Enzymatic Characteristics of Recombinant Medium Isozyme of 2′-5′ Oligoadenylate Synthetase

P69 is an isozyme of the medium size class of human 2′-5′ oligoadenylate synthetases. In this study, recombinant P69 was expressed and used for enzymological and structural investigations. Bacterially expressed P69 was inactive whereas the same protein expressed in insect cells was highly active. Whether this difference could be due to differential post-translational modifications of the protein was investigated. Mutations of appropriate residues showed that myristoylation of the protein was not necessary for enzyme activity. In contrast, inhibition of glycosylation of P69, by tunicamycin treatment of the insect cells, produced an enzymatically inactive protein. Recombinant P69 produced in insect cells was purified by affinity chromatography. It was a dimeric glycoprotein, very stable and completely dependent on double stranded (ds) RNA for activity. The enzyme catalyzed the non-processive synthesis of 2′-5′-linked oligoadenylate products containing up to 30 residues. 2′-O-Methylated dsRNA was incapable of activating P69 and a 25-base pair dsRNA was as effective as larger dsRNA. This expression system will be useful for large scale production of P69 and its mutants for structural studies. P69 is an isozyme of the medium size class of human 2′-5′ oligoadenylate synthetases. In this study, recombinant P69 was expressed and used for enzymological and structural investigations. Bacterially expressed P69 was inactive whereas the same protein expressed in insect cells was highly active. Whether this difference could be due to differential post-translational modifications of the protein was investigated. Mutations of appropriate residues showed that myristoylation of the protein was not necessary for enzyme activity. In contrast, inhibition of glycosylation of P69, by tunicamycin treatment of the insect cells, produced an enzymatically inactive protein. Recombinant P69 produced in insect cells was purified by affinity chromatography. It was a dimeric glycoprotein, very stable and completely dependent on double stranded (ds) RNA for activity. The enzyme catalyzed the non-processive synthesis of 2′-5′-linked oligoadenylate products containing up to 30 residues. 2′-O-Methylated dsRNA was incapable of activating P69 and a 25-base pair dsRNA was as effective as larger dsRNA. This expression system will be useful for large scale production of P69 and its mutants for structural studies. 2′-5′ Oligoadenylate (2-5(A)) 1The abbreviations used are: 2-5(A), 2′-5′ oligoadenylate; dsRNA, double-stranded RNA; poly(I):poly(C), polyinosinic acid:polycytidilic acid; PCR, polymerase chain reaction; bp, base pair(s); PKR, dsRNA activated protein kinase; ConA, concanavalin A; PAGE, polyacrylamide gel electrophoresis. 1The abbreviations used are: 2-5(A), 2′-5′ oligoadenylate; dsRNA, double-stranded RNA; poly(I):poly(C), polyinosinic acid:polycytidilic acid; PCR, polymerase chain reaction; bp, base pair(s); PKR, dsRNA activated protein kinase; ConA, concanavalin A; PAGE, polyacrylamide gel electrophoresis. synthetases are a family of enzymes that polymerize ATP into a series of 2′-5′-linked oligoadenylates (1Vilcek J. Sen G.C. Fields B.N. Knipe D.M. Howley P.M. Fields Virology. Lippincott-Raven Publishers, Philadelphia1996: 375-399Google Scholar, 2Hovanessian A.G. J. Interferon Res. 1991; 11: 199-205Crossref PubMed Scopus (149) Google Scholar). Trimers and higher oligomers of 2-5(A) can activate a latent ribonuclease, RNase L, by causing its dimerization (3Dong B. Silverman R.H. J. Biol. Chem. 1995; 270: 4133-4137Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). Cellular synthesis of the 2-5(A) synthetases is induced by interferons and viral infection of interferon-treated cells causes activation of the enzymes by viral dsRNA, production of 2-5(A), activation of RNase L, and degradation of RNA. This chain of events can prevent the replication of certain classes of viruses, such as picornaviruses, but other viruses are not affected by the 2-5(A) synthetase/RNase L pathway (4Gribaudo G. Lembo D. Cavallo G. Landolfo S. Lengyel P. J. Virol. 