Molecular Basis for the Constitutive Activity of Estrogen-related Receptor α-1

Some orphan nuclear receptors, including estrogen-related receptor α-1 (ERRα-1), can activate gene transcription in a constitutive manner. Little is known about the molecular basis of the constitutive activity of these receptors. Our results from site-directed mutagenesis experiments have revealed that Phe-329 (analogous to Ala-350 in estrogen receptor α (ERα)) is responsible for the constitutive activity of ERRα-1. The ERRα-1 mutant F329A lost the transactivation activity and acted as a dominant negative mutant. The mammalian cell transfection experiments revealed that the ERRα-1 mutant F329A, like wild-type ERα, recognized toxaphene (an organochlorine pesticide) as an agonist. This compound was previously shown to be an antagonist of wild-type ERRα-1. On the other hand, like wild-type ERRα-1, the ERα mutant A350F was found to be constitutively active (as demonstrated by mammalian cell transfection and yeast two-hybrid assays). These results indicate that Phe-329 in ERRα-1 and Ala-350 in ERα play important roles in both ligand binding and transactivation function. Some orphan nuclear receptors, including estrogen-related receptor α-1 (ERRα-1), can activate gene transcription in a constitutive manner. Little is known about the molecular basis of the constitutive activity of these receptors. Our results from site-directed mutagenesis experiments have revealed that Phe-329 (analogous to Ala-350 in estrogen receptor α (ERα)) is responsible for the constitutive activity of ERRα-1. The ERRα-1 mutant F329A lost the transactivation activity and acted as a dominant negative mutant. The mammalian cell transfection experiments revealed that the ERRα-1 mutant F329A, like wild-type ERα, recognized toxaphene (an organochlorine pesticide) as an agonist. This compound was previously shown to be an antagonist of wild-type ERRα-1. On the other hand, like wild-type ERRα-1, the ERα mutant A350F was found to be constitutively active (as demonstrated by mammalian cell transfection and yeast two-hybrid assays). These results indicate that Phe-329 in ERRα-1 and Ala-350 in ERα play important roles in both ligand binding and transactivation function. estrogen receptor human 17β-estradiol estrogen-related receptor α-1 glucocorticoid receptor-interacting protein 1 polymerase chain reaction chloramphenicol acetyl transferase estrogen response element Based on ligand binding properties, nuclear receptors can be classified into three types. The first type of nuclear receptor, including estrogen receptor (ER)1 and androgen receptor, is activated by specific ligands. The second type of receptor, similar to steroid and xenobiotic receptor, has a wide selectivity for ligands. The third type of receptor, like ERRα-1, is transcriptionally active in the absence of exogenous ligand. The third type of receptor has similar structural domain arrangements to the first and the second types of receptors. Little is known as to why receptors such as ERRα-1 are constitutively active. Our site-directed mutagenesis study has provided a molecular basis for the constitutive activity of ERRα-1. The cDNA for ERRα-1 was first isolated by screening cDNA libraries using probes corresponding to the DNA-binding domain of the human ERα (1Giguere V. Yang N. Segui P. Evans R.M. Nature. 1988; 331: 91-94Crossref PubMed Scopus (700) Google Scholar). Sequence alignment of ERRα-1, ERα, and ERβ reveals a strong similarity. In the ligand binding region, the amino acid sequence of ERRα-1 shows 36% identity when compared with ERα and 34% identity when compared with ERβ. However, ERRα-1 does not bind to any of the major classes of steroids, including estrogens and androgens (1Giguere V. Yang N. Segui P. Evans R.M. Nature. 1988; 331: 91-94Crossref PubMed Scopus (700) Google Scholar). Vanacker et al. (2Vanacker J.M. Bonnelye E. Chopin-Delannoy S. Delmarre C. Cavailles V. Laudet V. Mol. Endocrinol. 