The Structure of the Extracellular Domain of Triggering Receptor Expressed on Myeloid Cells Like Transcript-1 and Evidence for a Naturally Occurring Soluble Fragment

Triggering receptor expressed on myeloid cells like transcript-1 (TLT-1) is an abundant platelet-specific, type I transmembrane receptor. The extracellular fragment of TLT-1 consists of a single, immunoglobulin-like domain connected to the platelet cell membrane by a linker region called the stalk. Here we present evidence that a soluble fragment of the TLT-1 extracellular domain is found in serum of humans and mice and that an isoform of similar mass is released from platelets following activation with thrombin. We also report the crystal structure of the immunoglobulin domain of TLT-1 determined at the resolution of 1.19 Å. The structure of TLT-1 is similar to other immunoglobulin-like variable domains, particularly those of triggering receptor expressed on myeloid cells-1 (TREM-1), the natural killer cell-activating receptor NKp44, and the polymeric immunoglobulin receptor. Particularly interesting is a 17-amino acid segment of TLT-1, homologous to a fragment of murine TREM-1, which, in turn, showed activity in blocking the TREM-1-mediated inflammatory responses in mice. Structural similarity to TREM-1 and polymeric immunoglobulin receptor, and evidence for a naturally occurring soluble fragment of the TLT-1 extracellular domain, suggest that this immunoglobulin-like domain autonomously plays an as yet unidentified, functional role. Triggering receptor expressed on myeloid cells like transcript-1 (TLT-1) is an abundant platelet-specific, type I transmembrane receptor. The extracellular fragment of TLT-1 consists of a single, immunoglobulin-like domain connected to the platelet cell membrane by a linker region called the stalk. Here we present evidence that a soluble fragment of the TLT-1 extracellular domain is found in serum of humans and mice and that an isoform of similar mass is released from platelets following activation with thrombin. We also report the crystal structure of the immunoglobulin domain of TLT-1 determined at the resolution of 1.19 Å. The structure of TLT-1 is similar to other immunoglobulin-like variable domains, particularly those of triggering receptor expressed on myeloid cells-1 (TREM-1), the natural killer cell-activating receptor NKp44, and the polymeric immunoglobulin receptor. Particularly interesting is a 17-amino acid segment of TLT-1, homologous to a fragment of murine TREM-1, which, in turn, showed activity in blocking the TREM-1-mediated inflammatory responses in mice. Structural similarity to TREM-1 and polymeric immunoglobulin receptor, and evidence for a naturally occurring soluble fragment of the TLT-1 extracellular domain, suggest that this immunoglobulin-like domain autonomously plays an as yet unidentified, functional role. Triggering receptor expressed on myeloid cells like transcript-1 (TLT-1) 2The abbreviations used are: TLT-1, triggering receptor expressed on myeloid cells like transcript-1; TREM, triggering receptor expressed on myeloid cell; hTLT-1, human TLT-1; mTLT-1, murine TLT-1; YFP, yellow fluorescent protein; ESI-MS, electrospray ionization-mass spectrometry; pIgR, polymeric immunoglobulin receptor; r.m.s.d., root mean square deviation; CDR, complementarity determining region. is a membrane-bound protein, abundant in the α-granules of resting platelets and on the surface of activated platelets (1Washington A.V. Schubert R.L. Quigley L. Disipio T. Feltz R. Cho E.H. McVicar D.W. Blood. 2004; 104: 1042-1047Crossref PubMed Scopus (92) Google Scholar). The gene that codes for TLT-1 is located in the TREM gene cluster on human chromosome 6, locus 6p21.1, and murine chromosome 17. Related genes in the human TREM gene cluster include TREMs 1 and 2, TLTs 1 through 5, and the natural killer cell-activating receptor NKp44 (2Allcock R.J. Barrow A.D. Forbes S. Beck S. Trowsdale J. Eur. J. Immunol. 2003; 33: 567-577Crossref PubMed Scopus (131) Google Scholar). In the murine genome, chromosome 17 includes genes encoding TREMs 1 through 5, and TLTs 1 and 2 (2Allcock R.J. Barrow A.D. Forbes S. Beck S. Trowsdale J. Eur. J. Immunol. 