Key points are not available for this paper at this time.
UBPY is a ubiquitin-specific protease that can deubiquitinate monoubiquitinated receptor tyrosine kinases, as well as process Lys-48- and Lys-63-linked polyubiquitin to lower denomination forms in vitro. Catalytically inactive UBPY localizes to endosomes, which accumulate ubiquitinated proteins. We have explored the sequelae of short interfering RNA-mediated knockdown of UBPY. Global levels of ubiquitinated protein increase and ubiquitin accumulates on endosomes, although free ubiquitin levels are unchanged. UBPY-depleted cells have more and larger multivesicular endosomal structures that are frequently associated through extended contact areas, characterized by regularly spaced, electron-dense, bridging profiles. Degradation of acutely stimulated receptor tyrosine kinases, epidermal growth factor receptor and Met, is strongly inhibited in UBPY knockdown cells suggesting that UBPY function is essential for growth factor receptor down-regulation. In contrast, stability of the UBPY binding partner STAM is dramatically compromised in UBPY knockdown cells. The cellular functions of UBPY are complex but clearly distinct from those of the Lys-63-ubiquitin-specific protease, AMSH, with which it shares a binding site on the SH3 domain of STAM. UBPY is a ubiquitin-specific protease that can deubiquitinate monoubiquitinated receptor tyrosine kinases, as well as process Lys-48- and Lys-63-linked polyubiquitin to lower denomination forms in vitro. Catalytically inactive UBPY localizes to endosomes, which accumulate ubiquitinated proteins. We have explored the sequelae of short interfering RNA-mediated knockdown of UBPY. Global levels of ubiquitinated protein increase and ubiquitin accumulates on endosomes, although free ubiquitin levels are unchanged. UBPY-depleted cells have more and larger multivesicular endosomal structures that are frequently associated through extended contact areas, characterized by regularly spaced, electron-dense, bridging profiles. Degradation of acutely stimulated receptor tyrosine kinases, epidermal growth factor receptor and Met, is strongly inhibited in UBPY knockdown cells suggesting that UBPY function is essential for growth factor receptor down-regulation. In contrast, stability of the UBPY binding partner STAM is dramatically compromised in UBPY knockdown cells. The cellular functions of UBPY are complex but clearly distinct from those of the Lys-63-ubiquitin-specific protease, AMSH, with which it shares a binding site on the SH3 domain of STAM. Activated receptor tyrosine kinases (RTK) 3The abbreviations used are: RTK, receptor tyrosine kinase; MVB, multivesicular bodies; EGF, epidermal growth factor; EGFR, EGF receptor; DUB, deubiquitinating enzyme; UBPY, ubiquitin-specific processing protease Y; STAM, signal transducing adapter molecule; siRNA, short interfering RNA; HA, hemagglutinin; GFP, green fluorescent protein; BES, 2-bis(2-hydroxyethyl)aminoethanesulfonic acid; SH, Src homology; E3, ubiquitin-protein isopeptide ligase. generally enter the endosomal system through incorporation into clathrin-coated vesicles and delivery to a tubulo-vesicular compartment known as the early or sorting endosome. From here receptors may recycle to the plasma membrane or be selected for lysosomal sorting by incorporation into small vesicles that bud away from the limiting membrane into the vacuolar lumen to generate multivesicular bodies (MVBs) (1Felder S. Miller K. Moehren G. Ullrich A. Schlessinger J. Hopkins C.R. Cell. 1990; 61: 623-634Abstract Full Text PDF PubMed Scopus (351) Google Scholar, 2White I.J. Bailey L.M. Aghakhani M.R. Moss S.E. Futter C.E. EMBO J. 2005; 25: 1-12Crossref PubMed Scopus (249) Google Scholar, 3Katzmann D.J. Sarkar S. Chu T. Audhya A. Emr S.D. Mol. Biol. Cell. 2004; 15: 468-480Crossref PubMed Scopus (122) Google Scholar). Activated