1991; 65: 1748-1757Crossref PubMed Google Scholar). According to their sizes, the 2-5(A) synthetases can be divided into three classes: large, medium, and small, and within each class there are many isozymes (2Hovanessian A.G. J. Interferon Res. 1991; 11: 199-205Crossref PubMed Scopus (149) Google Scholar). Multiple genes, alternative splicing of the mRNAs, and differential post-translational modification of the proteins add to the diversity of these enzymes. For example, in mouse, there are at least three genes encoding small synthetases and 9-2 and 3-9 isozymes are encoded by two alternately spliced mRNAs of the same gene (5Rutherford M.N. Kumar A. Nissim A. Chebath J. Williams B.R. Nucleic Acids Res. 1991; 19: 1917-1924Crossref PubMed Scopus (37) Google Scholar, 6Ghosh S.K. Kusari J. Bandyopadhyay S.K. Samanta H. Kumar R. Sen G.C. J. Biol. Chem. 1991; 266: 15293-15299Abstract Full Text PDF PubMed Google Scholar, 7Ichii Y. Fukunaga R. Shiojiri S. Sokawa Y. Nucleic Acids Res. 1986; 14: 10117Crossref PubMed Scopus (46) Google Scholar). Similarly, the human medium synthetase gene gives rise to two alternatively spliced mRNAs encoding the isozymes P69 and P71 (8Marie I. Hovanessian A.G. J. Biol. Chem. 1992; 267: 9933-9939Abstract Full Text PDF PubMed Google Scholar). The three classes of the enzymes are structurally related and highly conserved across the species. The small synthetases are homotetramers, the medium synthetases are dimers, and the large isozyme is a monomer (9Marie I. Svab J. Robert N. Galabru J. Hovanessian A.G. J. Biol. Chem. 1990; 265: 18601-18607Abstract Full Text PDF PubMed Google Scholar). These enzymes are interesting to study for many reasons: their interferon inducibility, their activation by dsRNA, their ability to synthesize 2′-5′-linked oligonucleotides, and their cellular actions. Structure-function and enzymological studies of 2-5(A) synthetases have not progressed well in the past because of the lack of an efficient expression system for recombinant proteins. Recently, we have used a bacterial system and a insect cell/baculovirus system effectively for producing a small isozyme of 2-5(A) synthetase and its mutants (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar, 11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The same systems were used in the current study for producing the recombinant medium synthetase P69. The recombinant P69 protein was purified and used for enzymological studies. Bacterially produced P69 was enzymatically inactive but recombinant P69 produced in insect cells was highly active, completely dependent of dsRNA, non-processive, and stable. The recombinant protein was a dimer and had sugar modifications that were required for its activity. A 25-bp dsRNA, but not a 15-bp dsRNA, could activate P69 maximally and free 2′-OH groups on the dsRNA were required for its activity. Total RNA was prepared using RNAzol (Tel-Test Inc.) from human Daudi cells treated with 200 units/ml interferon α for 12 h. This RNA were reverse transcribed by priming with random hexamers using reverse transcriptase kit (Life Technologies, Inc.) according to the manufacturer's instructions, followed by PCR using primers (primer 1: GGCCGAATTCCATATGATGGGAAATGGGGAGTCC; primer 2: CCGGGTCGACTTAAAGCTTGATGACTTTTACCGGCAC) specific to 5′ and 3′ end sequences of P69, respectively. The PCR cycles were (i) 95 °C for 5 min; (ii) 95 °C for 1 min, 50 °C for 2 min, 72 °C for 1 min (30 cycles); and (iii) 72 °C for 10 min. The full-length PCR product was purified by low melting-agarose gel electrophoresis and cloned into pCRII vector (TA cloning kit, Invitrogen). To examine the protein production from the construct, it was translated in vitro in rabbit reticulocyte lysate (TNT rabbit reticulocyte lysate system, Promega), and tested for 2-5(A) synthetase activity as mentioned earlier (12Ghosh A. Desai S.Y. Sarkar S.N. Ramaraj P. Ghosh S.K. Bandyopadhyay S. Sen G.C. J. Biol. Chem. 1997; 272: 15452-15458Crossref PubMed Scopus (31) Google Scholar). The PCR product was excised out from pCRII vector withNdeI and SalI, which were incorporated in the PCR primers for the convenience of subsequent cloning, and cloned into the same sites of pET28a vector (Novagen), which puts a hexahistidine tag at the NH2 terminus of P69. Bacterial expression and partial purification of NH2-terminal hexahistidine-tagged P69 was done in a similar way as described earlier for 9-2 (11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The yield of pure P69 protein from bacterial expression system was 5 μg/50 ml of culture. To be able to use convenient unique restriction enzyme sites on full-length P69 cDNA, it was subcloned in pGEM4 without any tag. For this purpose, the pET28a-P69 construct was used as a template for PCR. Two primers, the forward primer (GGAGATATACCATGGGAAATGGGGAG) containing a NcoI site overlapping with protein start codon and a reverse primer downstream ofBamHI site (nucleotides 873–892) were used to PCR a ∼900-bp fragment. The PCR product was Klenow filled and cloned into the SmaI site of pBluescript KS+. The insert was then excised out from pBluescript KS+ with NcoI andBamHI and swapped with the corresponding fragment of the pET28a-P69 construct. The full-length cDNA insert from the above construct was excised out with XbaI and SalI and subcloned into the EcoRI-SalI site of pGEM4. The resulting construct, called pGM13, contained full-length