Luminal Chloride-dependent Activation of Endosome Calcium Channels

Although Ca2+ release from early endosomes (EE) is important for the fusion of primary endosomes, the presence of an ion channel responsible for releasing calcium from the EE has not been shown. A recent proteomics study has identified the TRPV2 channel protein in EE, suggesting that transient receptor potential-like Ca2+ channels may be in endosomes. The submicron size of endosomes has made it difficult to study their ion channels in the past. We have overcome this problem by generating enlarged EE with the help of a hydrolysis-deficient SKD1/VPS4B mutant in HEK293 cells. Here we report the first patch clamp recording of a novel endosome calcium channel (ECC) in these enlarged EE. The ECC shows a similar pharmacology to that of the TRPV2 channel. In addition, the ECC has a unique chloride-dependent regulation; it is inhibited by the endosome luminal chloride with a K50 of 82 mm. Although Ca2+ release from early endosomes (EE) is important for the fusion of primary endosomes, the presence of an ion channel responsible for releasing calcium from the EE has not been shown. A recent proteomics study has identified the TRPV2 channel protein in EE, suggesting that transient receptor potential-like Ca2+ channels may be in endosomes. The submicron size of endosomes has made it difficult to study their ion channels in the past. We have overcome this problem by generating enlarged EE with the help of a hydrolysis-deficient SKD1/VPS4B mutant in HEK293 cells. Here we report the first patch clamp recording of a novel endosome calcium channel (ECC) in these enlarged EE. The ECC shows a similar pharmacology to that of the TRPV2 channel. In addition, the ECC has a unique chloride-dependent regulation; it is inhibited by the endosome luminal chloride with a K50 of 82 mm. A number of TRP 2The abbreviations used are:TRPtransient receptor potentialEEearly endosomesECCendosome calcium channel2-APB2-aminoethoxydiphenyl borate[Cl-]lumendosome luminal chloride ion concentrationRuRruthenium redGFPgreen fluorescent proteinRTreverse transcriptionRhodrhodamineI-Vcurrent-voltage type calcium channels have been localized to intracellular vesicles; however, their physiological roles in situ have remained largely uncharacterized. The recent identification of the TRPV2 channel protein in an early endosomal fraction (1Wainszelbaum M.J. Proctor B.M. Pountow S.E. Stahl P.D. Barbieri A. Exp. Cell Res. 2006; 312: 2238-2251Crossref PubMed Scopus (50) Google Scholar) has raised the possibility of characterizing the physiological roles of the TRP-like channel in the native environment of the endosome membrane. To achieve this goal, it would be necessary to apply the patch clamp technique directly to endosome membranes. Past attempts at such studies have been unsuccessful, mainly because of the submicron size of endosomes. We have been able to increase the size of the endosome membrane by introducing a hydrolysis-deficient mutant of SKD1/VPS4B (E235Q) into HEK293 cells. Overexpression of SKD1/VPS4B (E235Q), which disrupts endosome trafficking (2Fujita H. Yamanaka M. Imamura K. Tanaka Y. Nara A. Yoshimori T. Yokota S. Himeno M. J. Cell Sci. 2003; 116: 401-414Crossref PubMed Scopus (109) Google Scholar), leads to the formation of large endosomes (3-6 μmin diameter) in HEK293 cells. Using these enlarged EE, we have made the first patch clamp recordings of a novel endosome calcium channel (ECC). This ECC was sensitive to >500 μm La3+ inhibition as reported in other TRP family channels, but was activated by 100 μm La3+ and by 200 μm 2-aminoethoxydiphenyl borate (2-APB), whereas being insensitive to TRPV1 activator capsaicin. Surprisingly ECC activity was affected by the endosome luminal chloride ion concentration ([Cl-]lum). [Cl-]lum inhibited ECC with a K50 of 82 mm. transient receptor potential early endosomes endosome calcium