Precise Construction and Tuning of an Aerolysin Single-Biomolecule Interface for Single-Molecule Sensing

Open AccessCCS ChemistryRESEARCH ARTICLE1 Aug 2019Precise Construction and Tuning of an Aerolysin Single-Biomolecule Interface for Single-Molecule Sensing Xue-Yuan Wu, Ming-Bo Wang, Ya-Qian Wang, Meng-Yin Li, Yi-Lun Ying, Jin Huang* and Yi-Tao Long* Xue-Yuan Wu School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China) , Ming-Bo Wang School of Pharmacy, East China University of Science and Technology, Shanghai 200237 (China) , Ya-Qian Wang School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China) , Meng-Yin Li School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China) , Yi-Lun Ying School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China) , Jin Huang* School of Pharmacy, East China University of Science and Technology, Shanghai 200237 (China) and Yi-Tao Long* School of Chemistry and Molecular Engineering, East China University of Science and Technology, Shanghai 200237 (China) School of Life Sciences, Nanjing University, Nanjing 210023 (China) https://doi.org/10.31635/ccschem.019.20180025 SectionsSupplemental MaterialAboutAbstractPDF ToolsAdd to favoritesDownload CitationsTrack Citations ShareFacebookTwitterLinked InEmail Membrane protein molecules can self-assemble to form a single-biomolecule interface, which can accommodate one single molecule at a time and provide a suitable sensing environment for single-molecule measurements. To achieve the high temporal and spatial resolution for revealing the heterogenous of single molecules, one of the most important challenge is to construct a functional single-biomolecule interface. Herein, the authors introduce a method to construct a single-biomolecule interface from the aerolysin membrane protein. Three single-spot mutations in aerolysin are selected to demonstrate the essential regions of a single-biomolecule interface. Nanopore measurements illustrate that the substitution of Q212 with arginine hinders the assembly of the nanopore, whereas replacement of positively charged R282 with glycine enhances the selectivity. Compared with wild-type (WT) aerolysin, N226Q prolongs the translocation time of poly(dA)4 by almost a factor of two while enhancing the blockage amplitude by 25%. Therefore, the authors highlight three critical regions on the structure of aerolysin, which are responsible for pore forming, sensing selectivity, and sensitivity. Specific amino acid groups could be modified by site-directed mutagenesis at a specific position on a single-biomolecule interface. This method for constructing a single-biomolecule interface is controllable, generalized, and highly reproducible, and could be applied to design and precisely construct more functionalized nanopore sensors for specific applications in biosensing. Download figure Download PowerPoint Introduction The interface of a sensor, where the interactions between reactive groups and analytes produce readable signal responses that determine the sensitivity of the sensor, is the key to its performance. 1–4 Single-molecule measurements provide a more precise and deep understanding of molecular interaction, especially for heterogeneities and stochastic behaviors. To meet the requirement of precise measurement at the single-molecule level, one of the most important techniques is to precisely construct a functional single-molecule interface, whose volume is compatible with that of a single molecule. Inspired by nature, the biological nanopore is the most primitive and space-saving single-molecular interface. The biological nanopore adopts a single-membrane protein as a single-biomolecule interface that has a comparable volume to that of an individual biomolecule. Moreover, there are abundant residues in the lumen of a biological nanopore that can be used for target recognition, ionic current response, or signal enhancement. As a single biomolecule is captured by a biological nanopore, it blocks the ionic flow through the nanopore, while interacting strongly with the inner