1999; 13: 764-773PubMed Google Scholar) suggested that ligands for ERRα-1 might be present in fetal calf serum, based on results that showed a lack of the ERRα-1 transactivation activity in ROS 17/2.8 cells under stripped serum conditions. Despite efforts from several laboratories, the physiological ligand for ERRα-1 has not yet been identified. Experimentally, ERRα-1 is transcriptionally active in the absence of exogenous hormone (see Fig. 2), and therefore, this receptor is generally considered to be a constitutive transcriptional activator protein. Utilizing yeast-based assays and mammalian transient transfection assays, we have recently found that two organochlorine pesticides, toxaphene and chlordane, can act as antagonists of ERRα-1 that suppress the constitutive activity of ERRα-1 (3Yang C. Chen S. Cancer Res. 1999; 59: 4519-4524PubMed Google Scholar). These findings are similar to those for the interaction of androstane metabolites with nuclear receptor CAR-β (4Forman B.M. Tzameli I. Choi H.-S. Chen J. Simha D. Seol W. Evans R.M. Moore D.D. Nature. 1998; 395: 612-615Crossref PubMed Scopus (439) Google Scholar). In contrast to the antagonistic action on ERRα-1, these pesticides have been reported to be weak agonists of ERα (5Soto A.M. Sonnenschein C. Chung K.L. Fernandez M.F. Olea N. Serrano F.O. Environ. Health Perspect. 1995; 103: 113-122Crossref PubMed Scopus (1606) Google Scholar). DNA sequencing kits were from United States Biochemical (Cleveland, Ohio). T4 kinase, T4 DNA ligase, and restriction endonucleases were purchased from New England Biolabs (Beverly, MA) and Roche Molecular Biochemicals. AmpliTaq polymerase was obtained from PerkinElmer Life Sciences. [14C]Chloramphenicol ([d-threo-(dichloroacetyl-1-14C)]) chloramphenicol (specific radioactivity, 55 mCi/mmol) was fromAmersham Pharmacia Biotech. The chloramphenicol acetyl transferase (CAT) expression vector, pUMSVOCAT, was a gift from Dr. K. Kurachi at the University of Michigan, Ann Arbor, Michigan. Oligonucleotide primers were synthesized in the DNA/RNA chemistry laboratory at the City of Hope. SK-BR-3 cells (ATCC (Manassas, VA)), derived from a human breast adenocarcinoma, were maintained in McCoy's 5A medium containing 10% fetal calf serum and glutamine. Estradiol and tamoxifen were purchased from Sigma. Toxaphene was kindly provided by Dr. Michael D. Shelby at the National Institute of Environmental Health Sciences. Dimethyl sulfoxide was from Mallinckrodt Chemical Works. The pSG5-GRIP1 was kindly provided by Dr. Michael R. Stallcup (University of Southern California, Los Angeles, CA). The ERE-TK-CAT plasmid was kindly provided by Dr. Ming-Jer Tsai (Baylor College of Medicine, Houston, TX). The mutants were generated by using a polymerase chain reaction (PCR)-based mutagenesis method described by Nelson and Long (6Nelson R.M. Long G.L. Anal. Biochem. 1989; 180: 147-151Crossref PubMed Scopus (294) Google Scholar). Briefly, the PCR mutagenesis for the ERRα1 mutant F329A used four primers: mutant Primer A for hERRα1/F329A, TGTGACCTCGCTGACCGAGAG (a forward primer with the mutated bases underlined); Primer B, GGGGTACTAGTAACCCGGGATCCTCAGTCCATCATGGCCTCGAG (a reverse hybrid primer containing a BamHI restriction site, a 3′-terminal 24-nucleotide sequence complementary to the ERRα-1 cDNA in the reverse strand that encodes for the carboxyl terminus, and a 5′-terminal 20-nucleotide unique sequence); Primer C, GACGGATCCGAATTCATGTCCAGCCAGGTGGTGGGCATTGAG (a forward primer containing an EcoRI restriction site and the cDNA sequence containing the first ATG site at the 5′-end); and Primer D, GGGGTACTAGTAACCCGGGA (a primer with a sequence that is identical to the 5′-terminal 20-nucleotide sequence of Primer B). PCR was carried out with a DNA Thermal Cycler 480 (PerkinElmer Life Sciences). For step 1, the reaction mixture (in 100 µl) contained 2.5 units ofTaq polymerase, 1 pmol of pSG5-hERRα-1 as template, and 100 pmol each of Primers A and B. The PCR cycles were 2 min at 95 °C to denature the template DNA, 2 min at 45 °C to allow the primers to anneal, and 2 min at 72 °C for DNA extension and cycled 30 times. The PCR product was resolved over 1% agarose gel and extracted by using the Qiagen Gel Extraction Kit (Qiagen Inc., Chatsworth, CA). The Step 2 reaction contained about 0.6 pmol of the Step 1 product and 1 pmol of pSG5-hERRα-1 and was run as a single cycle of 5 min at 95 °C, 2 min at 45 °C, and 10 min at 72 °C. Primers C and D were then added (100 pmol of each), and 30 additional PCR cycles were completed. The final PCR products were extracted and digested withEcoRI and BamHI. The resulting full-length mutant cDNA for hERRα1/F329A was ligated into the pSG5 expression vector. The sequence of the pSG5-F329A construct was confirmed by sequencing. The ERα mutant A350F was also prepared by the PCR-based mutagenesis approach. Plasmid pIC-ERF (purchased from ATCC), which contains the complete coding sequence of human ERα, was used