detected in the nucleus, supporting the immunostaining data (Fig. 1 D,a). Similar results were obtained using PC12 cells and neuroblastoma Neuro 2A cells (26Greene L.A. Tischler A.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 2424-2428Crossref PubMed Scopus (4861) Google Scholar, 27Olmsted J.B. Carlson K. Klebe R. Ruddle F. Rosenbaum J. Proc. Natl. Acad. Sci. U. S. A. 1970; 65: 129-136Crossref PubMed Scopus (261) Google Scholar) (data not shown). Nuclear localization signal-like motif, KERRK, was found in the amino terminus part of PIP3BP. We tested whether or not this sequence directs the protein to the nucleus. GFP fused to amino-terminal 14 amino acids of PIP3BP, MAKERRKAVLELLQ, localized exclusively in the nucleus (Fig. 1 D, c). A deletion mutant lacking amino acid 1–9 (GFP-PIP3BP(−NLS)) was diffusely distributed all over the cells (Fig. 1 D,b), suggesting that the targeting mechanism of the protein to the nucleus was absent. GFP alone was detected in all parts of the cells (Fig. 1 D, d). These results suggest that the amino acid 1–14 of PIP3BP targets the proteins to the nucleus. Fractionation of COS-7 cells transfected with an expression vector for Myc-PIP3BP by homogenizing and centrifugation revealed that PIP3BP free from GFP was also located in the nucleus (see below). The above results suggest that PIP3BP may play a role in the nucleus. We therefore determined whether or not PIP3 was generated in the nucleus. Various cells were by and and the lipids were analyzed by PI 3-kinase is activated to give a signal of PIP3 in 293T cells treated with 10 Konishi et for We used this As shown in A, generation of PIP3 in the nucleus was detected in cells as well as in the The fractionation was by of and which are membrane and nuclear respectively (Fig. C). the nuclear fraction of the H2O2-treated 293T cells was prepared and with generation of PIP3 was clearly it was not in that of the cells (Fig. The of the was by performance liquid chromatography analysis of the using a SAX5 column (data not shown). In the H2O2-treated 293T cells, of the proteins was suggesting the of H. H. Tanaka M. Y. C. Kuroda S. Kikkawa U. Proc. Natl. Acad. Sci. 1996; PubMed Scopus Google Scholar). Fractionation of the cells revealed that the of in the nuclear fraction was after H2O2 treatment and on nuclear was detected suggesting that the of PI 3-kinase activity in the nucleus may be because of of the PIP3 was also detected in the nucleus in 293T cells constitutively active PI 3-kinase, PC12 cells, and NIH 3T3 cells (Fig. A). Recently, several have used PIP3-binding such as and fused to GFP, as a to in PIP3 K. J.M. Curr. Biol. 1998; Full Text Full Text PDF PubMed Scopus Google Scholar, K. F. J.M. Biochem. J. 1998; PubMed Scopus Google Scholar). they to the nuclear PIP3. This may be because of of nuclear localization of these proteins. To the of PI 3-kinase on the localization of PIP3BP, COS-7 cells were transfected with the for expression of PIP3BP and constitutively active PI 3-kinase and the cells were and of PIP3BP was As shown in Fig. A, PIP3BPs fused to GFP and a were in nucleus in the of the activated PI 3-kinase. In they were localized in the membrane or cytosolic the constitutively active PI 3-kinase was The cells were observed under the to the of Co-expression of BD110 resulted in exportation out of the protein from the nucleus in of the transfected cells (Fig. whereas was detected almost exclusively in the nucleus expression of BD110 (data not shown). The kinase negative of PI 3-kinase did not this (Fig. of the cells with resulted in of PIP3BP to the nucleus within 30 suggesting that cells were not by the expression of the constitutively active PI 3-kinase (Fig. Point of PH domains in PIP3BP were suggested to the binding to PIP3, previously (13Tanaka K. Imajoh-Ohmi S. Swada T. Shirai R. Hashimoto Y. Iwasaki S. Kaibuchi K. Kanaho Y. Shirai T. Terada Y. Kimura K. Nagata S. Fukui Y. Eur. J. Biochem. 1997; 245: 512-519Crossref PubMed Scopus (82) Google Scholar). This mutant PIP3BP was not exported out of the nucleus These results suggest that of the PH domains and PIP3 is for the of PIP3BP. These results suggest that PIP3BP can shuttle between the nucleus and the cytoplasm depending on the activity of PI 3-kinase. It is well that PI is in the nucleus, in the nuclear It is that PI 3-kinase which is in the can the nuclear membrane at from the cytosolic to produce PIP3. We found that PI 3-kinase can be targeted after H2O2 treatment of 293T cells. The used was PI 3-kinase may be a protein that is targeted to the nucleus because staining of the proteins in the nuclear from H2O2-treated and cells were almost Although a may be for nuclear localization of a of PI 3-kinase, this that a small of PI 3-kinase, which is by the can be targeted to the nucleus after appropriate stimulation of the cells. The results in this clearly that PIP3BP can function as a PIP3-binding protein. Therefore, the that PIP3BP is targeted to the nucleus suggests that there may be an unknown function of PIP3BP in the nucleus. The exportation of PIP3BP out of the nucleus was to B, an of nuclear exportation signal We are PIP3BP is exported out of the nucleus to the role of the protein. We for of the