sensing interface of nanopore. Consequently, each ionic blockage contains information at the single-molecule level, including the structure, composition, and dynamic conformational change,5–8 etc. Moreover, the biological nanopore has the advantages of low cost, high throughput, and that it is label free.9–14 There are many examples of biological nanopores that have been used as single-biomolecule interfaces, such as α-hemolysin (α-HL),15Mycobacterium smegmatis porin A,16, 17 phi29 motor protein,18–20 aerolysin,21, 22 and cytolysin A.23, 24 Aerolysin is a β-pore-forming toxin produced by Aeromonas hydrophila as an inactive precursor protein, proaerolysin.25 Proaerolysin is a dimer in the solution, which must be cleaved the C-terminal peptide (CTP) by protease to be activated and separated into two monomers. The aerolysin monomers will then spontaneously oligomerize after CTP removal (Scheme 1a). Compared with α-HL, aerolysin lacks a vestibule structure in the cis region (Scheme 1a) and possesses a long (10 nm) and narrow (1 nm) interior as the inner sensing interface, which leads to a strong pore–analyst interaction.26, 27 These properties make aerolysin an excellent candidate for the single-biomolecule interface. Since it was first used to study the structure of α-helix collagens in 2006,28 the aerolysin nanopore has been widely utilized to study ions,29, 30 nucleic acids,31 poly(ethylene glycols),32 peptides,33 proteins,34–36 etc. These favorable characteristics allow aerolysin nanopore to have the capability to directly identify single-nucleobase differences in oligonucleotides37 and to be able to monitor real-time, stepwise cleavage processes of oligonucleotides by exonuclease.6 Furthermore, the translocation velocity of single oligonucleotide in an aerolysin nanopore was shown to be nearly 1000 times slower than in other nanopores.6 Aerolysin nanopores maintain structural stability over a wide pH range, allowing the rapid detection of disease marker molecules from human body fluids, such as direct detection of methylated DNA under serum conditions.38 However, due to the limitation of existing instrumentation, small and short ionic-blocking signals are difficult to read. In addition to further instrument development to improve detection, another solution is to improve the resolution of the single-biomolecule interface. To achieve the higher temporal and spatial resolution for single-molecule measurement, it is imperative to precisely design and construct a functional single-biomolecule interface. Therefore, a construction method should be developed and combined with site-directed mutagenesis. As shown in Scheme 1, we introduce a method to design and construct a single-biomolecule interface. Three single-spot mutations (i.e., Q212R, R282G, N226Q) in the different regions of aerolysin were performed to demonstrate the essential regions of a single-biomolecule interface. In our experiment, we illustrate that an aerolysin single-biomolecule interface is composed of three critical regions, which are responsible for pore forming, sensing selectivity, and sensitivity. These results provide useful understanding and offer a generalized method for the further construction of advanced single-molecule interfaces. Scheme 1 | A function model of aerolysin-sensing interface construction and electrochemical measurement. (a) Step 1: Construction of expression vector pET-22b-proaerolysin. Step 2: Expression vector is transformed into E. coli BL21 (DE3) pLysS cells for expression. Step 3: Proaerolysin proteins express in prokaryotic systems. Step 4: Cells are broken by ultrasonic means. Step 5: Proaerolysin proteins are extracted from lysate and purified with Ni-NTA agarose. Step 6: Proaerolysin dimer cleaves the CTP via trypsin to activate and separate into two monomers. Step7: Aerolysin monomers spontaneously oligomerize to a mushroom-shaped heptamer and insert into target lipid bilayer to form a nanopore. Step 8: Aerolysin proteins are characterized by electrochemical measurement. Analytes successively enter