Activation of a CrkL-Stat5 Signaling Complex by Type I Interferons

Type I interferons (IFNα and IFNβ) transduce signals by inducing tyrosine phosphorylation of Jaks and Stats, as well as the CrkL adapter, an SH2/SH3-containing protein which provides a link to downstream pathways that mediate growth inhibition. We report that Stat5 interacts constitutively with the IFN receptor-associated Tyk-2 kinase, and during IFNα stimulation its tyrosine-phosphorylated form acts as a docking site for the SH2 domain of CrkL. CrkL and Stat5 then form a complex that translocates to the nucleus. This IFN-inducible CrkL-Stat5 complex binds in vitro to the TTCTAGGAA palindromic element found in the promoters of a subset of IFN-stimulated genes. Thus, during activation of the Type I IFN receptor, CrkL functions as a nuclear adapter protein and, in association with Stat5, regulates gene transcription through DNA binding. Type I interferons (IFNα and IFNβ) transduce signals by inducing tyrosine phosphorylation of Jaks and Stats, as well as the CrkL adapter, an SH2/SH3-containing protein which provides a link to downstream pathways that mediate growth inhibition. We report that Stat5 interacts constitutively with the IFN receptor-associated Tyk-2 kinase, and during IFNα stimulation its tyrosine-phosphorylated form acts as a docking site for the SH2 domain of CrkL. CrkL and Stat5 then form a complex that translocates to the nucleus. This IFN-inducible CrkL-Stat5 complex binds in vitro to the TTCTAGGAA palindromic element found in the promoters of a subset of IFN-stimulated genes. Thus, during activation of the Type I IFN receptor, CrkL functions as a nuclear adapter protein and, in association with Stat5, regulates gene transcription through DNA binding. Type I interferons (IFNα, 1The abbreviations used are: IFN, interferon; GST, glutathione S-transferase; STAT, signal transducer and activator of transcription; IRS, insulin receptor substrate; PAGE, polyacrylamide gel electrophoresis; GDAC, genomic DNA affinity chromatography. IFNβ, and IFNω) are pleiotropic cytokines that exhibit multiple biological effects including antiviral and growth-inhibitory activities (1Pestka S. Langer J.A. Zoon K.C. Samuel C.E. Annu. Rev. Biochem. 1987; 56: 727-777Crossref PubMed Scopus (1605) Google Scholar, 2Platanias L.C. Curr. Opin. Oncol. 1995; 7: 560-565Crossref PubMed Scopus (44) Google Scholar). Following engagement of the Type I IFN receptor by IFNα or IFNβ, two kinases of the Janus family, Tyk-2 and Jak-1, are activated and phosphorylate the Stat proteins: Stat1, Stat2, Stat3, Stat4, and Stat5 (3Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1420Crossref PubMed Scopus (5062) Google Scholar, 4Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3401) Google Scholar). Activated Stat proteins form distinct signaling complexes to regulate gene transcription. Stat1 and Stat2 form a heterodimer that associates with a member of the IFN regulatory factor family, p48, resulting in the formation of the mature ISGF3 complex that translocates to the nucleus to initiate gene transcription by binding to interferon-stimulated response elements (3Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1420Crossref PubMed Scopus (5062) Google Scholar, 4Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3401) Google Scholar). Stat1 and Stat3 homo- and heterodimers and homodimers of Stat4, Stat5a, and Stat5b bind a palindromic sequence found in the promoters of IFN-stimulated genes (4Darnell Jr., J.E. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3401) Google Scholar,5Meinke A. Barahmand-Pour F. Wohrl S. Stoiber D. Decker T. Mol. Cell. Biol. 1996; 16: 6937-6945Crossref PubMed Scopus (156) Google Scholar). In addition to the Stat pathway, other signaling cascades are activated downstream of Jaks in IFNα signaling. These include the insulin receptor substrate (IRS) pathway that regulates activation of the phosphatidylinositol 3′-kinase (6Uddin S. Yenush L. Sun X-J. Sweet M.E. White M.F. Platanias L.C. J. Biol. Chem. 1995; 270: 15938-15941Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar, 7Platanias L.C. Uddin S. Yetter A. Sun X-J. White M.F. J. Biol. Chem. 1996; 271: 278-282Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 8Burfoot M.S. Rogers N.C. Watling D. Smith J.M. Pons S. Paonessaw