as template. The sequences of Primers A(ER), B(ER), C(ER), and D(ER) to generate the full-length human ERα cDNA encoding hERα/A350F are: 5′-CTGACCAACCTGTTCGACAGGGAG-3′, 5′-GGGGTACTAGTAACCCGGGCGGATCCTCAGACTGTGGCAGGGAAACCCTC-3, 5′-GCGGAATTCGCCGCCGCCATGACCATGACCCTCCACACCAAAGC-3, and 5′-GGGGTACTAGTAACCCGGGC-3′, respectively. The PCR-amplified A350F-containing ERα cDNA fragment was digested withEcoRI and BamHI and subcloned into pSG5 vector through EcoRI and BamHI sites. The expression plasmid, pSG5-hERα, for the expression of wild-type human ERα, was generated as follows. The full-length coding region of human ERα was generated by PCR using Primers C(ER) and B(ER) (the same as those used in ER/A350F preparation) on template DNA, pIC-ERF. The PCR product was digested with EcoRI and BamHI and subcloned into pSG5 vector through EcoRI and BamHI sites. The yeast expression plasmids pGBT9-hERα/HBDWT and pGBT9-hERα/HBDA350F for the expression of Gal4DBD/hERαHBDWT and Gal4DBD/hERαHBDA350Ffusion proteins were constructed as follows. The coding regions for wild-type and A350F mutant containing human ERα hormone-binding domains (amino acids 279–595) were amplified by PCR using pSG5-hERα and pSG5-A350F as template DNA, respectively. The sequence of the forward primer is 5′-GCGGAATTCATGGAAGTGGGGTCTGCTGGAGAC-3′, and the reverse primer is Primer B(ER), the same as the one used for A350F preparation. The PCR products were digested with EcoRI andBamHI, and the digested DNA fragments were subcloned in frame into EcoRI- and BamHI-digested pGBT9 vector. The luciferase reporter plasmid that contains three copies of the ERE sequence, pGL3(ERE)3-luciferase, was constructed as follows. Two complimentary oligonucleotides for three tandem copies of ERE consensus sequences, 5′-AATTCCAGGTCAGAGTGACCTGAGCTAAAATACCAGGTCAGAGTGACCTGAGCTAAAATACCAGGTCAGAGTGACCTGAGCTAAAATAC-3′ and 5′-TCGAGTATTTTAGCTCAGGTCACTCTGACCTGGTATTTTAGCTCAGGTCACTCTGACCTGGTATTTTAGCTCAGGTCACTCTGACCTGG-3′, were synthesized, phosphorylated, annealed, filled in, and subcloned into pGL3 promoter vector through SmaI site. The sequences and the orientations of the inserts in all the constructs were confirmed by restriction digestion and DNA sequencing. The plasmid pGAD-GRIP1322–1121 was the kind gift of Dr. Michael R. Stallcup (University of Southern California, Los Angeles). SK-BR-3 cells were transfected with the CAT plasmids by the use of Lipofectin (Life Technologies, Inc.) according to the manufacturer's instructions. The co-transfection experiments were performed 20–24 h after seeding ∼4 × 105 cells per 60-mm tissue culture dish using 10 µg of the test plasmid and 3 µg of the plasmid pSV-β-Gal, which was used to normalize the transfection efficiency. The overall amount of total DNA in all transfections was the same by including appropriate amounts of the empty vector, pSG5, in addition to specific amounts of the test plasmids indicated in each experiment. After overnight incubation, medium containing Lipofectin and DNA was removed, and the cells were cultured in the regular growth medium. After a 24-h incubation, the cells were harvested from the plates by scraping, pelleted by centrifugation, resuspended in 0.25 mTris-HCl, pH 8.0, and disrupted by freeze-thawing three times. Aliquots of the lysate were used for an assay of β-galactosidase activity (7Rosenthal N. Methods Enzymol. 1987; 152: 705-720Google Scholar). The CAT activity in the cell extracts containing an equal amount of β-galactosidase activity from each sample was determined by the liquid scintillation counting method (8Seed B. Sheen J.Y. Gene (Amst.). 1988; 67: 271-277Crossref PubMed Scopus (830) Google Scholar). Briefly, the appropriate amount of cell extracts was incubated in a reaction containing14C-labeled chloramphenicol and n-butyryl coenzyme A. The reaction products were extracted with a small volume of xylene. The xylene phase was mixed with scintillant and counted in a scintillation counter. The CAT activity was expressed as relative activity compared with that of the pUMSVOCAT construct (1.0) and shown as the mean ± S.E. of three independent transient transfection experiments performed for each construct. For studying the interaction of ERRα-1 with ligands, SK-BR-3 cells were initially cultured in growth medium containing charcoal/dextran-treated serum for 1 week. Compounds were added 24 h after cDNA transfection and incubated for another 24 h. Cells were harvested after two washes with 1 × phosphate-buffered saline, and the CAT activity was measured. Transactivation analysis of wild-type ERα and its mutant A350F was performed using HeLa cells and SK-BR-3 cells as the host cells. The cells were transfected with a luciferase reporter plasmid pGL3(ERE)3-luciferase (0.25 µg) alone or along with 10 ng of pSG5-hERα or pSG5-A350F using Lipofectin in Opti-MEM medium. Five h after exposure to Lipofectin/DNA, the Lipofectin/DNA-containing medium was removed, and the cells were cultured in 5% charcoal/dextran-treated fetal bovine serum and 100 nm E2-containing medium. Twenty-four h after transfection, the cells were harvested, lysed, and subjected to protein assay. An aliquot of cell lysates containing the same amount of protein from all the samples was used for luciferase assay according to the manufacturer's instructions (Promega). The luciferase activities were expressed as the mean and standard deviation of three independent experiments. The interaction between the wild-type ERα hormone-binding domain or its mutant A350F with GRIP1 was demonstrated by the yeast two-hybrid assays. The yeast strain Y187 was co-transformed with pGBT9-hERα/HBDWT or pGBT9-hERα/HBDA350F and pGAD-GRIP1322–1121. The reporter β-galactosidase activities in transformants were measured following the published procedure (7Rosenthal N. Methods Enzymol. 1987; 152: 705-720Google Scholar). Homology models (9Blundell T.L. Sibanda B.L. Sternberg M.J. Thornton J.M. Nature. 1987; 326: 347-352Crossref PubMed Scopus (593) Google Scholar) were built using software marketed by Molecular Simulations Inc. (San Diego, CA). The agonist-bound form of ERRα-1 was modeled using the DES-bound form of the estrogen receptor as a template (Protein Data Bank 3ERD, Ref. 10Shiau A.K. Barstad D. Loria P.M. Cheng L. Kushner P.J. Agard D.A. Greene G.L. Cell. 1998; 95: 927-937Abstract Full Text Full Text PDF PubMed Scopus (2269) Google Scholar). The antagonist form was modeled using the tamoxifen-bound form (3ERT). We reviewed the amino acid sequence alignment between ERRα-1 and ERα (1Giguere V. Yang N. Segui P. Evans R.M. Nature. 1988; 331: 91-94Crossref PubMed Scopus (700) Google Scholar) and compared the corresponding residues in ERRα-1 with those in the ERα ligand-binding site that are in direct contact with E2, as shown by Tanenbaum et al. (11Tanenbaum D.M. Wang Y. Williams S.P. Sigler P.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5998-6003Crossref PubMed Scopus (597) Google Scholar) (Fig.1). We have found that 9 out of the 19 residues are identical. Seven residues are conservative changes. One critical difference is between Phe-329 in ERRα-1 and Ala-350 in ERα (Fig. 1). It was thought that this difference might be the cause of the differences in ligand binding properties between the two receptors. The phenyl group of Phe-329 in ERRα-1 could provide steric hindrance to prevent the binding of E2 to this receptor. To test our hypothesis, we prepared ERRα-1 mutants in which Phe-329 was replaced by the residues in ERα, i.e. F329A as well as the ERα mutant A350F. Studies from our laboratory have revealed that ERRα-1 up-regulates aromatase expression in human breast tissue by binding to a regulatory element, S1, that is situated near promoters I.3 and II of the human aromatase gene (12Yang C. Zhou D. Chen S. Cancer Res. 1998; 58: 5695-5700PubMed Google Scholar). Aromatase is an enzyme that converts androgens to estrogens. The DNA mobility assay revealed that the of the for the mutant F329A and wild-type ERRα-1 were similar not our that Phe-329 is situated in the ligand-binding not in the DNA-binding To the of the ERRα-1 we the SK-BR-3 human breast cells with the expression plasmid for ERRα-1 its along with a CAT reporter plasmid containing the aromatase fragment promoter I.3 and the ERRα-1 binding element as described in Ref. C. Zhou D. Chen S. Cancer Res. 1998; 58: 5695-5700PubMed Google Scholar). wild-type ERRα-1 promoter CAT activity as reported previously (12Yang C. Zhou D. Chen S. Cancer Res. 1998; 58: 5695-5700PubMed Google the mutant F329A the promoter activity F329A the wild-type ERRα-1 activity when were These results indicate that F329A, as a dominant negative the activity of wild-type ERRα-1. reported previously (3Yang C. Chen S. Cancer Res. 1999; 59: 4519-4524PubMed Google the nuclear the activity of ERRα-1 the of exogenous ligand. However, the F329A activity was not by the of The our that Phe-329 is situated in the ligand-binding