aerolysin nanopore by the promotion of an applied voltage and interact with the amino acid residues in the lumen, which will produce a distinguishable blockage current. The locations of Q212R, R282G, and N226Q are marked by bands of different colors in aerolysin nanopore. (b) The chemical structural formulas of glutamine (orange), asparagine (green), arginine (red), and glycine (blue). Download figure Download PowerPoint Experimental Section Materials The proaerolysin gene and primers were all synthesized by Shanghai Personal Biotechnology Co., Ltd. (Shanghai, China). Pfu DNA polymerase, KOD-Plus-Neo, T4 polynucleotide kinase, isopropyl 1-thio-b-d-galactopyranoside, DpnI, T4 ligase, BamHI, HindIII, and a Gel Extraction Kit were all purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). TIANprep Mini Plasmid Kit was purchased from Tiangen Biotech Co. Ltd. (Beijing, China). One-Step Cloning Kit was purchased from Vazyme Biotech Co. Ltd. (Nanjing, China). Trypsin–agarose, decane (anhydrous, ≥99%), Imidazole, Na3PO4•12H2O, and trypsin-ethylenediaminetetraacetic were all purchased from Sigma-Aldrich Co., Ltd. (St. Louis, MO, USA). Ethylenediaminetetraacetic acid (EDTA, ≥99%) and tris(hydroxymethyl)aminomethane (Tris, ≥99%) were all purchased from Aladdin Chemistry Co. Ltd. (Shanghai, China). The 1,2-diphytanoyl-sn-glycero-3-phosphocholine (powder, ≥99%) was purchased from Avanti Polar Lipids, Inc. (Alabaster, AL, USA). All solutions were prepared using ultrapure water (18.2 MΩ cm at 25 °C) from a Milli-Q system (Billerica, MA, USA). Construction of recombinant plasmids pET-22b-proaerolysin According to the reference sequence (GenBank accession number P09167), the genes of proaerolysin were codon optimized for Escherichia coli expression and synthesized by Shanghai Personal Biotechnology Co., Ltd. As shown in Figure 1, primer pairs were designed for polymerase chain reaction (PCR) amplification. The forward primer, 5′-TATCGGAATTAATTCGGATCCGGATCCGGCAGAACC-3′, was flanked with a BamHI site. The reverse primer, 5′-TCGAGTGCGGCCGCAAGCTTAAGCTTTTGATTTGC-3′, was flanked with a HindIII site. The genes of proaerolysin were amplified by 1 U Pfu DNA polymerase in a Thermal Cycler (Bio-Rad, CA, USA) using the following conditions: 94 °C for 30 s, 60 °C for 30 s and 70 °C for 1.5 min for 35 cycles; 72 °C for 10 min. The empty vector pET-22b (+) was double digested by BamHI and HindIII restriction endonucleases and ligated to the amplified proaerolysin fragment using the One-Step Cloning Kit to produce a recombinant vector pET-22b-proaerolysin. The recombinant vector pET-22b-proaerolysin was transformed into E. coli DH5α cells. After plating, single bacterial colonies were picked and sequenced in Shanghai Sunny Biotechnology Co., Ltd. (Shanghai, China). The plasmids of proaerolysin were extracted by TIANprep Mini Plasmid Kit. Figure 1 | Construction of recombinant plasmid of pET-22b-proaerolysin. Download figure Download PowerPoint Site-directed mutagenesis The mutant expression vectors were constructed by the overlap extension PCR method. As shown in Table 1, both forward and reverse primers containing mutant amino acid were designed. The genes of mutant proaerolysin were amplified by high-fidelity KOD-Plus PCR polymerase in a Thermal Cycler (Bio-Rad) using the following conditions: 94 °C for 2 min; 98 °C for 15 s; 68 °C for 7 min 30 s for 15 cycles; and 72 °C for 10 min. PCR products were treated with 1 U DpnI at 37 °C for 2 h to digest WT proaerolysin plasmids. Linear digestion products were cyclized by 1 U T4 polynucleotide kinase and 1 U T4 ligase at 16 °C for 3 h. The mutant vector was transformed into E. coli DH5α and sequenced in Shanghai Sunny Biotechnology Co., Ltd. The plasmids of proaerolysin were extracted by TIANprep Mini Plasmid Kit. Table 1 | The sequences of primers used in this work Mutant proteins Sense primers Anti-sense primers Q212R CGTTCTGGTTACGACGTTACCCTGC CGGGGTATCGCTATCGTTAACTG R282G GGTCCGACCGTTCCGGCACGTAG CACGCTCTGACTCAGACTGGTGGTG N226Q CAATGGAGCAAAACCAATACCTACG GGTTGCGGTATCGTAACGCAGGG Proaerolysin