P69 cDNA without any NH2-terminal tag, and could be transcribed from the SP6 promoter of pGEM4. The G2A and G2D mutants were made using the pGM13 construct as template for PCR with similar forward primers as before having a NcoI site and the mutation (G to A or D) and the same reverse primer downstream of BamHI site (nucleotides 873–892). The 900-bp PCR products were Klenow filled and cloned into the SmaI site of pBluescript KS+. The mutated inserts were then excised out from pBluescript KS+ with NcoI and BamHI, swapped with the corresponding fragment on wild type cDNA in PGM13. The insect cell expression of P69 was done using the Bac-to-Bac Baculovirus expression system (Life Technologies) in a similar way as described earlier (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar, 13Ghosh A. Sarkar S.N. Guo W. Bandyopadhyay S. Sen G.C. J. Biol. Chem. 1997; 272: 33220-33226Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). The NH2-terminal hexahistidine-tagged P69 insert from pET28a was cloned into the XbaI andXhoI site of pFastBac. The recombinant baculovirus was produced according to Bac-to-Bac Baculovirus expression system instruction mannual. High Five (H5) cells (Invitrogen) were infected with the recombinant virus containing hexahistidine-tagged P69 at a multiplicity of infection of 10 and were harvested 32 were with in ml of for cells from containing 5 1 2 1 and 1 and by of cell lysate was prepared by at for min and to For 1 ml of cell a was to with the cell were in the 10 5 1 2 1 and 1 was with the the was to 10 and to the for at °C with on a 2 were and for min with three with A with the and at and and with with 30 was from the with 5 1 2 1 and 1 ml for 1 ml of cell The protein was then for 12 at yield of the purified protein was 5 protein was at °C in were done using the according to the manufacturer's A contained 1 P69 5 5 of activity and 50 in a and for at 30 The was by for 5 min at 95 The products were treated with for at and by A. Sarkar S.N. Guo W. Bandyopadhyay S. Sen G.C. J. Biol. Chem. 1997; 272: 33220-33226Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). the products were by gel electrophoresis on polyacrylamide gel in the of J. Interferon Res. 1991; 11: PubMed Scopus Google Scholar). from a was in of gel from which 2 of each was on and for at the of the the which the of the end of the the gel was on a with a and for 12 to a The of in each was using in a The of ATP by the enzyme for each was by the In a without the enzyme was in the which was in the same way as the the products by gel the in each was and with to the to for The in the was to 50 of in a 10 of The of ATP in each was then by the from 2-5(A) products with the In were and with appropriate using Inc.) P69 was used to the with and concanavalin A according to PubMed Scopus Google Scholar). of or was in the and protein was with the in of at °C with for 2 h. the end of the were in and in containing 1 proteins were by in 1 and on an P69 protein was by using To P69, insect cells were treated with 10 tunicamycin Baculovirus A W. H. 1 were harvested 30 and P69 protein was purified from the treated cells with an 5 The purified proteins were tested for glycosylation by their ability to and tested for 2-5(A) synthetase activity. proteins were size at on a 1 which was with a containing 5 5 and of wild type or protein was in of the above and to the and at a of were and protein from of each were by and by were with and P69 were for as a dsRNA of were made by the site of pBluescript KS+ as described earlier S.Y. Sen G.C. J. Interferon Res. 1997; PubMed Scopus (20) Google Scholar). These dsRNA were used in a to the activation of P69 activity. The dsRNA was as two pure stranded RNA using synthesis from The stranded were to the dsRNA (11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). For the of producing recombinant P69 we cloned its full-length by reverse chain using primers from the (8Marie I. Hovanessian A.G. J. Biol. Chem. 1992; 267: 9933-9939Abstract Full Text PDF PubMed Google Scholar). The cloned cDNA was expressed in the rabbit reticulocyte lysate system and vitro protein was enzymatically we have expressed 9-2 isozyme in (11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google bacterial expression of P69 was A hexahistidine-tagged protein was expressed in and it was purified by affinity 1 the expressed P69 protein was enzymatically inactive expressed and purified 9-2 isozyme was P69 from interferon-treated human cells is a protein (9Marie I. Svab J. Robert N. Galabru J. Hovanessian A.G. J. Biol. Chem. 1990; 265: 18601-18607Abstract Full Text PDF PubMed Google Scholar). myristoylation in rabbit reticulocyte but not in I. Biol. PubMed Scopus Google Scholar, PubMed Scopus Google the lack of activity of expressed P69 could be due