RTKs such as epidermal growth factor (EGF) receptor (EGFR), platelet-derived growth factor receptor, and Met are multimonoubiquitinated through the action of an E3 ubiquitin ligase, the proto-oncogene c-Cbl (4Haglund K. Sigismund S. Polo S. Szymkiewicz I. Di Fiore P.P. Dikic I. Nat. Cell Biol. 2003; 5: 461-466Crossref PubMed Scopus (667) Google Scholar, 5Mosesson Y. Shtiegman K. Katz M. Zwang Y. Vereb G. Szollosi J. Yarden Y. J. Biol. Chem. 2003; 278: 21323-21326Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar, 6Peschard P. Fournier T.M. Lamorte L. Naujokas M.A. Band H. Langdon W.Y. Park M. Mol. Cell. 2001; 8: 995-1004Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar, 7Hammond D.E. Carter S. McCullough J. Urbé S. Vande Woude G. Clague M.J. Mol. Biol. Cell. 2003; 14: 1346-1354Crossref PubMed Scopus (99) Google Scholar). Ubiquitination provides a sorting signal that is proposed to engage with the MVB sorting machinery through an initial interaction with the UIM (ubiquitin interacting motif) domain of Hrs (hepatocyte growth factor receptor tyrosine kinase substrate) (8Urbé S. Sachse M. Row P.E. Preisinger C. Barr F.A. Strous G. Klumperman J. Clague M.J. J. Cell Sci. 2003; 116: 4169-4179Crossref PubMed Scopus (153) Google Scholar, 9Raiborg C. Bache K.G. Gillooly D.J. Madshus I.H. Stang E. Stenmark H. Nat. Cell Biol. 2002; 4: 394-398Crossref PubMed Scopus (584) Google Scholar, 10Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (967) Google Scholar). Classical studies elucidated polyubiquitin chains linked through an internal lysine (Lys-48) as a proteasomal degradation signal (11Ciechanover A. Nat. Rev. Mol. Cell. Biol. 2005; 6: 79-86Crossref PubMed Scopus (833) Google Scholar, 12Deveraux Q. Ustrell V. Pickart C. Rechsteiner M. J. Biol. Chem. 1994; 269: 7059-7061Abstract Full Text PDF PubMed Google Scholar, 13Chau V. Tobias J.W. Bachmair A. Marriott D. Ecker D.J. Gonda D.K. Varshavsky A. Science. 1989; 243: 1576-1583Crossref PubMed Scopus (1125) Google Scholar). However, there is an increasing appreciation that alternative polyubiquitin chain structures play crucial roles in cellular physiology (14Pickart C.M. Fushman D. Curr. Opin. Chem. Biol. 2004; 8: 610-616Crossref PubMed Scopus (841) Google Scholar, 15Dupre S. Urban-Grimal D. Haguenauer-Tsapis R. Biochim. Biophys. Acta. 2004; 1695: 89-111Crossref PubMed Scopus (141) Google Scholar) and that ubiquitination is a dynamic post-translational modification, which may come to rival phosphorylation in its scope and complexity. The reversibility of ubiquitination can be attributed to the action of deubiquitinating enzymes (DUBs) of which there are an estimated 79 encoded in the human genome (16Nijman S.M. Luna-Vargas M.P. Velds A. Brummelkamp T.R. Dirac A.M. Sixma T.K. Bernards R. Cell. 2005; 123: 773-786Abstract Full Text Full Text PDF PubMed Scopus (1441) Google Scholar, 17Amerik A.Y. Hochstrasser M. Biochim. Biophys. Acta. 2004; 1695: 189-207Crossref PubMed Scopus (761) Google Scholar). Two DUBs, associated molecule with the SH3-domain of STAM (AMSH) and ubiquitin-specific processing protease Y (UBPY) are known to interact directly with signal transducing adapter molecule (STAM), a protein that is constitutively associated with the endosomal sorting adapter Hrs (18Tanaka N. Kaneko K. Asao H. Kasai H. Endo Y. Fujita T. Takeshita T. Sugamura K. J. Biol. Chem. 1999; 274: 19129-19135Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 19Kato M. Miyazawa K. Kitamura N. J. Biol. Chem. 2000; 275: 37481-37487Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). In fact, they share a binding site on the SH3 domain of STAM by virtue of a conserved binding motif, PXV/ID/NRXXKP (19Kato M. Miyazawa K. Kitamura N. J. Biol. Chem. 2000; 275: 37481-37487Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). AMSH is a member of the JAMM/MPN+ family of metalloproteases (20Maytal-Kivity V. Reis N. Hofmann K. Glickman M.H. BMC Biochem. 