expression and purification The mutant proaerolysin plasmids were transformed into E. coli BL21 (DE3) pLysS cells. After plating, a single bacterial colony was inoculated in 10 mL LB medium containing 100 µg/mL ampicillin and allowed to incubate overnight in a shaker held at 37 °C. The culture was diluted with 1 L fresh LB medium containing 100 µg/mL ampicillin and grown at 37 °C and 220 r/min until an OD600 of 0.6. A 0.5 mM final concentration of isopropyl 1-thio-b-d-galactopyranoside was added to the bacterial culture to induce protein expression for 4 h at 16 °C and 220 r/min. The E. coli cells were harvested from culture by centrifugation (3000 revolutions per minute for 30 min at 4 °C). The collected cell pellets were resuspended in 100 mL lysis buffer (0.5 M NaCl, 20 mM Na3PO4, pH 7.4) and lysed by sonication using 160 cycles of 5 s work and 10 s interval on ice. Bacteria lysates were centrifuged at 3000 revolutions per minute for 30 min at 4 °C. A Ni-NTA affinity resin column was equilibrated with lysis buffer, and collected supernatant was loaded onto the column, allowing the supernatant to traverse the column at 6 s every drop. The Ni-NTA affinity resin column was washed with two buffers successively to remove the unbound proteins, first with 20 mM Na3PO4, 0.5 M NaCl, pH 7.4, and 50 mM Imidazole, followed by 20 mM Na3PO4, 0.5 M NaCl, pH 7.4, and 100 mM Imidazole. Finally, mutant proaerolysin proteins were washed with elution buffer containing 20 mM Na3PO4, 0.5 M NaCl, pH 7.4, and 300 mM Imidazole. The molecular weight of the collected protein was confirmed by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). Formation of aerolysin nanopore and electrochemical measurement Proaerolysin was activated by trypsin–EDTA at room temperature for 6 h. A Delrin bilayer cup (Warner Instruments, Hamden, CT, USA) contained a septum with a 50 µm orifice that formed two chambers that had a cis side and trans side. The lipid bilayer produced by 1,2-diphytanoyl-sn-glycero-3-phosphocholine spanned the orifice. Both chambers contained 1 mL electrolyte solution (1.0 M KCl, 10 mM Tris, 1 mM EDTA, pH 8.0). Potential was applied via a pair of Ag/AgCl electrodes, which were immersed into the solution of both chambers. 1 µL of aerolysin monomers was injected adjacent to the orifice in the cis side, and the pore-insertion was determined by the open pore current. Data analysis Current traces were recorded on a patch clamp amplifier (Axopatch 200B) and converted into digital signals with an analog–digital converter (Digidata 1440A). All signals were filtered with low-pass Bessel filter at 5 kHz and sampled at 100 kHz by running Clampex 10.4 software (Molecular Devices, Forest City, CA, USA). Recently, low-current electrochemical measurement systems have been developed for nanopore detection.39, 40 Data were processed using the following software: Clampfit 10.4, MOSAIC,41, 42 and Origin (OriginLab Corporation, Northampton, MA, USA). Results and Discussion The plasmids of the three mutations were sequenced separately at Shanghai Sunny Biotechnology Co., Ltd. To verify the mutant results, the sequencing spectrograms around the mutation site (Q212R, R282G, and N226Q) are shown in Figure 2a–c. Taking the sequencing spectrograms of Q212R, for example, the codon in position 212 is mutated to CGA, while the other part of the plasmid sequence remains unchanged (), which demonstrates that the mutant plasmid of Q212R is successfully constructed. We verified the mutant result of R282G and N226Q using the same method. As shown in Figure 2d, we purified N226Q, R282G, and Q212R mutant proaerolysin proteins. After activated with trypsin, R282G and N226Q mutant aerolysin monomers largely formed oligomers having molecular weights much larger than 116 kD and which remained at the top of the SDS–PAGE while only a small amount of the monomers remained. However, the Q212R mutant aerolysin monomers failed to oligomerize after activation with trypsin. All of the proteins remained at the band around 52 kD on the SDS–PAGE. Moreover, the