2003; 33: 567-577Crossref PubMed Scopus (131) Google Scholar). Gene products from the TREM gene cluster are expressed in specific populations of cells of the myeloid lineage. To date, only TREM-1, TREM-2, NKp44, and TLT-1 have been characterized. The immunoglobulin-like domain of human TLT-1 (hTLT-1) consists of 105 residues and is attached to the membrane by a 37-amino acid stalk. The putative transmembrane segment of hTLT-1 is 20 amino acids long and lacks the positively charged amino acid that other TREM family members use to interact with a negatively charged side chain of the adaptor molecule DAP12 (3Colonna M. Nat. Rev. Immunol. 2003; 3: 445-453Crossref PubMed Scopus (540) Google Scholar). Inside the membrane-spanning region, DNAX activation protein 12 contains a signaling motif known as an immunoreceptor tyrosine-based activation motif (3Colonna M. Nat. Rev. Immunol. 2003; 3: 445-453Crossref PubMed Scopus (540) Google Scholar). Two cDNA sequences, which code for proteins with identical extracellular and membrane-spanning regions but different cytoplasmic domains (2Allcock R.J. Barrow A.D. Forbes S. Beck S. Trowsdale J. Eur. J. Immunol. 2003; 33: 567-577Crossref PubMed Scopus (131) Google Scholar), have been reported for hTLT-1. The shorter transcript has a cytoplasmic domain of 18 amino acids with no recognizable signaling motifs, and the cytoplasmic domain of the longer hTLT-1 transcript consists of 127 amino acids, including two tyrosine residues. Both cytoplasmic tyrosines are found in sequence motifs known as immunoreceptor tyrosine-based inhibitory motifs (4Washington A.V. Quigley L. McVicar D.W. Blood. 2002; 100: 3822-3824Crossref PubMed Scopus (52) Google Scholar). TLT-1, carrying two immunoreceptor tyrosine-based inhibitory motifs, is the only product of the TREM gene cluster with known signaling motifs. Crystal structures of the previously determined immunoglobulin-like domains from several TREM family receptors include NKp44 (PDB code 1HKF) (5Cantoni C. Ponassi M. Biassoni R. Conte R. Spallarossa A. Moretta A. Moretta L. Bolognesi M. Bordo D. Structure (Camb). 2003; 11: 725-734Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar), murine TREM-1 (mTREM-1) (1U9K) (6Kelker M.S. Debler E.W. Wilson I.A. J. Mol. Biol. 2004; 344: 1175-1181Crossref PubMed Scopus (24) Google Scholar), and two crystal structures of human TREM-1 (hTREM-1) (1Q8M and 1SMO) (7Radaev S. Kattah M. Rostro B. Colonna M. Sun P.D. Structure (Camb). 2003; 11: 1527-1535Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 8Kelker M.S. Foss T.R. Peti W. Teyton L. Kelly J.W. Wuthrich K. Wilson I.A. J. Mol. Biol. 2004; 342: 1237-1248Crossref PubMed Scopus (55) Google Scholar). Recently, TREM-1 and TREM-2 gained attention because of their potential involvement in human diseases. The presence of soluble TREM-1 in human serum has been shown to be a specific marker of bacterial infection (9Gibot S. Cravoisy A. Clin. Med. Res. 2004; 2: 181-187Crossref PubMed Scopus (111) Google Scholar), and TREM-1 expression patterns appear to correlate with survival of patients with sepsis (10Gibot S. Le Renard P.E. Bollaert P.E. Kolopp-Sarda M.N. Bene M.C. Faure G.C. Levy B. Intensive Care Med. 2005; 31: 594-597Crossref PubMed Scopus (90) Google Scholar). Mutations of TREM-2 cause a rare genetic disorder in humans called Nasu-Hakola disease (11Cella M. Buonsanti C. Strader C. Kondo T. Salmaggi A. Colonna M. J. Exp. Med. 2003; 198: 645-651Crossref PubMed Scopus (192) Google Scholar). Studies using a murine model of septic shock have demonstrated an interesting paradigm for TREM-1 function: Expression of surface-bound TREM-1 is up-regulated in response to bacterial infection, resulting in increased production of pro-inflammatory cytokines and leading to an immune response against the potential pathogen. However, overreaction of the immune system can cause septic shock. A recent study showed that administration of either the intact immunoglobulin-like domain of murine TREM-1 or a specific 17-amino acid peptide fragment of mTREM-1 resulted in decreased production of pro-inflammatory cytokines and protected mice from death caused by septic shock (12Gibot S. Kolopp-Sarda M.N. Bene M.C. Bollaert P.E. Lozniewski A. Mory F. Levy B. Faure G.C. J. Exp. Med. 2004; 200: 1419-1426Crossref PubMed Scopus (312) Google Scholar). Thus, the mTREM-1 immunoglobulin-like domain