2002; 3: 28Crossref PubMed Scopus (184) Google Scholar, 21Cope G.A. Suh G.S. Aravind L. Schwarz S.E. Zipursky S.L. Koonin E.V. Deshaies R.J. Science. 2002; 298: 608-611Crossref PubMed Scopus (588) Google Scholar), which we have shown to negatively regulate EGFR sorting to the lysosome as evidenced by enhanced receptor degradation following acute stimulation of AMSH knockdown cells (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). UBPY is a cysteine protease of the ubiquitin-specific processing protease (UBP/USP) family, also known as USP8, and has been proposed to regulate cellular ubiquitin levels and entry into S phase (23Naviglio S. Mattecucci C. Matoskova B. Nagase T. Nomura N. Di Fiore P.P. Draetta G.F. EMBO J. 1998; 17: 3241-3250Crossref PubMed Scopus (162) Google Scholar). The yeast orthologue of UBPY is thought to be Doa4, which associates with late components of the MVB sorting machinery (24Bowers K. Lottridge J. Helliwell S.B. Goldthwaite L.M. Luzio J.P. Stevens T.H. Traffic. 2004; 5: 194-210Crossref PubMed Scopus (165) Google Scholar, 25Luhtala N. Odorizzi G. J. Cell Biol. 2004; 166: 717-729Crossref PubMed Scopus (164) Google Scholar) and has been proposed to recycle ubiquitin from committed receptors (26Amerik A.Y. Nowak J. Swaminathan S. Hochstrasser M. Mol. Biol. Cell. 2000; 11: 3365-3380Crossref PubMed Scopus (261) Google Scholar, 27Dupre S. Haguenauer-Tsapis R. Mol. Cell. Biol. 2001; 21: 4482-4494Crossref PubMed Scopus (142) Google Scholar). In this paper we show that knockdown of UBPY by RNA interference has multiple cellular effects that include the accumulation of ubiquitinated proteins on endosomes, an increase in both number and size of multivesicular endosomes, and a block in RTK degradation. Plasmids—Human UBPY cDNA was obtained from the Kazusa DNA Research Institute, Japan (clone KIAA0055) and subcloned into pEGFPC1. The C786S mutation was introduced by QuikChange site-directed mutagenesis (Stratagene) and subcloned into pEGFP-UBPY. A short interfering (si)RNA-resistant UBPY construct (UBPY*) was generated by introducing five degenerate point mutations (underlined below) into UBPY within the region targeted by UBPY-specific siRNA duplex1 (forward primer sequence GCCTATGTACTATATATGAAGTACGTCACGGTGTACAATCTTATC) and subcloning into pEGFPC1-UBPY. GST-UBPY, HA-STAM, and Flag-ubiquitin constructs were generous gifts from Giulio Draetta (Milan, Italy), Naomi Kitamura (Yokohama, pMIW-HA-Hbp), and John O'Bryan (Chicago, IL). Antibodies and Other Reagents—Mouse monoclonal anti-HA antibody was from Covance, and anti-ubiquitin antibodies were from Sigma (U5379), Covance (P4G7), and Affiniti-Biomol (FK1, FK2). Anti-GFP was a gift of Francis Barr (Martinsried, Germany). Mouse monoclonal anti-EGFR R1 and goat polyclonal anti-EGFR 1005 were from Santa Cruz. Met antibodies were obtained from Cell Signaling. Anti-lysobisphosphatidic acid was a generous gift of Jean Gruenberg (Geneva, Switzerland). Rabbit polyclonal AMSH, Hrs, and STAM antibodies have been previously described (7Hammond D.E. Carter S. McCullough J. Urbé S. Vande Woude G. Clague M.J. Mol. Biol. Cell. 2003; 14: 1346-1354Crossref PubMed Scopus (99) Google Scholar, 22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar, 28Sachse M. Urbé S. Oorschot V. Strous G.J. Klumperman J. Mol. Biol. Cell. 2002; 13: 1313-1328Crossref PubMed Scopus (286) Google Scholar, 29Row P.E. Clague M.J. Urbé S. Biochem. J. 2005; 389: 629-636Crossref PubMed Scopus (48) Google Scholar) Secondary antibodies were from Molecular Probes and Sigma. Protein A- and G-agarose were from Sigma. Bacterial Expression and Purification of Recombinant Proteins—GST-UBPY was expressed in Rosetta (DE3) pLysS cells (Novagen) and batch-purified with glutathione-Sepharose (Pharmacia) according to manufacturers' instructions. Purified