site. It is known that such as with nuclear receptors at the ligand-binding domain when the receptor is in an binding It was not that an antagonist for ERRα-1 (3Yang C. Chen S. Cancer Res. 1999; 59: 4519-4524PubMed Google could act as an for F329A Toxaphene the F329A activity in a the same compound the wild-type the ERRα-1 mutant F329A in that toxaphene as a weak agonist. However, was found not to F329A activity in the of that could not F329A not is an for cells were transfected with pSG5-hERRα-1 or pSG5-F329A The transfected cells were incubated with toxaphene for h at the indicated After cells were with 1 × phosphate-buffered saline, the CAT activity was measured. The an of three independent experiments. To the of Phe-329 in ERRα-1, we and the ERα mutant A350F. Our mammalian cell transfection experiments (in both HeLa and SK-BR-3 have revealed that the ERα mutant A350F is transcriptionally active the addition of E2 In E2 was not to the transactivation that E2 bind to this ERα mutant. Our experiments have also found that A350F can in the absence of ligands 5 and These results indicate that the ERα mutant A350F in that is transcriptionally active in the absence of exogenous transactivation analysis of ERα mutant A350F in SK-BR-3 cells. that wild-type ERα with GRIP1 in the of The are identical to those described in Fig. Our yeast two-hybrid assay has found that the ERα mutant not wild-type ERα, has the to a promoter such as It was found that a receptor of the DNA-binding domain of to the ligand-binding domain of ERα with the A350F was transcriptionally active on a reporter Ala-350 in ERα is an domain (amino acids D. Mol. Scholar). structural of the ERα ligand-binding domain A.K. Barstad D. Loria P.M. Cheng L. Kushner P.J. Agard D.A. Greene G.L. Cell. 1998; 95: 927-937Abstract Full Text Full Text PDF PubMed Scopus (2269) Google D.M. Wang Y. Williams S.P. Sigler P.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5998-6003Crossref PubMed Scopus (597) Google A.M. L. Greene G.L. Nature. PubMed Scopus Google Scholar) have revealed that in response to ligand In the of E2 and other to a the of which of ligands and by and such as tamoxifen the from a that proteins A.K. Barstad D. Loria P.M. Cheng L. Kushner P.J. Agard D.A. Greene G.L. Cell. 1998; 95: 927-937Abstract Full Text Full Text PDF PubMed Scopus (2269) Google Scholar). obtained from the analysis of the two mutants described in this allow to we the of the of a physiological ligand for ERRα-1, this orphan receptor is transcriptionally active in the absence of ligands. A molecular of wild-type ERRα-1 reveals that the chain of Phe-329 might be to ligand the binding This to an active of protein a the receptor is constitutively active This has been by a at the in ERα shown in Fig. the phenyl chain the estrogen binding the of the in which when the is the A350F mutant is constitutively active. the ligand of wild-type ERRα-1 to be filled with we that toxaphene in the by when the active (Fig. B). Toxaphene as an antagonist of wild-type ERRα-1, and the of However, when is in the ligand the of Phe-329 to our that toxaphene can the (Fig. and as an which does when However, the is not to E2 or which our that these are not ligands for wild-type ERRα-1 or the F329A mutant not In does not a for protein For receptors, ligand binding is for the transcription Our results provide a structural basis as to why orphan receptors such as ERRα-1 are transcriptionally active in the absence of exogenous In ERRα-1, the phenyl chain of Phe-329 is situated in the ligand binding that the domain in an active In site-directed mutagenesis in the ligand binding of ERRα-1 the binding properties of the that this is a ligand of this receptor. Toxaphene is the by the United as antagonistic on ERRα-1 not be In addition to Phe-329 in ERRα-1 and Ala-350 in ERα, are two other differences between the ligand-binding site of ERRα-1 and that of are in ERRα-1, in ERα, in ERRα-1, and in ERα (Fig. 1). The ERRα-1 mutant has been generated and was found to have similar properties to the wild-type ERRα-1, that this is not as important as the of the mutant is similar to F329A not E2 was found not to be a ligand for the ERRα-1 mutant or The ERRα-1 mutant was also generated recently and found to be constitutively active. E2 toxaphene as a ligand of this mutant. is not that E2 is not a ligand of the results that is important for toxaphene mutagenesis experiments are carried out to the of in toxaphene