apparently blocks the signal produced by surface-bound mTREM-1 (12Gibot S. Kolopp-Sarda M.N. Bene M.C. Bollaert P.E. Lozniewski A. Mory F. Levy B. Faure G.C. J. Exp. Med. 2004; 200: 1419-1426Crossref PubMed Scopus (312) Google Scholar). While examining the expression patterns of murine TLT-1 (mTLT-1) during platelet activation, we observed the time-dependent production of a smaller form of mTLT-1. Here, we present evidence that soluble species of TLT-1 can be found in murine and human serum. To build a strong foundation for future characterization of TLT-1 function, we crystallized a recombinant fragment of the hTLT-1 immunoglobulin-like domain consisting of residues 20-125, and determined its crystal structure at the resolution of 1.19 Å. Human embryonic kidney (HEK) 293T cells were maintained and transfected as described earlier (13Paul S.P. Taylor L.S. Stansbury E.K. McVicar D.W. Blood. 2000; 96: 483-490Crossref PubMed Google Scholar). Expression plasmids for mTLT-1 and characterization of full-length murine TLT-1 (mTLT-1) were previously described (13Paul S.P. Taylor L.S. Stansbury E.K. McVicar D.W. Blood. 2000; 96: 483-490Crossref PubMed Google Scholar). The expression plasmid for mTLT-1 was tagged at the carboxyl terminus with a yellow fluorescent protein (YFP) fragment using PCR. Primers used for amplification included: forward, gtttaaacatgtgatggtgagcaagggcgaggag, and reverse, cggcacatgtggcagtcgtccatgccgagagtg. The PCR product was digested with PmeI and PvuII and blunt-end-ligated into an EcoRV site in the vector tag site to create mTLT-1YFP. hTLT-1 was generated by RT-PCR using Platinum HiFi-Supermix (Invitrogen) with human platelet cDNA as a template. Primers included: forward, atgggcctcaccctgctcttg, and reverse, gctggatggagtctgattg. Murine Platelets—Mice were bred and maintained under specific pathogen-free conditions at NCI, National Institutes of Health (NIH), Frederick, MD. Animal care was provided following the procedures outlined in A Guide for the Care and Use of Laboratory Animals (14National Research CouncilGuide for Care and Use of Laboratory Animals.National Institutes of Health Publication 86-23. NIH, Bethesda, MD1996Google Scholar). Peripheral blood collection via cardiac puncture and platelet purification from peripheral blood were performed as described earlier (15Jantzen H.M. L. J. Clin. PubMed Scopus Google Scholar). were in and 12 Human platelet in was from the blood were by at for and in and to a of platelets were in 1 of 1 and and for on of protein was by as previously described (13Paul S.P. Taylor L.S. Stansbury E.K. McVicar D.W. Blood. 2000; 96: 483-490Crossref PubMed Google Scholar). TLT-1 was generated by with a protein residues of mTLT-1 and a tag for purification TLT-1 as as TLT-1, were generated by and by and were from The cDNA sequence encoding full-length hTLT-1 was from J. Res. 2005; 33: PubMed Scopus Google Scholar). The expression used for structure contains only the immunoglobulin-like domain fragment was for on of the sequence of TLT-1 with the sequence used for structure of NKp44 and structure of hTLT-1 from the (5Cantoni C. Ponassi M. Biassoni R. Conte R. Spallarossa A. Moretta A. Moretta L. Bolognesi M. Bordo D. Structure (Camb). 2003; 11: 725-734Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, J. M. A. F. J. Mol. Scopus Google Scholar). The sequence was for expression in using the J. Res. 2002; PubMed Scopus Google Scholar). The gene and amplification were performed as previously described J. Res. 2002; PubMed Scopus Google Scholar), and the gene was into a plasmid vector for expression in A vector the gene encoding residues of hTLT-1 was into the cells cells were on with and of were and used to of with and and for at The were in of and and at showed Expression was by of 1 and with for cells were by at for 20 The cell was in with I and A cell and for the soluble was The TLT-1 was several and in as previously described T. A. L. M.S. PubMed Scopus Google Scholar). and the resulting was with and to a protein and and of for at the and of hTLT-1 was and to and and and of the protein were by and by electrospray mass The hTLT-1 was digested with and by to the of was in 1 to a of 1 and in a of with a 1 of hTLT-1 in at were by of hTLT-1 immunoglobulin-like domain were to by of crystal in the hTLT-1, resulted in The 1 of hTLT-1 in 20 and consisting of and were at were at of in a with A of to the resolution of was using generated by on the at and were using a The resolution was at the at the with to Å. The were using the 2 2 were and using W. PubMed Scopus Google Scholar). 