RGC-32 Mediates Transforming Growth Factor-β-induced Epithelial-Mesenchymal Transition in Human Renal Proximal Tubular Cells

Epithelial-mesenchymal transition (EMT) occurs in several disease states, including renal fibrosis and carcinogenesis. Myofibroblasts produced from EMT of renal tubular cells are responsible for the deposition of extracellular matrix components in a large portion of renal interstitial fibrosis. Transforming growth factor-β (TGF-β) plays an essential role in the EMT of renal tubular cells, but the molecular mechanism governing this process remains largely unknown. In this study, we found that RGC-32 (response gene to complement 32) is critical for TGF-β-induced EMT of human renal proximal tubular cells (HPTCs). RGC-32 is not normally expressed in the HPTCs. However, TGF-β stimulation markedly activates RGC-32 while inducing an EMT, as shown by the induction of smooth muscle α-actin (α-SMA) and extracellular matrix proteins collagen I and fibronectin, as well as the reduction of epithelial marker E-cadherin. TGF-β function is mediated by several signaling pathways, but RGC-32 expression in HPTCs appears to be mainly regulated by Smad. Functionally, RGC-32 appears to mediate TGF-β-induced EMT of HPTCs. Blockage of RGC-32 using short hairpin interfering RNA significantly inhibits TGF-β induction of myofibroblast marker gene α-SMA while repressing the expression of E-cadherin. In contrast, overexpression of RGC-32 induces α-SMA expression while restoring E-cadherin. RGC-32 also inhibits the expression of another adherens junction protein, N-cadherin, suggesting that RGC-32 alone induces the phenotypic conversion of renal epithelial cells to myofibroblasts. Additional studies show that RGC-32 stimulates the production of extracellular matrix components fibronectin and collagen I. Mechanistically, RGC-32 induces EMT via the activation of other transcription factors such as Snail and Slug. RGC-32 knockdown inhibits the expression of Snail and Slug during TGF-β-induced EMT. Taken together, our data demonstrate for the first time that RGC-32 plays a critical role in TGF-β-induced EMT of renal tubular cells. Epithelial-mesenchymal transition (EMT) occurs in several disease states, including renal fibrosis and carcinogenesis. Myofibroblasts produced from EMT of renal tubular cells are responsible for the deposition of extracellular matrix components in a large portion of renal interstitial fibrosis. Transforming growth factor-β (TGF-β) plays an essential role in the EMT of renal tubular cells, but the molecular mechanism governing this process remains largely unknown. In this study, we found that RGC-32 (response gene to complement 32) is critical for TGF-β-induced EMT of human renal proximal tubular cells (HPTCs). RGC-32 is not normally expressed in the HPTCs. However, TGF-β stimulation markedly activates RGC-32 while inducing an EMT, as shown by the induction of smooth muscle α-actin (α-SMA) and extracellular matrix proteins collagen I and fibronectin, as well as the reduction of epithelial marker E-cadherin. TGF-β function is mediated by several signaling pathways, but RGC-32 expression in HPTCs appears to be mainly regulated by Smad. Functionally, RGC-32 appears to mediate TGF-β-induced EMT of HPTCs. Blockage of RGC-32 using short hairpin interfering RNA significantly inhibits TGF-β induction of myofibroblast marker gene α-SMA while repressing the expression of E-cadherin. In contrast, overexpression of RGC-32 induces α-SMA expression while restoring E-cadherin. RGC-32 also inhibits the expression of another adherens junction protein, N-cadherin, suggesting that RGC-32 alone induces the phenotypic conversion of renal epithelial cells to myofibroblasts. Additional studies show that RGC-32 stimulates the production of extracellular matrix components fibronectin and collagen I. Mechanistically, RGC-32 induces EMT via the activation of other transcription factors such as Snail and Slug. RGC-32 knockdown inhibits the expression of Snail and Slug during TGF-β-induced EMT. Taken together, our data demonstrate for the first