protein was dialyzed against DUB-assay buffer. Deubiquitination Assays—Lys-48-linked tetraubiquitin (250 ng) or Lys-63-linked tetraubiquitin chains (250 ng) (Boston Biochem) were incubated for 2 h at 37 °C in of DUB-assay with were on according to instructions. proteins were to the membrane was for in in in and with a antibody to ubiquitin by Cell and cells were in in with and were from cells were with and or h Cell and were in and in were by and incubated with antibodies and Protein A- or Protein G-agarose for 2 h at cells were in at and were at °C for with by at for and with of to of cells were in for stimulated with EGF for on and in and with protease and EGFR was and were in and and in buffer. of was by with and the was in for EGFR, to for of UBPY by cells were h with siRNA or UBPY-specific siRNA duplex1 or UBPY-specific siRNA 2 and siRNA at in the of was to a of cells were h with siRNA at a of a was with of of and of siRNA were and with to of BES, incubated for and to the cells. The cells were incubated at The of UBPY knockdown was by and by on a the of cells an accumulation of ubiquitin on as shown in the cells were h with siRNA or UBPY-specific siRNA the cells were with or UBPY The of which EGFR h of EGF was by on a were h for as previously described (8Urbé S. Sachse M. Row P.E. Preisinger C. Barr F.A. Strous G. Klumperman J. Clague M.J. J. Cell Sci. 2003; 116: 4169-4179Crossref PubMed Scopus (153) Google Scholar). Secondary antibodies used were with or were with a and UBPY-depleted cells were incubated in for with in of with of cells were with with and for according to were and with in a were by the of internal and were in MVB were by in cells with a and to the with cellular of cells cellular of cells of have an in for that the processing of polyubiquitin chains to lower denomination forms (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar, R. C. 2003; PubMed Scopus Google Scholar). In AMSH for UBPY for polyubiquitin (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). with the that the Lys-63-linked chains to at that were from ubiquitin in which with the of been to We have with polyubiquitin chains from ubiquitin and that in to AMSH, UBPY and Lys-63-linked chains of the of UBPY and a inactive UBPY (23Naviglio S. Mattecucci C. Matoskova B. Nagase T. Nomura N. Di Fiore P.P. Draetta G.F. EMBO J. 1998; 17: 3241-3250Crossref PubMed Scopus (162) Google Scholar) in cells. We cells levels of UBPY and UBPY UBPY antibody is to the In both and inactive UBPY are to the and plasma membrane UBPY an of as early by with and with EGFR UBPY to be to early stimulation of of but UBPY a of ubiquitin on a we have previously following of inactive AMSH (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). However, in to AMSH this UBPY accumulation of a of STAM which is by ubiquitin antibodies (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). UBPY and AMSH with the SH3 domain of STAM the of and may for binding (19Kato M. Miyazawa K. Kitamura N. J. Biol. Chem. 2000; 275: 37481-37487Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). to of inactive of UBPY or We to RNA interference to the of UBPY in endosomal ubiquitin of cells with siRNA, AMSH siRNA on the levels of ubiquitinated proteins as by In contrast, knockdown of UBPY, with distinct siRNA in a increase in the of ubiquitinated proteins. of proteins are on with a polyubiquitin antibody (4Haglund K. Sigismund S. Polo S. Szymkiewicz I. Di Fiore P.P. Dikic I. Nat. Cell Biol. 2003; 5: 461-466Crossref PubMed Scopus (667) Google ubiquitination was in the levels of free ubiquitin was in UBPY knockdown cells on UBPY knockdown cells an accumulation of ubiquitin on in number of cells of the cells with UBPY and number of cells with which was in cells number of cells be with which a to in to more we an and structures a late I.J. Bailey L.M. Aghakhani