1 collection and shown in to the resolution cell the of of I was on a of from of of protein shown in to the resolution the of The of I was on a of from in a The structure of the immunoglobulin-like domain of hTLT-1 was by using the R. D. Biol. Scopus Google Scholar), and the were on a The of of chain (6Kelker M.S. Debler E.W. Wilson I.A. J. Mol. Biol. 2004; 344: 1175-1181Crossref PubMed Scopus (24) Google Scholar), NKp44 1HKF) (5Cantoni C. Ponassi M. Biassoni R. Conte R. Spallarossa A. Moretta A. Moretta L. Bolognesi M. Bordo D. Structure (Camb). 2003; 11: 725-734Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar), and the domain of chain Structure (Camb). 2004; Full Text Full Text PDF PubMed Scopus Google was used as a variable regions were from the of the from the were used as the model of the hTLT-1 an of and the amino acid sequence was to that of hTLT-1 using the A. and P.D. J. M. R.J. T. D. Biol. PubMed Scopus Google Scholar). was residues were into the The resolution of was to Å. this were in the and the resolution of the was to the of 1.19 Å. was with the A. Biol. PubMed Scopus Google Scholar). were with the A. Wilson for Scholar). the of were with of and for the model were and The and were by the J. Google and C. PubMed Scopus Google Scholar). 1 The and the structure have been with the protein (PDB of found in the α-granules of resting is to the platelet surface following activation by (1Washington A.V. Schubert R.L. Quigley L. Disipio T. Feltz R. Cho E.H. McVicar D.W. Blood. 2004; 104: 1042-1047Crossref PubMed Scopus (92) Google Scholar). A was performed using resting and activated platelets to in mTLT-1 activation, platelet were with an of The of platelets was by the the mass of mTLT-1 from a form to a of and to the smaller mTLT-1 isoform was released from In platelets were to to the and resting platelets and the resulting showed no of a isoform 1 and However, following activation with a soluble form of mTLT-1 be in the of platelets by The form of mTLT-1 was in murine serum with an specific for the extracellular domain of mTLT-1 but in serum using an specific to the cytoplasmic domain of mTLT-1, that the species in serum includes the extracellular domain We the of the as TLT-1 by that two different the extracellular domain of mTLT-1 with a of TLT-1 was observed in murine or in 2 and To mTLT-1 found in serum resulted from of the platelet or from of soluble we transfected cells with cDNA encoding mTLT-1, or a were for of recombinant mTLT-1 in that the protein is observed the in 1 and and of identical were in cell of the cDNA used for 2 and The isoform released from cells was identical in mass to the form in murine serum is the murine and human we the using human and cells transfected with hTLT-1 Human platelets and serum with an specific for the extracellular domain of hTLT-1 to the murine system 2, A and human platelets hTLT-1 but human serum contains only a of smaller In human two to of 12 and were observed similar to the observed in following platelet activation Human TLT-1 is from of resting platelets and from To hTLT-1 were in from of hTLT-1, or from we transfected cells with the hTLT-1 cDNA encoding the smaller of two known of hTLT-1 and the cell for the presence of hTLT-1 was from cells or but full-length and smaller and are observed in from which were transfected with the hTLT-1 gene and of that the of recombinant hTLT-1 released from cells are identical in mass to those released from platelets following activation with examining TLT-1 from platelets and recombinant TLT-1 from suggest that the extracellular domain have a of the intact To a of this domain function, we have crystallized and determined the structure of the immunoglobulin-like domain of human The Structure of TLT-1 crystallized in the with cell a and Å. The model described of the side including those in the and the structure of hTLT-1 consisting of connected by in the immunoglobulin-like The and and the form similar to those observed in TREM-1 The structure