to the lack of this modification of the protein. To examine myristoylation is for appropriate mutants of P69 were of a protein is by the at its NH2 terminus D. H. Biol. PubMed Scopus Google and mutation of the at 2 is to the proteins ability to be I. Biol. PubMed Scopus Google Scholar, N. D. P. G. J. Biol. PubMed Scopus Google Scholar). such mutants of P69, and G2D were and the corresponding proteins were in The proteins were as as the wild type protein that myristoylation is not required for enzyme activity. for a expressed protein to be inactive could be the of the hexahistidine tag at its This was out by the that made in vitro was enzymatically 2 the for the of the expressed P69 was not the above series of that the of the tag at the NH2 terminus or the of myristoylation not the enzyme activity. bacterial expression of recombinant P69 was we to it in insect cells using the baculovirus A recombinant encoding was for this Recombinant P69 protein was produced in the infected cells in large to be by of proteins in cell not The P69 protein was purified from the of the cell using affinity chromatography. This purification was very efficient an P69 as in A. A purification of the activity was by this with yield of recombinant as of ATP of cell purified as of ATP of in a the expressed P69, the recombinant P69 produced in insect cells was highly A series of 2-5(A) oligomers is by 2-5(A) synthetases. gel electrophoresis for the products by we have that small 9-2 isozyme is of to hexamers of 2-5(A) (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar). In contrast, the recombinant P69 protein was very efficient in higher oligomers of of the higher oligomers were to of 2-5(A) could be of P69 is a dimer (9Marie I. Svab J. Robert N. Galabru J. Hovanessian A.G. J. Biol. Chem. 1990; 265: 18601-18607Abstract Full Text PDF PubMed Google Scholar). The same was for the recombinant P69 purified from insect that the purified recombinant P69 had an of the of the P69 is it showed that the protein as a The protein of P69 the of sites in the protein. with to protein in that lack protein glycosylation to examine the glycosylation of P69 expressed in insect are to to purified P69 was to to two P69 to and but not to the These that P69 sugar To glycosylation of the protein is for its enzyme P69 was in insect cells because tunicamycin is to sugar modifications of P69 was purified from and cells as the protein purified from the cells not to its lack of The protein was enzymatically inactive that sugar modification of the P69 protein is required for producing an The of the recombinant protein were in the series of In these of products was used for the of 2-5(A) the enzyme activity with protein and of A and The protein was enzymatically 30 of not A that for ATP of this enzyme was A similar with of the dsRNA, that the purified protein was inactive without dsRNA and for the enzyme of was required The of the recombinant P69 protein are in of purified in a For other isozymes it that 2-5(A) is non-processive J. D. M.N. S. A. PubMed Scopus Google Scholar). The of synthesis of oligomers by P69 that the same was for this To examine the of P69, the in was 2-5(A) oligomers to the protein and the of the products made by enzyme and enzyme were The of the dsRNA required for P69 activation was in the series of dsRNA of were vitro and their ability to activate P69 was tested at a a 25-bp dsRNA was as as whereas a 15-bp dsRNA was efficient in activating the higher oligomers of 2-5(A) were in the of the 25-bp or dsRNA as with the 15-bp dsRNA A and of 2-5(A) synthesis in the of of that 25-bp dsRNA was as as the at tested product at each were very similar not for 15-bp dsRNA, the of synthesis was of that by and synthesis of the higher oligomers was very for the product with the the of the higher oligomers was at higher of the dsRNA a low of the 25-bp RNA produced the same product as a of the 15-bp RNA A of the dsRNA was tested in D. PKR, be activated by dsRNA Biochemistry. PubMed Scopus Google Scholar). To examine this is by P69, a dsRNA was at 50 this RNA could not activate the P69 protein it that free 2′-OH groups on the of the dsRNA are required for with the P69 isozyme of 2-5(A) synthetases. The 2-5(A) synthetases are interesting enzymes because of their two unique are activated by dsRNA and any other or RNA the of 2′-5′ of and structural of these enzymes by the lack of an of pure proteins. synthesis of 2-5(A) synthetases can be induced in cells by interferon many isozymes are induced and the cells not their expression at For these we to recombinant enzymes in expression such as or insect cells, that are not to the of 2-5(A) synthetases because lack the RNase of recombinant proteins to an ability that is for studies. we to a expression system of an protein that can