channel 2-aminoethoxydiphenyl borate endosome luminal chloride ion concentration ruthenium red green fluorescent protein reverse transcription rhodamine current-voltage HEK293 cells stably expressing the tetracycline-inducible SKD1/VPS4B (E235Q) gene (3Lin Y. Kimpler L.A. Naismith T.V. Lauer J.M. Hanson P.I. J. Biol. Chem. 2005; 280: 12799-12809Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar) were treated with tetracycline 4-6 h prior to the experiments. GFP-tagged SKD1/VPS4B (E235Q)-expressing cells were used to demonstrate co-localization of GFP-SKD1/VPS4B (E235Q) with endocytosed rhodamine sulfate. c-myc-SKD1/VPS4B (E235Q)-expressing cells were used to show Lysotracker Green negative staining in the rhodamine sulfate containing enlarged endosomes and were also used in patch clamp experiments. Enlarged endosomes of sizes from 3-6 μm were visually identified and dissected manually with a glass electrode. Under the phase contrast microscope, enlarged endosomes were viewed as phase-bright (see Fig. 1C, circled). To facilitate slicing of the plasma membrane with an electrode, cells with enlarged endosomes, closer to the edge of cells, were used because cell thickness increased toward the center. The electrode was pressed against the cell vertically and then was quickly pulled away from the cell to slice the cell membrane. Plating the cells on poly-l-lysine-treated cover glass prevented the cells from detaching from the cover glass. Multiple attempts (2-3 times) were required to free the enlarged endosomes from the cell. When successful, enlarged endosomes were seen as phase-dark spheres. Isolation was successful for 20-30% of attempts. Compared with cell membrane blebs, the surface of isolated enlarged endosomes looked slightly rough as if the surrounding structures such as actin filaments were still connected. The cell membrane blebs were usually bigger than enlarged endosomes, and their surface looked smooth. The patch pipette resistance was 5-6 megOhms. Following giga seal (>5 Gohm) formation, ion channel activities were examined in inside-out configurations. The whole endosome capacitance was 298.06 ± 149.03 femtofarad (n = 4), which corresponds to an EE diameter of 3-6 μm, if the lipid unit membrane capacitance is assumed to be 1 microfarad/cm2.An Ag/AgCl agar bridge was used as a ground electrode. The Ag/AgCl agar bridge eliminated a junction potential caused by varying Cl- in the bath solution. The solutions used were (in mm) a pipette solution (KCl 30, K2SO4 60, MgCl2 0.1, EGTA 0.5, HEPES 10, pH 7.20); a Na+-based solution (NaCl 145, KCl 5, CaCl2 1.8, MgCl2 1, HEPES 10, pH 7.2); a K+-based solution (KCl 150, MgCl2 0.1, HEPES 10, pH 7.2); and a K+-based low Cl- solution (KCl 30, K2SO4 60, MgCl2 0.1, HEPES 10, pH 7.2). For the chloride effects, [Cl-] was varied by mixing KCl 150 and K2SO4 75 in different ratios. Patch clamp data were analyzed with the Clampfit program (Axon Instruments), OriginPro 7 (OriginLab), and Sigmaplot 9.0 (Systat Software Inc.). The data were filtered with a low pass filter at 1 kHz for analysis and at 200 Hz for display. Single channel data were analyzed by plotting all point histograms. When multiple channel activities were observed, the mean of the channel amplitudes was plotted against the applied voltages. RT-PCR was carried out using HEK293 total RNA. The RNAs were reverse-transcribed using oligo(dT). The PCR reaction was done using a sense primer (TGCTGACGGGCCACATCCTTATCC) and nested antisense primers (First, AAGCCCAGTTCACCTCCTCCAC; second, GCCCCGTTGCCCTCGTCCTC). The hTRPV2 cDNA was used as a positive control. The PCR result was analyzed using 1% agarose gel, and the DNAs were visualized with ethidium. Using artificial bilayer reconstitution, the biophysical and pharmacological properties of intracellular TRP channels from the endoplasmic reticulum membrane (4Gonzalez-Perrett S. Kim K. Ibarra C. Damiano A.E. Zotta E. Batelli M. Harris P.C. Reisin I.L. Arnaout M.A. Cantiello H.F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 1182-1187Crossref PubMed Scopus (398) Google Scholar, 5Gonzalez-Perrett S. Batelli M. Kim K. Essafi M. Timpanaro G. Moltabetti N. Reisin I.L. Arnaout M.A. Horacio F. J. Biol. Chem. 2002; 277: 24959-24966Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) and the lysosomal membrane (6Raychowdhury M.K. González-Perrett S. Montalbetti N. Timpanaro G.A. Chasan B. Goldmann W.H. Stahl S. Cooney A. Goldin E. Cantiello H.F. Hum. Mol. Genet. 