time that RGC-32 plays a critical role in TGF-β-induced EMT of renal tubular cells. Epithelial-mesenchymal transition (EMT), 2The abbreviations used are: EMT, epithelial-mesenchymal transition; MAPK, mitogen-activated protein kinase; HPTC, human renal proximal tubular cell; α-SMA, smooth muscle α-actin; ECM, extracellular matrix; RT-PCR, reverse transcription-PCR; ERK, extracellular signal-regulated kinase; shRNA, short hairpin RNA; PI3K, phosphatidylinositol 3-kinase; TGF-β, transforming growth factor-β. the conversion from an epithelial to a mesenchymal phenotype, is a normal process during embryonic development such as mesoderm and neural tube formation. EMT is also a process in several disease states, including carcinogenesis and renal fibrosis. Renal tubulointerstitial fibrosis is the final inevitable common consequence of an excessive accumulation and deposition of extracellular matrix (ECM) components in the tubulointerstitium that occurs in virtually every type of chronic kidney disease; the degree of renal tubulointerstitial fibrosis correlates closely with the decline in renal function of progressive chronic kidney disease (1Eddy A.A. Pediatr. Nephrol. 2000; 15: 290-301Crossref PubMed Scopus (550) Google Scholar, 2Schieppati A. Remuzzi G. Kidney Int. 2005; 98: S7-S10Abstract Full Text Full Text PDF Scopus (295) Google Scholar, 3Liu Y. J. Am. Soc. Nephrol. 2004; 15: 1-12Crossref PubMed Scopus (974) Google Scholar). Regardless of the initial causes, the striking feature of tubulointerstitial fibrosis is the activation of smooth muscle α-actin (α-SMA)-positive myofibroblasts. It is thought that these cells are the central effectors responsible for ECM deposition in the pathogenesis of renal disease (3Liu Y. J. Am. Soc. Nephrol. 2004; 15: 1-12Crossref PubMed Scopus (974) Google Scholar, 4Hewitson T.D. Becker G.J. Am. J. Nephrol. 1995; 15: 111-117Crossref PubMed Scopus (101) Google Scholar, 5Essawy M. Soylemezoglu O. Muchaneta-Kubara E.C. Shortland J. Brown C.B. el Nahas A.M. Nephrol. Dial. Transplant. 1997; 12: 43-50Crossref PubMed Scopus (177) Google Scholar). Although the exact origins of myofibroblasts remain largely unclear and controversial, accumulating evidence has demonstrated that the major sources for the new myofibroblasts in advanced fibrosis originate from renal tubular epithelial cells via EMT (3Liu Y. J. Am. Soc. Nephrol. 2004; 15: 1-12Crossref PubMed Scopus (974) Google Scholar, 6Iwano M. Plieth D. Danoff T.M. Xue C. Okada H. Neilson E.G. J. Clin. Investig. 2002; 110: 341-350Crossref PubMed Scopus (1739) Google Scholar, 7Kalluri R. Neilson E.G. J. Clin. Investig. 2003; 112: 1776-1784Crossref PubMed Scopus (2129) Google Scholar). These myofibroblasts are morphological intermediates between fibroblasts and smooth muscle cells characterized by loss of epithelial function and the cell marker E-cadherin or N-cadherin and gain of the ability to produce ECM components such as collagen I, collagen III, and fibronectin, as well as smooth muscle cell phenotype expressing α-SMA (8Yang J. Liu Y. Am. J. Pathol. 2001; 159: 1465-1475Abstract Full Text Full Text PDF PubMed Scopus (710) Google Scholar, 9Boyer B. Valles A.M. Edme N. Biochem. Pharmacol. 2000; 60: 1091-1099Crossref PubMed Scopus (383) Google Scholar). Transforming growth factor-β (TGF-β) and its downstream signaling molecules have been shown to play an essential role in EMT. Both in vitro and in vivo studies have demonstrated that TGF-β, by itself, can initiate and complete the entire EMT process (10Yang J. Liu Y. J. Am. Soc. Nephrol. 2002; 13: 96-107Crossref PubMed Google Scholar, 11Fan J.M. Ng Y.Y. Hill P.A. Nikolic-Paterson D.J. Mu W. Atkins R.C. Lan H.Y. Kidney Int. 1999; 56: 1455-1467Abstract Full Text Full Text PDF PubMed Scopus (479) Google Scholar). The TGF-β signal is transduced by its transmembrane serine/threonine kinase receptors type I and type II. Binding of TGF-β to receptor type II leads to the recruitment and phosphorylation of receptor type I, which further activates its downstream signaling mediators, Smad2 and Smad3. Phosphorylated Smad2/3 then binds to the common partner Smad4 and is subsequently translocated into the nucleus, where it controls the transcription of TGF-β-responsive genes (12Bottinger E.P. Bitzer M. J. Am. Soc. Nephrol. 