G. Pellegrini S. White M.F. Kerr I.M. J. Biol. Chem. 1997; 272: 24183-24190Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar) and the CrkL pathway that links the functional Type I IFN receptor complex to the growth-inhibitory C3G/Rap-1 cascade (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). In the present study we determined whether the CrkL pathway functions in coordination with the Stat pathway. Our data demonstrate that Stat5 is constitutively associated with the Tyk-2 kinase, and its IFN-phosphorylated form provides a docking site for the SH2 domain of CrkL. The resulting CrkL-Stat5 complex translocates to the nucleus to regulate gene transcription via GAS elements. Viewed together, these findings provide evidence for a novel function of CrkL as a nuclear adapter protein. The Daudi and KG1 human cell lines were grown in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% (v/v) fetal bovine serum (Life Technologies, Inc.) and antibiotics. Human recombinant IFNα2 was provided by Hoffmann-La Roche. Human recombinant IFNα-consensus (IFNCon1) was provided by Amgen Inc. Human recombinant IFNβ was provided by Biogen Inc. (Cambridge, MA). The anti-CrkL and anti-Stat5b polyclonal antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The production of the pGEX-CrkLSH2 construct has been described previously (10Heaney C. Kolibaba K. Bhat A. Oda T. Ohno S. Fanning S. Druker B.J. Blood. 1997; 89: 297-306Crossref PubMed Google Scholar). Cells were stimulated with 104 units/ml of the indicated interferons as described previously (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). After stimulation, the cells were lysed in phosphorylation lysis buffer, and immunoprecipitations and immunoblotting using the ECL method were performed as described previously (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). Production of glutathione S-transferase fusion proteins and binding experiments using lysates from IFNα-untreated or -treated cells were performed as described previously (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 11Uddin S. Katzav S. White M.F. Platanias L.C. J. Biol. Chem. 1995; 270: 7712-7716Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). Preparation of nuclear extracts, genomic DNA affinity chromatography, and mobility shift assays were performed essentially as described previously (12Ghislain J.J. Fish E.N. J. Biol. Chem. 1996; 271: 12408-12413Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). A double-stranded oligodeoxynucleotide specific for Stat5 binding (AGATTTCTAGGAATTCAAATC), derived from the β-casein promoter, was synthesized and used in gel shift assays. We sought to identify the tyrosine kinase that regulates IFNα-induced activation of Stat5 and the mechanisms by which the protein is activated and binds DNA. When lysates from IFNα-stimulated KG1 myeloid cells were immunoprecipitated with an anti-Tyk-2 antibody and immunoblotted with antiphosphotyrosine, we noted that a tyrosyl phosphoprotein migrating as a doublet at 96/94 kDa was complexed with Tyk-2 (Fig. 1 A). This protein corresponded to Stat5, as determined by immunoblotting with a specific anti-Stat5 antibody (Fig. 1 B). The interaction of Stat5 with Tyk-2 was present prior to IFNα treatment and increased further after IFNα stimulation, suggesting that Stat5 interacts constitutively with Tyk-2 and thus may provide a link between this kinase and downstream signaling elements. Similarly, a constitutive interaction of Stat5 with Tyk-2 was seen in studies with the IFNα-sensitive Daudi lymphoblastoid cell line (Fig. 1, C and D). In previous studies, we have demonstrated that the adapter protein CrkL interacts in an IFNα-dependent manner with Tyk-2 and is tyrosine-phosphorylated during IFNα stimulation, providing a link between the Type I IFN receptor and the C3G-Rap-1 growth-inhibitory pathway (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). Accordingly, we examined whether CrkL associates with Stat5 during IFNα or IFNβ stimulation. In time course studies, Daudi cells were left untreated or treated for 10 or 20 min with IFNα or IFNβ. Cell lysates were prepared, immunoprecipitated with an anti-CrkL antibody, and then immunoblotted with an anti-Stat5 antibody. Stat5 was detected in association with CrkL after IFNα stimulation, establishing