be purified the medium isozyme P69 the small isozymes for medium, but not the small 2-5(A) polymerize of the medium synthetases are and to study structurally small synthetases that are was the with which the recombinant P69 could be have expressed a small in and insect cells (11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 13Ghosh A. Sarkar S.N. Guo W. Bandyopadhyay S. Sen G.C. J. Biol. Chem. 1997; 272: 33220-33226Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). systems produced enzymatically 9-2 proteins the expressed protein had a specific activity (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar). P69, a medium isozyme was expressed in of these expression the expressed P69 was enzymatically that this was because of the lack of post-translational modification of the protein expressed in the protein is to be a modification in we this modification was required for enzyme activity. appropriate study that this was not the Similarly, of P69 not to be the difference in the insect cells, we to in the protein by in of cells and then the P69 protein by the same expressed recombinant virus protein was highly not The protein modification that we tested was glycosylation because P69 that P69 in insect cells was and glycosylation was necessary for enzyme activity of the protein. studies will be to the lack of sugar modification of the protein J. Biol. Chem. 1997; 272: Full Text Full Text PDF PubMed Scopus Google or its and J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). these a for the of P69 expressed in which lack the ability to proteins. The insect cell system produced a yield of the recombinant P69 protein. It was to using the hexahistidine tag at its NH2 The P69 protein to the affinity that the of P69 is not This was the 9-2 isozyme that not to the same affinity (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar). The purified recombinant P69 protein had a specific activity and its for ATP and the dsRNA were similar to of the enzyme A.G. Svab J. I. Robert N. S. A.G. J. Biol. Chem. Full Text PDF PubMed Google Scholar). The of the recombinant P69 and 9-2 isozymes were very had for the specific were similar and the were The dsRNA for P69, 10 was the for proteins were their activity was of at 30 a difference in of the two the P69 isozyme 2-5(A) the 9-2 which and for produced higher but hexamers could be as its product activity (10Bandyopadhyay S. Ghosh A. Sarkar S.N. Sen G.C. Biochemistry. 1998; 37: 3824-3830Crossref PubMed Scopus (20) Google Scholar). In contrast, up to of 2-5(A) was by the P69 The of this difference in the of the two isozymes is at this The of the ability of P69 to synthesize higher 2-5(A) oligomers could be that the enzyme was highly to the to the protein their that chain The of from to the in the products produced a of and the in the of to that the is is in to the of I. J. D. Hovanessian A.G. J. 1997; PubMed Scopus Google that the P69 be a was on the that were for chain This is by that ATP is a or higher oligomers of a of ATP dimer and the of higher oligomers not In contrast, that the enzyme is non-processive is in with the earlier by J. D. M.N. S. A. PubMed Scopus Google that the enzyme purified from the reticulocyte lysate could use and of 2-5(A) as used the recombinant purified P69 protein for the of its The protein was inactive as such and or could not activate it not were the and there were specific for this activity. have that the small isozyme can be activated by as as and by RNA Desai S. J. Hovanessian A.G. Sen G. Williams B.R. Silverman R.H. Virology. PubMed Scopus Google and RNA (11Desai S.Y. Patel R.C. Sen G.C. Malhotra P. Ghadge G.D. Thimmapaya B. J. Biol. Chem. 1995; 270: 3454-3461Abstract Full Text Full Text PDF PubMed Scopus (57) Google which are not that the P69 isozyme can be activated maximally by a 25-bp dsRNA. P69 was activated well by or at the dsRNA 15-bp dsRNA, It was a at It that of the dsRNA be necessary for P69 and its This is of the of dsRNA for activation of PKR, class of enzyme Biol. 1992; PubMed Scopus Google Scholar). Similarly, Biochemistry. PubMed Scopus Google the lack of activation of P69 by dsRNA that free 2′-OH groups on the RNA are necessary for its a by its lack of activation by or These the two classes of 2-5(A) synthetase and were in of the of their the dsRNA of are not in PKR, but not P69, is at of dsRNA and of is as by the lack of of the at R.C. Sen G.C. J. Biol. Chem. 1992; 267: Full Text PDF PubMed Google Scholar). it is not P69, but not can synthesize 2-5(A) that 2-5(A) chain is a non-processive of 2-5(A) as of the be efficient for P69 In this it is interesting to that higher 2-5(A) by P69 was at low dsRNA or the was the 15-bp dsRNA A and it that of dsRNA with the P69 protein not its ability to the but its of such as ATP or 2-5(A)