2002; 13: 2600-2610Crossref PubMed Scopus (664) Google Scholar, 13Massague J. Wotton D. EMBO J. 2000; 19: 1745-1754Crossref PubMed Google Scholar, 14Schnaper H.W. Hayashida T. Hubchak S.C. Poncelet A.C. Am. J. Physiol. 2003; 284: F243-F252Crossref PubMed Scopus (36) Google Scholar). Overexpression of inhibitory Smad7 abolishes Smad2 phosphorylation and tubular cell phenotypic conversion (15Lan H.Y. Curr. Opin. Nephrol. Hypertens. 2003; 12: 25-29Crossref PubMed Scopus (229) Google Scholar, 16Li J.H. Zhu H.J. Huang X.R. Lai K.N. Johnson R.J. Lan H.Y. J. Am. Soc. Nephrol. 2002; 13: 1464-1472Crossref PubMed Scopus (236) Google Scholar). Smad3 knock-out mice are protected from unilateral ureter obstruction-induced tubulointerstitial fibrosis, as shown by reduced EMT and collagen deposition (17Sato M. Muragaki Y. Saika S. Roberts A.B. Ooshima A. J. Clin. Investig. 2003; 112: 1486-1494Crossref PubMed Scopus (702) Google Scholar). Although much progress has been made to demonstrate the importance of TGF-β and its Smad mediators in EMT, the downstream effectors of Smad signaling that mediate EMT remain largely unknown. RGC-32 is found in many adult human tissues, including heart, brain, liver, skeletal muscle, placenta, kidney, and pancreas (18Badea T. Niculescu F. Soane L. Fosbrink M. Sorana H. Rus V. Shin M.L. Rus H. J. Biol. Chem. 2002; 277: 502-508Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). It is overexpressed in colon cancer and many tumors (19Fosbrink M. Cudrici C. Niculescu F. Badea T.C. David S. Shamsuddin A. Shin M.L. Rus H. Exp. Mol. Pathol. 2005; 78: 116-122Crossref PubMed Scopus (49) Google Scholar). RGC-32 plays a role in cell cycle activation. It is a substrate and regulator of cyclin-dependent kinase p34cdc2 (18Badea T. Niculescu F. Soane L. Fosbrink M. Sorana H. Rus V. Shin M.L. Rus H. J. Biol. Chem. 2002; 277: 502-508Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 20Fosbrink M. Niculescu F. Rus H. Immunol. Res. 2005; 31: 37-46Crossref PubMed Scopus (66) Google Scholar). Our previous studies have shown that RGC-32 is important in TGF-β-induced smooth muscle cell differentiation from neural crest cells (21Li F. Luo Z. Huang W. Lu Q. Wilcox C.S. Jose P.A. Chen S. J. Biol. Chem. 2007; 282: 10133-10137Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). In the present study, we found that RGC-32, acting downstream of Smad, plays an important role in mediating TGF-β-induced EMT of HPTCs. RGC-32 appears to induce EMT by activating other regulators. Cell Culture and Reagents-HPTCs were cultured as described (22Sanada H. Jose P.A. Hazen-Martin D. Yu P.Y. Xu J. Bruns D.E. Phipps J. Carey R.M. Felder R.A. Hypertension. 1999; 33: 1036-1042Crossref PubMed Scopus (136) Google Scholar). Briefly, normal HPTCs were grown in Dulbecco’s modified Eagle’s/F-12 medium (Invitrogen) supplemented with 5% fetal bovine serum, 5 ng/ml selenium, 5 mg/ml insulin, 5 mg/ml transferrin, 36 ng/ml hydrocortisone, 4 pg/ml triiodo-thyronine, and 10 ng/ml epidermal growth factor at 37 °C in a 95% O2 and 5% CO2 incubator. NRK-52E cells (rat kidney epithelial cell line) (23de Larco J.E. Todaro G.J. J. Cell. Physiol. 1978; 94: 335-342Crossref PubMed Scopus (232) Google Scholar) were cultured in Dulbecco’s modified Eagle’s medium supplemented with 5% fetal bovine serum and 4 mm l-glutamine. TGF-β1 was obtained from R&D Systems (Minneapolis, MN). α-SMA, α-tubulin, collagen type I monoclonal antibodies, and fibronectin polyclonal antibody were purchased from Sigma. E-cadherin monoclonal antibody was from BD Biosciences. Preparation of RGC-32 Antibody-RGC-32 antigen (peptide sequence vtprkaklgdtkeled) was synthesized, and polyclonal antibody was produced by Proteintech Group, Inc. (Chicago, IL). The antibody was purified by immunoaffinity chromatography using RGC-32 peptides. Antibody specificity was confirmed by examining the expression of T7-tagged RGC-32 