M.R. Moss S.E. Futter C.E. EMBO J. 2005; 25: 1-12Crossref PubMed Scopus (249) Google Scholar, T. Stang E. P. Gruenberg J. 1998; PubMed Scopus Google Scholar). of UBPY knockdown cells by that knockdown cells an number of multivesicular endosomal increase of which also a in size with of in UBPY-depleted cells a of as with in cells A and is the of vacuolar which for a vesicles and which are in cells with also provides of of extended of contact by a regularly of with a of knockdown accumulation of that are to of an A and that is in cells. of RTK in UBPY-depleted cells were to EGFR but in to in the receptor for extended and it from degradation in EGFR degradation be directly attributed to the of UBPY, of UBPY but was to this of the h of the UBPY the in EGFR of cells endosomal EGFR h of EGF with of cells with of cells an accumulation of ubiquitin on as with of cells We that EGFR was in UBPY knockdown by the of of of acute EGF we a EGFR degradation that of receptor by an is generated in UBPY knockdown and the of the receptor is be that although this is a a in EGFR levels is We the ubiquitination of the EGFR EGF stimulation and that of EGFR is in UBPY-depleted cells suggesting that UBPY may be for of ubiquitin from EGFR to incorporation into is for the of acutely stimulated receptor tyrosine A and cells were with siRNA or UBPY-specific siRNA, and stimulated with EGF or for were and protein were by with and anti-EGFR and was by with the of a EGFR degradation in at in cells that is from UBPY knockdown cells. cells were as in and with anti-EGFR or antibody a a was in were by with anti-ubiquitin and anti-EGFR We the of UBPY was to the of EGFR or to We the of Met, the receptor for growth factor in UBPY knockdown cells. Met receptor degradation both ubiquitination and P. Fournier T.M. Lamorte L. Naujokas M.A. Band H. Langdon W.Y. Park M. Mol. Cell. 2001; 8: 995-1004Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar, D.E. Urbé S. Vande Woude G.F. Clague M.J. 2001; PubMed Scopus Google Scholar), in to EGFR, it also to through an on its S. Urbé S. Clague M.J. J. Biol. Chem. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). Met receptor degradation is to UBPY knockdown as for EGFR, the degradation is in the of UBPY UBPY the of the can knockdown of a RTK free ubiquitin levels is that UBPY can regulate the MVB sorting machinery on the receptors We the of Hrs in cells that were or of UBPY or In as well as in Hrs is a and an endosomal which as a of structures and a more is dramatically in UBPY-depleted the is and Hrs is to structures which also for ubiquitin We of cells by and that the levels of Hrs were more we that the adapter protein STAM was in UBPY knockdown cells However, of STAM in UBPY knockdown cells the in EGFR degradation may proteins by proteasomal degradation. this be the for of STAM we UBPY knockdown cells with the proteasomal of cells with STAM was and by with that proteasomal in UBPY knockdown cells accumulates ubiquitinated STAM, which as a The of this ubiquitin is on the knockdown of UBPY. the levels of AMSH also lower in cells of UBPY, of AMSH levels in be that this of AMSH for the of AMSH EGFR (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar) and the we are UBPY is a that Lys-48- and Lys-63-linked polyubiquitin and may also monoubiquitinated such as the platelet-derived growth factor receptor and EGFR and E. T. A. T. Kitamura N. M. Mol. Biol. Cell. 2005; PubMed Scopus Google Scholar). of the internal within ubiquitin is for its against Lys-63-linked as is are (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). to a accumulation of ubiquitinated proteins (23Naviglio S. Mattecucci C. Matoskova B. Nagase T. Nomura N. Di Fiore P.P. Draetta G.F. EMBO J. 1998; 17: 3241-3250Crossref PubMed Scopus (162) Google free ubiquitin We were in the cellular of UBPY with share a binding site with the SH3 domain of STAM (19Kato M. Miyazawa K. Kitamura N. J. Biol. Chem. 2000; 275: 37481-37487Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar) but to and In to AMSH, UBPY with in cells but can be following acute EGF A paper E. T. A. T. Kitamura N. M. Mol. Biol. Cell. 2005; PubMed Scopus Google Scholar) that UBPY directly with EGFR, although we to at for this interaction and Catalytically inactive UBPY is on in suggesting that its may be for from Catalytically inactive AMSH also more endosomal and its that of UBPY, to accumulation of ubiquitin at effects be of the of AMSH or UBPY from binding site to STAM. We that inactive AMSH but UBPY the of a ubiquitinated of STAM, with which it interact with E3 AMSH has been shown to interact with the protein which as an adapter for of the and H. A. 2004; PubMed Scopus Google Scholar). ubiquitination of STAM is well has in the ubiquitination of its binding partner Hrs A. C. Stenmark H. Dev. Cell. 2003; 5: Full Text Full Text PDF PubMed Scopus Google Scholar). may be that AMSH an E3 to STAM, which is by the inactive of of AMSH and UBPY UBPY knockdown to in the and size of as by and to the accumulation of both Hrs and ubiquitin at to the of endosomal in UBPY knockdown cells is clearly block to in as were in more of are by a We that this to ubiquitinated proteins in by ubiquitin binding on the partner of UBPY function may be to and that knockdown of UBPY RTK degradation. this with the AMSH knockdown for which the of EGFR degradation is clearly enhanced (22McCullough J. Clague M.J. Urbé S. J. Cell Biol. 2004; 166: 487-492Crossref PubMed Scopus (309) Google Scholar). E. T. A. T. Kitamura N. M. Mol. Biol. Cell. 2005; PubMed Scopus Google Scholar) have a of EGFR receptor in UBPY knockdown which is in to the have been of UBPY-specific siRNA the by E. T. A. T. Kitamura N. M. Mol. Biol. Cell. 2005; PubMed Scopus Google Scholar) were on of a short In we have been to the of by was an by K. M.A. D.J. Luzio J.P. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) the of UBPY and AMSH on EGF degradation and is in with UBPY is proposed to be an orthologue of the yeast Doa4, the of which to receptor sorting (26Amerik A.Y. Nowak J. Swaminathan S. Hochstrasser M. Mol. Biol. Cell. 2000; 11: 3365-3380Crossref PubMed Scopus (261) Google Scholar). function is thought to be essential for the sorting but to the cellular levels of free We in the levels of ubiquitin following UBPY knockdown suggesting that this is the by which receptor sorting is can the of a to an of receptor is that UBPY knockdown to the accumulation of ubiquitinated which can be alternative may in the of proteins in MVB sorting that with UBPY. Hrs levels are by its this is to to a in RTK sorting as levels of Hrs to a more of Met degradation we here I.J. Bailey L.M. Aghakhani M.R. Moss S.E. Futter C.E. EMBO J. 2005; 25: 1-12Crossref PubMed Scopus (249) Google Scholar, 7Hammond D.E. Carter S. McCullough J. Urbé S. Vande Woude G. Clague M.J. Mol. Biol. Cell. 2003; 14: 1346-1354Crossref PubMed Scopus (99) Google Scholar). However, in this is by an of the protein and UBPY binding STAM. that UBPY may regulate STAM stability by its which in the of UBPY STAM for proteasomal degradation. may well to the sorting C. E. M. N. S. Asao H. T. Sugamura K. Biochem. Biophys. 2003; PubMed Scopus Google Scholar) have previously shown that STAM are in EGFR and of the yeast orthologue also to in receptor sorting Nat. Cell Biol. 2002; 4: PubMed Scopus Google Scholar). However, it is that the effects we at the as well as the accumulation of proteins in UBPY knockdown to the of multiple for UBPY In the endosomal functions of the DUBs, UBPY and AMSH, are with effects on the stability and ubiquitination of STAM to the UBPY may have multiple effects on endosomal which as of receptor and We Giulio Francis Naomi John and Jean Gruenberg for
Row et al. (Tue,) studied this question.