purity of the proteins fabricated by this method meet the demands of electrochemical measurement. Figure 2 | Sequencing spectrogram of Q212R (a), R282G (b), and N226Q (c) mutant plasmids. The codons at mutant site are marked by the red rectangles. (d) SDS–PAGE analysis result. The protein samples of N226Q (1), R282G (3), and Q212R (5) mutant proaerolysin monomers. The protein samples of N226Q (2), R282G (4), Q212R (6) mutant, and WT (7) aerolysin monomers after activation with trypsin. Proaerolysin was activated with trypsin for 8 h at room temperature. Download figure Download PowerPoint To verify the ability of WT and mutant aerolysin monomers to form nanopore, we injected WT R282G, Q212R, and N226Q aerolysin monomers adjacent to the lipid bilayer in the cis chamber. As shown in Figure 3, when the WT, N226Q and R282G aerolysin monomers were added to the cis chamber, a current jump was observed under a bias voltage, demonstrating that, under our experimental conditions, these monomers could oligomerize and insert lipid bilayer. This phenomenon was not observed when we injected Q212R near the lipid bilayer, illustrating that glutamine-212 is a vital site for pore formation. In other words, the substitution of glutamine with arginine hinders the oligomerization of mutant aerolysin monomers. Negatively charged oligonucleotides (5′-AAAA-3′) were added to the cis chamber to characterize the aerolysin nanopores. Poly(dA)4 generated longer and larger current blockage signals in N226Q mutant than those in the wild-type aerolysin nanopore. Poly(dA)4 failed to block the current of the R282G mutant, which results from the removal of positively charged arginine at the nanopore entrance. Domains 3 and 4 of proaerolysin were profoundly rearranged during pore formation,27 where the residue Q212 is located. We also performed single-spot mutation at D209, S213, and Y215. These mutant aerolysin monomers did not appreciably oligomerize (data not shown). In our previous study,43–45 we proved that the residue R220 located under the R282 is responsible for selectivity, and the residue K238 is related to sensitivity. These results proved that there are possibly three regions in aerolysin, which are related to pore formation, selectivity, and sensitivity. The residues located in the corresponding region could be modified when the selectivity or sensitivity are regulated. The residues located in the pore-forming region should be cautiously selected to mutate, because the change of residues might hinder the pore formation. Figure 3 | Single-biomolecule interface models and the corresponding raw current traces versus time of WT aerolysin (a), Q212R mutant (b), R282G mutant (c), and N226Q mutant (d). The three regions in the aerolysin nanopore are responsible for pore formation (orange), sensing selectivity (red), and sensitivity (green). The data were recorded in 1.0 M KCl, 10 mM Tris, 1.0 mM EDTA at pH 8.0, and 22 ± 2 °C. The concentration of poly(dA)4 was 2.0 μM. The applied potential was +120 mV. Download figure Download PowerPoint The structure of the WT aerolysin nanopore is quite stable and has a constant conductance in our experimental conditions. As shown in Figure 4a, the current–voltage curve of N226Q mutant exhibits a linear relationship between the open pore current and the applied voltage, which is almost the same as that of the WT aerolysin nanopore. This proves that the substitution of asparagine with glutamine at 226 maintains the structure of the aerolysin nanopore. The current–voltage curve of R282G deviates from a linear relationship at high voltage, which is due to the rectification caused by the removal of positive charge within the nanopore. The current signals of poly(dA)4 were statistically analyzed according to I/I0 and duration time. Here, I represents residual current, whereas I0 stands for the open pore current. As shown in Figure 4b–c, the histograms of I/I0 are fitted with a Gaussian distribution, and the duration time histograms correspond to an exponential distribution. At an applied voltage +120 