cDNA. RGC-32 Expression and Short Hairpin Interfering RNA (shRNA) Constructs-The RGC-32 expression plasmid was described previously (21Li F. Luo Z. Huang W. Lu Q. Wilcox C.S. Jose P.A. Chen S. J. Biol. Chem. 2007; 282: 10133-10137Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). For the construction of RGC-32 shRNA plasmids, double-stranded DNA oligonucleotides for RGC-32 and scrambled (control) shRNA were designed using siRNA Target Designer (Promega). The RGC-32 shRNA sequence is CGGCCATTCTTGGTTCACTATTCAAGAGATAGTGAACCAAGAATGGCCCT; the scrambled shRNA sequence is CGCCTCTCTCTTAGTGAGATTTCAAGAGAATCTCACTAAGAGAGAGGCCT. shRNA DNA templates were inserted into pGeneClip™ vectors using GeneClip™ U1 hairpin cloning systems (Promega) following the manufacturer’s recommendations. The inserts were verified by sequencing. Transient Transfection-HPTCs or NRK-52E cells were plated at 3 × 105/well in 6-well plates and incubated at 37 °C in aCO2 incubator until they reached 80% confluency. Cells were then transiently transfected in triplicate with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations. 4.0 μg of plasmid DNA and 10 μl of Lipofectamine 2000 were diluted separately in Opti-MEM I medium and incubated for 5 min. They were then combined and incubated for 30 min at room temperature. 24 h after transfection, cells were starved in serum-free Dulbecco’s modified Eagle’s/F-12 medium for 6 h, followed by treatment with 5 ng/ml TGF-β1 or vehicle for the indicated times. Reverse Transcription-PCR (RT-PCR)-Total RNA was extracted using TRIzol reagent (Invitrogen) following the manufacturer's instructions. cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad). PCR was performed as described previously (24Chen S. Lechleider R.J. Circ. Res. 2004; 94: 1195-1202Crossref PubMed Scopus (158) Google Scholar). mRNA expression of the genes of interest was normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase or cyclophilin. The primers used in PCR are listed in protein and were performed as described using α-SMA, collagen I, fibronectin, RGC-32, or followed by with antibody S. M. R.M. J.E. Jose P.A. Lechleider R.J. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). The were by and using a epithelial cells were in in at room for followed by for 10 min. Cells were then with bovine serum and incubated with RGC-32 and E-cadherin and were used for E-cadherin and RGC-32 Antibody were by are expressed as were or times. of was used to the was used to the between was a TGF-β is to induce EMT from renal tubular cell from and J.M. J. C. V. J. Am. Soc. Nephrol. PubMed Scopus (236) Google Scholar, A. C. G. J. L. I. A. Am. J. Physiol. 2003; 284: PubMed Scopus (232) Google Scholar, Y. J. C. C. Liu Y. J. Clin. Investig. 2003; 112: PubMed Scopus Google Scholar, F. M. R. Neilson E.G. Kidney Int. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar). RGC-32 has been shown to be a downstream of RGC-32 plays a role in TGF-β-induced EMT of renal tubular cells, we first an EMT cell by using TGF-β to an from human kidney (22Sanada H. Jose P.A. Hazen-Martin D. Yu P.Y. Xu J. Bruns D.E. Phipps J. Carey R.M. Felder R.A. Hypertension. 1999; 33: 1036-1042Crossref PubMed Scopus (136) Google Scholar). HPTCs were with TGF-β for or 24 h to induce EMT. The expression of genes such as α-SMA and ECM proteins collagen I and fibronectin was by and shown in TGF-β treatment markedly mRNA and protein expression of α-SMA and ECM components in a TGF-β also the expression of the epithelial marker E-cadherin suggesting that HPTCs were to myofibroblasts by TGF-β induces RGC-32 expression in neural crest cells and mesenchymal cells, which in smooth muscle cell differentiation (21Li F. Luo Z. Huang W. Lu Q. Wilcox C.S. Jose P.A. Chen S. J. Biol. Chem. 2007; 282: 10133-10137Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). However, RGC-32 expression in renal cells and its importance in renal have not been In of the important role of TGF-β in renal tubular EMT and RGC-32 a TGF-β downstream we to or not RGC-32 plays a role in TGF-β-induced EMT of human renal tubular cells. first