2004; 13: 617-627Crossref PubMed Scopus (118) Google Scholar) have been examined. TRPV5 and TRPV6 localization has been seen in rab11 positive recycling endosomes (7van de Graaf S.F.J. Chang Q. Mensenkamp A.R. Hoenderop J.G.J. Bindels R.J.M. Mol. Cell. Biol. 2006; 26: 303-312Crossref PubMed Scopus (105) Google Scholar). However, little is known about their functional properties in native endosomal membranes. Recently the TRPV2 channel protein was identified in rab5 positive early endosomes in IL4/PGE2-treated J774 cells. Newly endocytosed primary endosomes undergo Ca2+-dependent fusion to become early endosomes (EE) (8Gruenberg J. Nat. Rev. Mol. Cell Biol. 2001; 2: 721-730Crossref PubMed Scopus (583) Google Scholar, 9Maxfield F.R. McGraw T.E. Nat. Rev. Mol. Cell Biol. 2004; 5: 121-132Crossref PubMed Scopus (1514) Google Scholar). Various reports suggest that the EE itself function as the Ca2+ source (10Colombo M.I. Beron W. Stahl P.D. J. Biol. Chem. 1997; 272: 7707-7712Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 11Yan Q. Sun W. McNew J.A. Vida T.A. Bean A.J. J. Biol. Chem. 2004; 279: 18270-18276Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 12Holroyd C. Kistner U. Annaert W. Jahn R. Mol. Biol. Cell. 1999; 10: 3035-3044Crossref PubMed Scopus (71) Google Scholar). Although Ca2+ release through ion channels in EE has not been shown, the presence of TRPV2 protein in EE (1Wainszelbaum M.J. Proctor B.M. Pountow S.E. Stahl P.D. Barbieri A. Exp. Cell Res. 2006; 312: 2238-2251Crossref PubMed Scopus (50) Google Scholar) and in intracellular vesicles (13Kanzaki M. Zhang Y.Q. Mashima H. Shibata H. Kojima I. Nat. Cell Biol. 1999; 1: 165-170Crossref PubMed Scopus (409) Google Scholar, 14Hellwig N. Albrecht N. Harteneck C. Schultz G. Schaefer M. J. Cell Sci. 2004; 118: 917-928Crossref Scopus (246) Google Scholar) suggests that the ECC could be a TRP-like channel. Newly formed EE membranes are exposed to two distinct environments. One environment is the EE lumen, which contains an endocytosed extracellular high Cl- and high Ca2+ solution, and the other is the cytosolic environment, which contains low Cl- and low Ca2+. The difference in ionic compositions between the two leads to a time-dependent release of Cl- and Ca2+ ions from the EE (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar, 16Gerasimenko J.V. Tepikin A.V. Petersen O.H. Gerasimenko O.V. Curr. Biol. 1998; 8: 1335-1338Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). ClC type Cl- channels (i.e. ClC-5) are reported to regulate the Cl- movement. They are localized in the EE, and a disruption of the ClC-5 gene causes a dramatic slowing of endocytosis and reduced endosome acidification (17Piwon N. Gunther W. Schwake M. Bosl M.R. Jentsch T.J. Nature. 2000; 408: 369-373Crossref PubMed Scopus (482) Google Scholar, 18Jentsch T.J. Maritzen T. Zdebik A.A. J. Clin. Investig. 