of the immunoglobulin-like domain of hTLT-1 is similar to variable domains with the observed in regions hTLT-1 has two homologous to those previously in the structures of NKp44 and of the was during the purification of hTLT-1 by and of the in TLT-1 is in immunoglobulin-like domains, and is found in murine and human TREM-1, NKp44, and The in hTLT-1, located in and is present in murine or human TREM-1 but is found in NKp44 and with model of hTLT-1 immunoglobulin-like domain was used as a for the protein using the from T. Biol. PubMed Scopus Google Scholar). The protein structures with similarity to hTLT-1. The to hTLT-1 are including pIgR, TREM-1, NKp44, and the myeloid cell receptor, (PDB The immunoglobulin-like domain of hTLT-1 also with cell and other immune The the in hTLT-1 and a receptor, (PDB chain is the for the human molecule type I (PDB and hTLT-1 is Å. the for hTLT-1 and proteins with amino acid sequence NKp44, and pIgR, are and determining regions have been in as as regions C. J. Mol. Biol. PubMed Scopus Google Scholar). In immunoglobulin-like the are to as and The structure of hTLT-1 in and are the of the hTLT-1 and immunoglobulin-like crystal The of in hTLT-1 were in in to crystal with which the of and A of the a D. PubMed Scopus Google In hTLT-1, the side of and interact with the of located on the the of and to and Human TREM-1 and NKp44 are at the to and in hTLT-1. In the is resulting in a similar of In mTREM-1 the residues to and are and a similar the side chain of is from a in the side chain of The region in the TREM family includes and In murine and human TREM-1, NKp44, and pIgR, this region from the of through to located in the In TLT-1, residues include or in and The a to and a of is maintained in known structures of TREM family in turn, a and a with the side of and from the the structure of the sequence the In hTLT-1, the is and consists of only residues that of the TREM-1, NKp44, and TLT-1 only TREM family structures In is observed the two crystal The structure is a in which the the of and the amino terminus were in a of the In murine and human TREM-1, the is residues longer hTLT-1. In mTREM-1 and this the by of the The observed in the of from a in and at occurring in the of of hTLT-1 and in and the of amino acid in the of the are at the particularly and the amino However, in the on are which to a The surface of hTLT-1 several charged by regions with surface potential The of 2, and in hTLT-1, positively charged determining a contains and from the molecule contains the of the an negatively charged on the but is in the sequence by and which form a positively charged surface The surface of NKp44 a positively charged by the in the and the In hTLT-1 this is charged and includes several negatively charged the of this on the surface of TLT-1 are the of the are with by on and with located in the and the the surface of this is by side of the and which are in in TREM-1 with hTLT-1. on the surface of (PDB code is a of the from and the of In hTLT-1, the from the and a molecule in the A on the of hTLT-1 and NKp44 to murine or human TREM-1 from the in with mTREM-1 in hTLT-1 are to mTREM-1 residues A peptide of mTREM-1 residues has been and shown to pro-inflammatory production caused by membrane-bound mTREM-1 in a model of septic shock (12Gibot S. Kolopp-Sarda M.N. Bene M.C. Bollaert P.E. Lozniewski A. Mory F. Levy B. Faure G.C. J. Exp. Med. 2004; 200: 1419-1426Crossref PubMed Scopus (312) Google Scholar). In hTLT-1 and this peptide of the the and of the Both of the peptide from mTREM-1 form and of the of the peptide to the by the and of the In hTLT-1, residues to the mTREM-1 peptide to the surface at the a in known structures of TREM family members and the carboxyl of the of hTLT-1 a to the surface at murine and human TREM-1 have in the 17-amino acid peptide is murine and human TREM-1, with only amino acid in this region. The sequence of hTLT-1 of 17 amino acids are the amino terminus of the from The mTREM-1 and hTLT-1 residues in the of the peptide to the and of but the of the the and The the two structures the sequence and of Thus, the 17-amino acid peptide of a and that is to different activation is of the in a of including and and Scholar). Here we that the extracellular domain of murine and human TLT-1 is released