mV, the fitted value of I/I0 in N226Q is 0.42 ± 0.02, less than the fitted value of 0.51 ± 0.01 in WT aerolysin, indicating that poly(dA)4 generates a 1.25 times larger blockage amplitude in the N226Q mutant than in WT aerolysin. Additionally, the full width at half maximum of the I/I0 peak in N226Q is narrower than in WT aerolysin (Figure 4b; ), proving that poly(dA)4 displays quite uniform behavior through N226Q, which further demonstrated the sensitivity of N226Q. The duration time of poly(dA)4 through N226Q is 9.86 ± 1.20 ms, which is 1.83 times longer than the fitted value of 5.40 ± 1.40 ms in WT aerolysin. This means that the substitution of asparagine with glutamine, containing a longer side chain, enhances the poly(dA)4–nanopore interaction. Figure 4 | The statistical analysis of poly(dA)4 in single-channel WT and mutant aerolysin nanopore. (a) I–V curves of WT (red), N226Q (black), and R282G mutant (blue). (b) I/I0 histograms of WT and N226Q mutant. I/I0 histograms of WT and N226Q mutant fit a Gaussian distribution. (c) Duration time histogram of N226Q mutant. Duration time histogram of N226Q mutant is fitted by an exponential function. (d) Duration time (orange) and frequency (green) versus applied voltage ranging from +80 to +160 mV for N226Q mutant. The data were recorded in 1.0 M KCl, 10 mM Tris, 1.0 mM EDTA at pH 8.0, and 22 ± 2 °C. The concentration of poly(dA)4 was 2.0 μM. The applied voltage was +120 mV in (b) and (c). The error bars represent the standard deviation of the data, which was based on three independent experiments. Download figure Download PowerPoint We further investigated the influence of voltage on the poly(dA)4–nanopore interaction. At applied voltages ranging from +80 to +160 mV, the duration times of poly(dA)4 by N226Q and WT aerolysin both decrease exponentially with increasing voltage (Figure 4d; ), that the of voltage the translocation of However, the translocation frequency of poly(dA)4 in N226Q is that in WT aerolysin, which proves that the sensitivity region the selectivity of the aerolysin nanopore. In we developed a method to construct and a single-biomolecule interface from aerolysin for single-molecule A of mutant aerolysin single-biomolecule were designed and verified by single oligonucleotide results that glutamine-212 is a vital site for aerolysin pore formation. The replacement of positively charged arginine at the the selectivity of the aerolysin nanopore. N226Q mutant prolongs the translocation time of poly(dA)4 by almost a factor while enhancing the blockage amplitude by 25%. We that each single-molecule interface should three critical regions, which are responsible for pore formation, sensing selectivity, and sensitivity. This generalized method of constructing a single-biomolecule interface is controllable, which could be applied in not only the proteins also other pore-forming a protein of single-molecule could be which could the development of functionalized sensors for specific applications to single-molecule measurements. Yi-Tao The information is of mutant proaerolysin and experimental of The authors This was by the Science of China and of Shanghai Ying Interface for the and of with Li of on Li Li Wang for of on A for Molecular of Ying of of with a Aerolysin of by Nanopore of a Membrane 1, DNA to and for 3, and via from DNA with an E. DNA at with a Mutant Nanopore and DNA Nanopore Sequencing of of DNA Wang Wang of and DNA of DNA Wang of a Nanopore for a pH Li of Cells with an Aerolysin Nanopore the of DNA of by of the Aeromonas Proaerolysin in and of a of the Aerolysin a of and Aerolysin Li Wang Wu of Current in with and Wu and of with of with a of an Aerolysin of at the Mutant and by and for of a Li Wang of in an and of by Aerolysin Nanopore Ying Current for Nanopore Wang Ying of Molecular in Current A Single-Molecule Interface for Nanopore Wang Ying Li Wang Sensing and of an Aerolysin Nanopore via 3, Wang Li Wang Wu Ying of of the Aerolysin Nanopore for Li Wang the Sensing of Aerolysin for was by the Science of China and of Shanghai times