2005; 115: 2039-2046Crossref PubMed Scopus (113) Google Scholar). On the other hand, study has been reported the the of an endosome Ca2+ channel. To such a a patch clamp study of the native EE membrane is however, the submicron size of and of to the EE membrane have prevented such an We have overcome this by generating enlarged EE μm in diameter) with the help of a hydrolysis-deficient SKD1/VPS4B (E235Q) (2Fujita H. Yamanaka M. Imamura K. Tanaka Y. Nara A. Yoshimori T. Yokota S. Himeno M. J. Cell Sci. 2003; 116: 401-414Crossref PubMed Scopus (109) Google Scholar) in HEK293 cells (3Lin Y. Kimpler L.A. Naismith T.V. Lauer J.M. Hanson P.I. J. Biol. Chem. 2005; 280: 12799-12809Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The SKD1/VPS4B membrane trafficking at the early endosome junction between and recycling endosomes (2Fujita H. Yamanaka M. Imamura K. Tanaka Y. Nara A. Yoshimori T. Yokota S. Himeno M. J. Cell Sci. 2003; 116: 401-414Crossref PubMed Scopus (109) Google Scholar, Y. Kimpler L.A. Naismith T.V. Lauer J.M. Hanson P.I. J. Biol. Chem. 2005; 280: 12799-12809Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, M.A. 2005; PubMed Scopus Google Scholar). HEK293 cells expressing SKD1/VPS4B (E235Q) formed enlarged EE which were a phase contrast When the cells were with containing rhodamine sulfate these enlarged EE the This suggests that formed primary endosomes to to the enlarged EE of SKD1/VPS4B containing enlarged EE were not by the Lysotracker of with the containing solution containing endosomes the SKD1/VPS4B (E235Q) and to become by Lysotracker Fig. circled). This suggests that SKD1/VPS4B (E235Q) the of enlarged EE, and the enlarged EE not these we that these large EE. We then a to manually the containing enlarged EE using a glass pipette (see Fig. This to for patch clamp enlarged EE were in the and inside-out patch clamp in the EE luminal Cl- and Ca2+ show that of EE formation, luminal Cl- is to the (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google and a of luminal Ca2+ to the J.V. Tepikin A.V. Petersen O.H. Gerasimenko O.V. Curr. Biol. 1998; 8: 1335-1338Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). For that we a in [Cl-]lum ECC chloride in the bath from 150 to a physiological in [Cl-]lum was using inside-out EE that exposed their luminal surface to bath solution. we the bath [Cl-] to the of the ECC A and 7 out of This was inhibited by a TRP channel La3+ (n = La3+ inhibited the to ± Fig. A and also Fig. A and To the ion of this ion were carried luminal with not the potential however, with an in a of the suggesting that this endosome channel was a channel and In mm) this channel a of (n = ECC is a Ca2+ channel. in ECC was by the bath [Cl-] to with Ca2+ in the bath in a Ca2+ the Ca2+ and the were by La3+ were at and The potential was Ca2+ was = low [Cl-] activated ECC = and inhibition by La3+ pH ECC to from to in are shown. ECC is activated as pH is reduced from 7 to and then to of and ECC pH of pH and of low Cl- on the ECC channel In the solution the ECC activity was seen = Cl- and pH increased to the solution to the Cl- whereas the pH in reduced ECC activity = On to the ECC was inhibited = all point of in E. The of two The on the a and the on the by an of ECC the endosome channel chloride channel activities were examined in to varied chloride 150 to in and The were to a analysis The K50 for ECC chloride was to be 82 mm. The Ca2+ demonstrate this endosome channel was a Ca2+ Ca2+ was examined. The from = to was with Ca2+ in the bath solution Ca2+ = A Ca2+ was seen and was inhibited by La3+ A and the difference in the calcium was to be = J. Scopus Google Scholar) (see pH the has been that the lysosomal (6Raychowdhury M.K. González-Perrett S. Montalbetti N. Timpanaro G.A. Chasan B. Goldmann W.H. Stahl S. Cooney A. Goldin E. Cantiello H.F. Hum. Mol. Genet. 