from the surface of activated murine platelets and serum we observed a or with an mass of the full-length mTLT-1 be observed at an mass of hTLT-1 at of 12 and the hTLT-1 isoform observed at an mass of In human and murine TLT-1, the mass full-length and is 20 by The of mTLT-1 and hTLT-1, from their amino acid residues as signal are and The observed and from different in mice to The soluble species of mTLT-1 released from platelets and in serum as an form of mTLT-1 its membrane-spanning region and of the cytoplasmic hTLT-1, is observed at an mass to its mass mTLT-1, and the soluble of hTLT-1 observed are of the hTLT-1 extracellular domain of 12 and to and amino acids of the extracellular domain, or the immunoglobulin-like domain residues the smaller of TLT-1 from of recombinant murine or human TLT-1 extracellular domain from cells that the region of TLT-1 is to were with two different specific for the extracellular domain of mTLT-1, and a of that the observed are mTLT-1 and the of observed with a that TLT-1 can be in soluble released from platelets the potential for activity of In the of platelet function, TLT-1 platelet or and of TLT-1 in by platelets from the TLT-1 species the natural TLT-1 and of The crystal structure of this recombinant fragment of hTLT-1 includes the of the extracellular domain and is similar to the soluble from natural The crystal structure of the immunoglobulin-like domain of hTLT-1 a with other TREM receptors (5Cantoni C. Ponassi M. Biassoni R. Conte R. Spallarossa A. Moretta A. Moretta L. Bolognesi M. Bordo D. Structure (Camb). 2003; 11: 725-734Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, M.S. Debler E.W. Wilson I.A. J. Mol. Biol. 2004; 344: 1175-1181Crossref PubMed Scopus (24) Google Scholar, S. Kattah M. Rostro B. Colonna M. Sun P.D. Structure (Camb). 2003; 11: 1527-1535Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 8Kelker M.S. Foss T.R. Peti W. Teyton L. Kelly J.W. Wuthrich K. Wilson I.A. J. Mol. Biol. 2004; 342: 1237-1248Crossref PubMed Scopus (55) Google but also with Structure (Camb). 2004; Full Text Full Text PDF PubMed Scopus Google and the myeloid cell receptor Structural hTLT-1 and variable domains, and cell suggest that TLT-1 can form a with or protein or peptide residues of hTLT-1 with murine and human TREM-1, and NKp44, a with TREM-1 NKp44, because the is as hTLT-1 and NKp44, with hTLT-1 and either murine or human was because the structure that hTLT-1 and NKp44 a to hTLT-1 and use to protein or peptide C. J. Mol. Biol. PubMed Scopus Google Scholar). the in and with the immunoglobulin and to and which of the structure in a the of the immunoglobulin-like domain, that hTLT-1 is with sequence resulting in in surface and Recently, a recombinant mTREM-1 immunoglobulin-like domain was shown to pro-inflammatory production (12Gibot S. Kolopp-Sarda M.N. Bene M.C. Bollaert P.E. Lozniewski A. Mory F. Levy B. Faure G.C. J. Exp. Med. 2004; 200: 1419-1426Crossref PubMed Scopus (312) Google Scholar). In to the intact immunoglobulin-like domain, a 17-amino acid fragment of this domain pro-inflammatory production and death in a murine model of septic shock (11Cella M. Buonsanti C. Strader C. Kondo T. Salmaggi A. Colonna M. J. Exp. Med. 2003; 198: 645-651Crossref PubMed Scopus (192) Google Scholar). The activity of this peptide in apparently blocking mTREM-1 activity is because the of this peptide is in sequence and structure the TREM and the carboxyl of the peptide is members of the TREM The of this of its on the and its activity suggest that the peptide includes an site for the natural of The peptide the and TREM-1 (11Cella M. Buonsanti C. Strader C. Kondo T. Salmaggi A. Colonna M. J. Exp. Med. 2003; 198: 645-651Crossref PubMed Scopus (192) Google Scholar). We that an fragment from hTLT-1 residues to hTLT-1 to its natural hTLT-1 an hTLT-1 activity is we can the intact immunoglobulin-like domain or smaller of that domain can the The immunoglobulin-like domains and the surface and the immunoglobulin-like domain as a for with The presence of a naturally occurring soluble form of murine and human TLT-1 released from platelets a TLT-1 to its cytoplasmic The hTLT-1 structure to the of TLT-1 an activity is the of TLT-1 and a foundation to of TLT-1 We the use of of the located at the National