that this member of the Stat family of proteins associates with CrkL in an IFNα-dependent manner (Fig. 2,A and B). In contrast, there was no Stat1 present in anti-CrkL immunoprecipitates from IFNα-treated cells, 2S. Uddin and L. C. Platanias, unpublished observations. indicating that the CrkL-Stat5 interaction is selective. As Stat5 was found to be constitutively associated with the Tyk-2 kinase, while the CrkL interaction was IFNα-dependent, we determined whether Stat5 undergoes IFNα-induced tyrosine phosphorylation and subsequently functions as a docking site for the SH2 domain of CrkL. In experiments in which Daudi or KG-1 cells were treated with IFNα for different times and the status of phosphorylation of Stat5 was examined, we observed that Stat5 is phosphorylated on tyrosine, suggesting that it acts as a substrate for the kinase activity of the associated Tyk-2 protein (Fig. 3, A andB, and data not shown). In addition, the SH2 domain of CrkL bound to the phosphorylated/activated form of both Stat5 isomers (a and b) in an IFNα-dependent manner (Fig. 3, C and D), confirming that Stat5 acts as a docking site for the CrkL SH2 domain and strongly suggesting that such an interaction mediates the formation of the CrkL-Stat5 complex.Figure 3The IFNα-induced tyrosine-phosphorylated form of Stat5 functions as a docking site for the SH2 domain of CrkL. A, Daudi cells were incubated in the presence or absence of IFNα for 20 min. Cell lysates were immunoprecipitated with an antibody against Stat5b and immunoblotted with antiphosphotyrosine.B, the blot shown in A was stripped and reprobed with the anti-Stat5b antibody. C, Daudi cells were incubated at 37 °C for 30 min in the presence or absence of IFNα. Cell lysates were bound to a glutathione S-transferase fusion protein encoding the SH2 domain of CrkL (GST-CkLSH2) or GST alone used as control. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat5b. D, KG-1 cells were incubated at 37 °C for 30 min in the presence or absence of IFNα. Cell lysates were bound to glutathione S-transferase fusion protein encoding the SH2 domain of CrkL (GST-CkLSH2) or GST alone used as control. Bound proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat5b.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Previous studies have shown that CrkL functions as an adapter, linking tyrosine kinases or their substrates to guanine exchange factors for small G proteins. Our finding that the protein interacts in an SH2-dependent manner with Stat5 suggested that it may also participate in the formation of DNA binding complexes that regulate transcription of interferon-stimulated genes. To test this hypothesis, we evaluated the ability of CrkL to bind DNA using genomic DNA affinity chromatography (GDAC) (12Ghislain J.J. Fish E.N. J. Biol. Chem. 1996; 271: 12408-12413Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Specifically, nuclear extracts from Daudi cells treated with IFNα or IFNβ were subjected to GDAC, and then the DNA-bound fraction was resolved by SDS-PAGE and immunoblotted for CrkL (Fig. 4 A). CrkL bound DNA in an IFNα- or IFNβ-dependent manner (Fig.4 A), and its DNA-bound form migrated at approximately 140 kDa, strongly suggesting that such DNA binding occurs in a complex with Stat5. Furthermore, as CrkL was detectable in immunoblots of the nuclear extracts only after Type I IFN treatment, these data suggested that the protein translocates to the nucleus in a Type I IFN-dependent manner. Similarly, when the IFN-induced DNA-bound fractions collected following GDAC were immunoblotted with Stat5, we noticed that Stat5 was detectable in the same complex with CrkL (Fig. 4 B), strongly suggesting that it forms a DNA-binding complex in association with CrkL. Further analyses of these Type I IFN-induced nuclear extracts by gel shift assays, employing an oligonucleotide specific for Stat5 binding derived from the β-casein promoter, identified the presence of IFNα- or IFNβ-inducible DNA-binding complexes, whose mobilities were affected by inclusion of anti-CrkL antibodies (Fig.5 A) but not control RIgG (Fig.5 A and data not shown). The presence of Stat5 in these CrkL-containing complexes in the electrophoretic mobility shift assay was confirmed by immunoblotting with antibodies to Stat5 (Fig.5 B). Thus, CrkL forms DNA-binding