2004; 13: 617-627Crossref PubMed Scopus (118) Google Scholar) and intracellular are inhibited by pH (4Gonzalez-Perrett S. Kim K. Ibarra C. Damiano A.E. Zotta E. Batelli M. Harris P.C. Reisin I.L. Arnaout M.A. Cantiello H.F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 1182-1187Crossref PubMed Scopus (398) Google Scholar, 5Gonzalez-Perrett S. Batelli M. Kim K. Essafi M. Timpanaro G. Moltabetti N. Reisin I.L. Arnaout M.A. Horacio F. J. Biol. Chem. 2002; 277: 24959-24966Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). In as in Fig. and ECC activity was (n = the luminal surface of EE patch membranes was exposed to pH and EE pH is reported to be (8Gruenberg J. Nat. Rev. Mol. Cell Biol. 2001; 2: 721-730Crossref PubMed Scopus (583) Google Scholar, 9Maxfield F.R. McGraw T.E. Nat. Rev. Mol. Cell Biol. 2004; 5: 121-132Crossref PubMed Scopus (1514) Google Scholar, N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar, M. G. J. 2001; PubMed Scopus Google that ECC activity is by Cl- concentration and pH we examined the two would ECC channel and Under ECC activity was seen = Following a to low Cl- and pH the channel was activated and increased to the solution to Cl- whereas the pH in reduced ECC activity = This that ECC could be activated by pH of by Cl- to pH the ECC channel was inhibited = ECC and TRP TRP family channels C. Schultz G. Rev. 2005; PubMed Scopus Google Scholar), calcium channel (13Kanzaki M. Zhang Y.Q. Mashima H. Shibata H. Kojima I. Nat. Cell Biol. 1999; 1: 165-170Crossref PubMed Scopus (409) Google Scholar), (4Gonzalez-Perrett S. Kim K. Ibarra C. Damiano A.E. Zotta E. Batelli M. Harris P.C. Reisin I.L. Arnaout M.A. Cantiello H.F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 1182-1187Crossref PubMed Scopus (398) Google Scholar, 5Gonzalez-Perrett S. Batelli M. Kim K. Essafi M. Timpanaro G. Moltabetti N. Reisin I.L. Arnaout M.A. Horacio F. J. Biol. Chem. 2002; 277: 24959-24966Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar), and (6Raychowdhury M.K. González-Perrett S. Montalbetti N. Timpanaro G.A. Chasan B. Goldmann W.H. Stahl S. Cooney A. Goldin E. Cantiello H.F. Hum. Mol. Genet. 2004; 13: 617-627Crossref PubMed Scopus (118) Google Scholar) are in intracellular known TRP such as ruthenium red and La3+ were for their to ECC of ECC by La3+ are in and (n = mm) inhibited ECC activity Fig. also inhibited ECC inhibition with and We that the ECC was of a low concentration of of 100 μm La3+ has been to the S. A. Schaefer M. R. Schultz G. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar), the possibility that 100 μm La3+ could as an ECC activator was examined and the of ECC activities were and were at negative The of 100 μm La3+ in the of ECC The was at positive (n = Fig. and ECC were also by with 100 μm La3+ out of To the of the of a activator of channels Q. C. T. M. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar), was examined. of 200 μm by than ECC that been activated by 100 μm La3+ (n = Fig. and The activator in as high as μm (n = on ECC which still could be activated by 100 μm La3+ TRPV2 in HEK293 the pharmacological of ECC are closer to of than of other known TRP channels (see we to TRPV2 was in HEK293 cells. This was examined by RT-PCR of HEK293 total RNA. to hTRPV2 a from HEK293 total that was in size to the made from hTRPV2 cDNA of ECC in of endocytosis the EE [Cl-]lum is reduced to (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar). This in the EE [Cl-]lum is to be a of the of Cl- channels K. B. M. A. Jentsch T.J. J. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) in the EE membranes (i.e. membrane which have on a large in the extracellular in primary endosomes (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar). negative which a potential in the endosome (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar, M. G. J. 2001; PubMed Scopus Google Scholar), not become a for Cl- to the endosomes but also the of the through the membrane. The plasma membrane extracellular from cytosolic membrane this plasma membrane an endosome membrane and the endosomal luminal from the (see and also Fig. the through the membrane the Cl- channels in the endosome membrane sense this as an these negative with pH prevented [Cl-]lum (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar), suggesting that the potential could be the of chloride channel prior to [Cl-]lum This also inhibited acidification of endosomes (15Sonawane N.D. Verkman A.S. J. Cell Biol. 2003; 160: 1129-1138Crossref PubMed Scopus (63) Google Scholar). reduced endosome acidification and a dramatic slowing of endocytosis were also the ClC-5 endosome chloride channel gene was (17Piwon N. Gunther W. Schwake M. Bosl M.R. Jentsch T.J. Nature. 