RGC-32 is expressed in HPTCs and RGC-32 expression is regulated by shown in and RGC-32 is normally expressed at a in HPTCs. h of TGF-β mRNA and protein expression were significantly 24 h of RGC-32 mRNA and protein expression were and with vehicle treatment and These data that TGF-β is a of RGC-32 in HPTCs. Smad proteins are the major intermediates for TGF-β signaling also mediate TGF-β including MAPK, MAPK, and R. 2003; PubMed Scopus Google Scholar, 2000; PubMed Scopus Google Scholar). RGC-32 is regulated in we used to signaling and these are important for RGC-32 activation. shown in of kinase and not RGC-32 suggesting that these signaling are not in RGC-32 Smad proteins are important for RGC-32 we used a Smad4 in which the Smad4 activation in the is abolishes the function of Smad signaling S. R. Roberts A.B. Lechleider R.J. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar). found that RGC-32 induction and suggesting that RGC-32 is regulated by Smad RGC-32 is in TGF-β-induced EMT of we first RGC-32 is essential for myofibroblast marker α-SMA used shRNA to RGC-32 expression and then or not TGF-β is to induce α-SMA in the of shown in RGC-32 shRNA significantly RGC-32 RGC-32 knockdown in a reduction of RGC-32 alone induces myofibroblast we transfected or RGC-32 cDNA into HPTCs and RGC-32 induces the myofibroblast marker shown in RGC-32 overexpression a expression of α-SMA, suggesting that RGC-32 TGF-β function in the EMT of HPTCs. the EMT, renal tubular cells epithelial phenotype and new of of this process is the loss of epithelial RGC-32 function in renal tubular EMT, we RGC-32 the expression of the epithelial marker E-cadherin. TGF-β E-cadherin expression in HPTCs and However, RGC-32 knockdown its expression that RGC-32 is critical for phenotypic RGC-32 alone E-cadherin we overexpressed RGC-32 in HPTCs and found that RGC-32 E-cadherin expression in the of TGF-β Additional studies in kidney epithelial cells using that RGC-32 expression E-cadherin at the RGC-32 also the of and significantly formation. that the cells expressing RGC-32 a from the epithelial cell to an mesenchymal These data demonstrate that RGC-32 plays a critical role in renal tubular EMT. Although the loss of E-cadherin expression is a of tubular EMT, N-cadherin appears to be the in human and proximal in vivo Physiol. 2004; PubMed Google Scholar, B. Y. T. I. PubMed Scopus Google Scholar). HPTCs used in this TGF-β N-cadherin expression RGC-32 is in N-cadherin expression during EMT, we RGC-32 expression by RGC-32 shRNA or cDNA into HPTCs. found that RGC-32 knockdown by shRNA N-cadherin expression RGC-32 overexpression N-cadherin expression These data that RGC-32 the loss of the epithelial phenotype of HPTCs by the expression of adherens junction proteins E-cadherin and EMT is not characterized by the of epithelial proteins but by the of the EMT as The the expression of ECM RGC-32 ECM protein mRNA and protein expression of collagen I and fibronectin were in cells where RGC-32 was or shown in and knockdown of RGC-32 TGF-β-induced mRNA and protein expression of collagen I and RGC-32 overexpression expression and These data demonstrate that RGC-32 plays an important role in ECM protein production in the myofibroblasts from renal tubular cells. has been shown to be regulated by the Brown EMBO J. 1999; PubMed Google it was to Smad signaling in the cells from a S. R. Roberts A.B. Lechleider R.J. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar). fibronectin is regulated by Smad or in HPTCs during TGF-β-induced EMT, we used to PI3K, ERK, or while using Smad7 to Smad that of ERK, or signaling TGF-β-induced fibronectin expression However, the expression suggesting that the is not Smad7 also significantly fibronectin expression that Smad signaling is important for TGF-β-induced fibronectin These data demonstrate that fibronectin is regulated by Smad and during TGF-β-induced EMT of HPTCs. studies have shown that transcription factors and play important in EMT H. M. A. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar, D. Mol. Biol. Cell. PubMed Scopus Google Scholar, J. Cell Biol. 1997; PubMed Scopus Google Scholar, Mol. Biol. Cell. 2007; PubMed Scopus Google Scholar, Becker I. B. R. H. Becker Am. J. Pathol. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar, C. J. B. H. F. G. Res. 2005; 33: PubMed Scopus Google Scholar, J. S. R.A. C. I. A. R.A. Cell. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). to RGC-32 function in renal tubular EMT is to these is not expressed in HPTCs. and are expressed in these cells. However, TGF-β not the expression of or in HPTCs not Snail and Slug were expressed in HPTCs. However, TGF-β treatment significantly expression RGC-32 downstream or of Snail or Slug in mediating TGF-β-induced EMT, we RGC-32 expression using shRNA and Snail and Slug expression in HPTCs. found that of RGC-32 significantly TGF-β-induced Snail and Slug These data that RGC-32 as an regulator of Snail and Slug in TGF-β-induced renal tubular EMT. Although signaling plays critical in renal tubular EMT, TGF-β downstream important for EMT remain largely unknown. RGC-32 appears to be of the TGF-β downstream important for EMT of HPTCs. of evidence this TGF-β activates RGC-32 expression inducing EMT RGC-32 knockdown TGF-β-induced expression of the myofibroblast marker α-SMA, RGC-32 overexpression induces α-SMA in HPTCs RGC-32 the epithelial marker a of EMT RGC-32 induces the production of the ECM proteins collagen I and fibronectin which are of a mesenchymal TGF-β function is mediated by several signaling RGC-32 activation in HPTCs appears to be regulated by Smad proteins RGC-32 expression is Smad signaling is by The of other signaling not RGC-32 activation. studies show that RGC-32 is regulated by Smad and in TGF-β-induced smooth muscle differentiation from neural crest cells, that RGC-32 activation in normal development and is by (21Li F. Luo Z. Huang W. Lu Q. Wilcox C.S. Jose P.A. Chen S. J. Biol. Chem. 2007; 282: 10133-10137Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar). The renal tubular EMT to be from the EMT in carcinogenesis. of E-cadherin is a for However, in the EMT of cancer cells, loss of E-cadherin is by expression of to N-cadherin is with the of and of cancer cells Becker I. B. R. H. Becker Am. J. Pathol. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar, Johnson J. Cell Biol. 1999; PubMed Scopus Google Scholar, A. G.J. Res. 2000; 60: Google Scholar). N-cadherin is expressed in HPTCs. However, in the EMT of of an N-cadherin expression is by TGF-β of the responsible for the of N-cadherin the governing renal tubular EMT and carcinogenesis. RGC-32 appears to play a role in the of N-cadherin and in the EMT of HPTCs. In the cancer cell TGF-β induces fibronectin expression via a Brown EMBO J. 1999; PubMed Google Scholar). In fibronectin is regulated by Smad and pathways, including ERK, and These data further the of renal tubular EMT from that of EMT in carcinogenesis. RGC-32 expression in HPTCs is regulated by Smad ERK, or fibronectin expression transcription factors have been to mediate TGF-β-induced EMT, including and H. M. A. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar, D. Mol. Biol. Cell. PubMed Scopus Google Scholar, J. Cell Biol. 1997; PubMed Scopus Google Scholar, Mol. Biol. Cell. 2007; PubMed Scopus Google Scholar, Becker I. B. R. H. Becker Am. J. Pathol. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar, C. J. B. H. F. G. Res. 2005; 33: PubMed Scopus Google Scholar, J. S. R.A. C. I. A. R.A. Cell. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). Snail and Slug have been shown to be important for renal tubular EMT and fibrosis A. J. EMBO J. PubMed Scopus Google Scholar, B. A. O. A. S. F. B. M. R. F. Am. J. Pathol. 2007; Full Text Full Text PDF PubMed Scopus Google Scholar). and are present in Snail and Slug are by TGF-β, with importance in the renal tubular EMT. Snail and Slug to be downstream of RGC-32 knockdown of RGC-32 significantly inhibits Snail and Slug mRNA Taken together, our studies demonstrate that RGC-32, as a downstream of TGF-β, by Smad is a of EMT in renal tubular cells. RGC-32 induces EMT activating the transcription of other with