complexes in association with Stat5, strongly suggesting that it is involved in the regulation of Type I IFN-dependent gene expression. Our data provide strong evidence that CrkL, in cooperation with Stat5, binds DNA, and this complex likely functions as a transcription factor in IFNα/β-induced signaling. Indeed, we have observed this IFN-induced CrkL-Stat5 complex in other IFN-sensitive cell lines, namely human glial T98G and human osteosarcoma U2OS cells (data not shown). Such a role for CrkL was unexpected and raises the possibility that other related proteins, e.g. CrkII, Grb-2, may function as transcriptional activators in other signaling cascades. The members of this family of proteins have been previously shown to function as adapters, providing a link between receptor tyrosine kinases or their substrates and guanine exchange factors. Until now, there has been no evidence of their exhibiting DNA binding activity. CrkL has been shown to interact primarily with C3G (9Ahmad S. Alsayed Y. Druker B.J. Platanias L.C. J. Biol. Chem. 1997; 272: 29991-29994Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 13Ingham R.J. Krebs D.L. Barbazuk S.M. Turck C.W. Hirai H. Matsuda M. Gold M.R. J. Biol. Chem. 1996; 271: 32306-32314Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 14Sawasdikosol S. Ravichandran K.S. Kay Lee K. Chang J-H. Burakoff S.J. J. Biol. Chem. 1995; 270: 2893-2896Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 15Reedquist K.A. Fukazawa T. Panchamoorthy G. Langdon W.Y. Shoelson S.E. Druker B.J. Band H. J. Biol. Chem. 1996; 271: 8435-8442Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar), which acts as a guanine exchange factor for Rap-1 (16Gotoh T. Hattori S. Nakamura S. Kitayama H. Noda M. Takai Y. Kaibuchi K. Matsui H. Hatase O. Takahashi H. Kurata T. Matsuda M. Mol. Cell. Biol. 1995; 15: 6746-6753Crossref PubMed Scopus (336) Google Scholar), a small G protein that antagonizes Ras and has tumor suppressor activity (17Cook S. Rubinfeld B. Albert I. McCormick F. EMBO J. 1993; 12: 3475-3485Crossref PubMed Scopus (335) Google Scholar, 18Kitayama H. Sugimoto Y. Matsuzaki T. Ikawa Y. Noda M. Cell. 1989; 56: 77-84Abstract Full Text PDF PubMed Scopus (763) Google Scholar, 19Kitayama H. Matsuzaki T. Ikawa Y. Noda M. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4284-4288Crossref PubMed Scopus (104) Google Scholar). Regulation of Rap-1 activation by the CrkL-C3G complex appears to be critical for inhibition of T-cell proliferation and induction of anergy (20Boussiotis V.A. Freeman G.J. Berezovskaya A. Barber D.L. Nadler L.M. Science. 1997; 278: 124-128Crossref PubMed Scopus (395) Google Scholar). In addition, recent studies have demonstrated that CrkL interacts with a newly cloned member of the IRS family of proteins, IRS-4, in an IGF-1-dependent manner and that it has oncogenic potential when overexpressed in cell lines (21Koval A.P. Karas M. Zick Y. LeRoith D. J. Biol. Chem. 1997; 273: 14780-14787Abstract Full Text Full Text PDF Scopus (38) Google Scholar). The current report implicates Stat5 in the engagement of CrkL in IFN signaling, as shown by the requirement of Stat5 as a docking site for the SH2 domain of CrkL. Most importantly, for the first time these data demonstrate that a Stat protein can act as a docking protein for the SH2 domain of a non-Stat protein to form a DNA-binding complex with it. Although, in the case of CrkL, this function appears to be specific for Stat5, it is likely that other Stats will be found to function in a similar manner in other systems. Recent reports have suggested that Stat5 is involved in IFNα signaling in myeloid cell lines and HeLa cells (5Meinke A. Barahmand-Pour F. Wohrl S. Stoiber D. Decker T. Mol. Cell. Biol. 1996; 16: 6937-6945Crossref PubMed Scopus (156) Google Scholar), and its activation has been observed in response to differentiation and growth arrest signals (22Barahmand-pour F. Meinke A. Eilers A. Gouilleux F. Groner B. Decker T. FEBS Lett. 1995; 360: 29-33Crossref PubMed Scopus (45) Google Scholar, 23Eilers A. Baccarini M. Hipskind R.A. Schindler C. Decker T. Mol. Cell. Biol. 1994; 14: 1364-1373Crossref PubMed Scopus (62) Google Scholar). Our results strongly suggest that such functions for Stat5 require its interaction with and formation of a signaling complex with CrkL.