2000; 408: 369-373Crossref PubMed Scopus (482) Google Scholar, 18Jentsch T.J. Maritzen T. Zdebik A.A. J. Clin. Investig. 2005; 115: 2039-2046Crossref PubMed Scopus (113) Google Scholar). Gerasimenko J.V. Tepikin A.V. Petersen O.H. Gerasimenko O.V. Curr. Biol. 1998; 8: 1335-1338Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar) have reported that the in endosomes. extracellular Ca2+ inhibited the acidification of endosomes endocytosis J.V. Tepikin A.V. Petersen O.H. Gerasimenko O.V. Curr. Biol. 1998; 8: 1335-1338Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar), which suggests that acidification of endosomes is also on the of Ca2+ from endosomes. it that a of luminal Cl- and the endosomes not and endosome are (8Gruenberg J. Nat. Rev. Mol. Cell Biol. 2001; 2: 721-730Crossref PubMed Scopus (583) Google Scholar, 9Maxfield F.R. McGraw T.E. Nat. Rev. Mol. Cell Biol. 2004; 5: 121-132Crossref PubMed Scopus (1514) Google Scholar). primary endosomes to early endosomes in a Ca2+-dependent if that this Ca2+ from the primary endosomes is responsible for the endosome then the of the low Cl- and ECC in Ca2+ release One of this data is that Ca2+ release through ECC endosome fusion and the of EE luminal calcium (10Colombo M.I. Beron W. Stahl P.D. J. Biol. Chem. 1997; 272: 7707-7712Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 11Yan Q. Sun W. McNew J.A. Vida T.A. Bean A.J. J. Biol. Chem. 2004; 279: 18270-18276Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 12Holroyd C. Kistner U. Annaert W. Jahn R. Mol. Biol. Cell. 1999; 10: 3035-3044Crossref PubMed Scopus (71) Google Scholar) and calcium release S. M.J. J. Cell Sci. 2001; PubMed Google Scholar) in EE fusion this ECC the TRPV2 was the channel protein that was in the proteomics study of the rab5 positive early endosomal fraction suggesting in early endosomes. RT-PCR TRPV2 in HEK293 cells it is that TRPV2 may be responsible for the ECC ECC was inhibited by μm to 1 and are other TRP and was by 100 μm and 200 μm TRPV2 was to a with TRPV1 N. Albrecht N. Harteneck C. Schultz G. Schaefer M. J. Cell Sci. 2004; 118: 917-928Crossref Scopus (246) Google Scholar). are by Q. C. T. M. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar). The of ECC to a TRPV1 the possibility of TRPV1 in the ECC The concentration used for was than the reported for TRPV2 and we out the of However, the reported biophysical properties of C. Schultz G. Rev. 2005; PubMed Scopus Google Scholar) are different from of The of is as high as that of ECC and the Ca2+ of is than that of ECC = are not to be the ECC because are to Q. C. T. M. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar). is TRP channel that is activated by in the μm M. J. J. 2006; PubMed Scopus Google Scholar). However, it is not that TRPV2 a channel with the are reports of of channels by 100 μm but it has been seen in and Q. C. T. M. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar). to 100 μm La3+ and but concentration of La3+ the Ca2+ of the ECC to = was slightly but with that of TRPV2 = M.J. T.A. M. A.J. Nature. 1999; PubMed Scopus Google Scholar). The pharmacological between the ECC and the with the proteomics study (1Wainszelbaum M.J. Proctor B.M. Pountow S.E. Stahl P.D. Barbieri A. Exp. Cell Res. 2006; 312: 2238-2251Crossref PubMed Scopus (50) Google Scholar), suggests that the ECC is a of the TRPV2 channel a TRP gene family channel. In the successful patch clamp analysis of enlarged endosomes a novel endosome calcium channel. This to ion channels in the native membrane environment to a of their physiological in whole endosome We C. W. and A. for and A. and S. for the