Identification of Pneumocystis carinii DNA in oropharyngeal mouth washes from AIDS children dying of respiratory illnesses

Polymerase chain reaction (PCR) usingPneumocystis carinii-specific primers pAZ 102-H(5′–GTGTACGTTGCAAAGTACTC–3′) and pAZ 102-E(5′–GATGGCTGTTTCCAAGCCCA–3′) was performed on oropharyngeal washes obtained at autopsy from 22 AIDS children with histologically confirmedP. cariniipneumonia (PCP), and 48 control AIDS children who died from other infections. Fifteen of 22 (68%) PCP samples and none of 48 (0%) control samples had detectableP. cariniiDNA (sensitivity 68%; specificity 100%; positive predictive value 100%; negative predictive value 87%). This method requires further validation in clinical practice. Childhood respiratory diseases are common causes of paediatric hospital admissions in both HIV-positive and HIV-negative children [1]. Pneumocystis carinii pneumonia (PCP) is one of the most serious HIV-associated opportunistic infections among children. PCP was initially thought to be a rare manifestation of AIDS in Africa [2,3], although recent reports indicated that PCP is an important clinical problem in African children [4–6]. PCP, tuberculosis and community-acquired pneumonia have overlapping clinical features, and therefore misdiagnosis often occurs in the absence of specific criteria for making a pathogen-specific diagnosis. The definitive diagnosis of PCP is dependent on the identification of cysts or trophozoites of P. carinii in lavage samples or lung biopsy. Bronchoscopy and needle biopsies are difficult to perform in children, are labour-intensive and distressing to both parent and child, and are not performed as routine even in resource-rich countries. There is a need to develop accurate diagnostic tests for PCP in children on easily obtainable clinical specimens. The molecular analysis of P.carinii DNA by polymerase chain reaction (PCR) of clinical samples that are easily obtainable, such as orophrayngeal secretions, was first described by Wakefield and colleagues [7] in 1993, and has been successfully applied to clinical studies on adults [8–10]. Necropsy lung samples provide a definitive histopathological diagnosis on the identification of P. carinii cysts on microscopy. The availability of oropharyngeal saline mouth washes from a recent necropsy study of Zambian children provided a unique opportunity to evaluate the use of PCR for the identification of P. carinii DNA, and to establish the sensitivity and specificity of the test. PCR for the detection of P. carinii DNA was performed on coded oropharyngeal samples obtained at autopsy from two groups of children with AIDS: those histologically confirmed as having PCP; and those who died of other respiratory infections. The sites where the study was carried out were the Department of Pediatrics and the JICA Laboratories, Department of Pathology, University Teaching Hospital, Lusaka, Zambia. The parents or guardians of children who died of respiratory disease in the inpatient paediatric wards were approached and details of the study were explained. Time was given to consult any relatives present and come back with any questions. Arrangements to offer counselling to parents wishing to know the HIV status of their child were in place. The autopsy was carried out within 6 h of death. Consent for a limited post-mortem and for obtaining oropharyngeal mouth washes was obtained. A syringe with a quill was used to squirt 10 ml saline into the mouth, which was aspirated (a new syringe, sterile saline pack, and quill was used for each cadaver, and each specimen was placed in a sterile container). These samples were frozen at −70°C. A limited necropsy was performed using aseptic techniques, and among other material, lung tissues were obtained for histopathological examination. A change of gloves and blades was made between each procedure. The initial standard staining technique was with haematoxylin and eosin, Ziehl–Neelsen and Gomori–Grocott methenamine silver nitrate stain. Oropharyngeal mouth washes from 22 HIV-positive children with histopathologically confirmed PCP and 48 HIV-positive children with other respiratory infections were selected for laboratory analyses by PCR. These samples were allocated random numbers, and the molecular analyses on them was performed with technical staff blinded to the diagnosis. Known measures for avoiding contamination were used during DNA extraction and amplification (laminar flow cabinet, disposable gloves, pipettes, tubes and reagents). The detection of P. carinii DNA sequences with PCR amplification was performed as previously described [11] using the primers pAZ 102-H (5′–GTGTACGTTGCAAAG TACTC–3′) and pAZ 102-E (5′–GATGGCT GTTTCCAAGCCCA–3′), which amplify a fragment of the large subunit ribosomal RNA. All PCR products were separated by gel electrophoresis on 2% agarose gels stained with ethidium bromide and visualized under ultraviolet light. PCR results were aligned to histopathological diagnosis after decoding. The sensitivity and specificity of PCR for the detection of the presence of P. carinii DNA in oropharyngeal washes as a diagnostic measure for PCP was determined using histopathological identification of the organism as the gold standard. The positive and negative predictive values of the test were calculated. P. carinii DNA was detected in 15 out of 22 oropharyngeal mouth washes of children with AIDS (sensitivity 68%). None of the 48 oropharyngeal samples from AIDS children who died of other respiratory infections had any P. carinii DNA detectable by PCR (specificity 100%) (Table 1). The positive predictive value of PCR for P. carinii DNA detection on oropharyngeal mouth washes from children was 100% (15/15) and the negative predictive value was 87% (48/55).Table 1: Polymerase chain reaction for Pneumocystis carinii DNA on oropharyngeal washings compared with histopathological identification. As oropharyngeal mouth wash samples can be easily obtained without involving an invasive procedure, the molecular identification of P. carinii DNA in mouth washes from children may have the potential for use as a practical diagnostic test. It could also be used for large-scale epidemiological and field studies. Encouragingly, the results of this study are similar to those obtained from previous studies in adults [7–10]. None of the control group of children with non-PCP respiratory illness had P. carinii DNA detectable in their oropharyngeal mouth washes, and PCR thus appears to be a highly specific test for PCP in children. However, the test did not detect all the cases of PCP, and its use in clinical practice would thus be limited. There is a need to improve the sensitivity of PCR for the detection of P. carinii DNA in oropharyngeal mouth washes of children. The samples used in this study were from dead children, and further studies are required to establish whether these results can be reproduced in the real-life situation in living children. Obtaining oropharyngeal wash samples from dead children was relatively easy. The procedure may be more difficult in living children, especially those under the age of 3 years. However, a recent study [12] showed that the acquisition of nasopharyngeal aspirates from living infants is possible. If the method can be validated for use in clinical practice, the use of PCR on oropharyngeal samples may have additional applications in field and epidemiological studies. Kennedy Lishimpia Francis Kasoloa,b Chifumbe Chintua Peter Mwabaa Victor Mudendaa Daniel Maswahua,c Hiroshi Terunumab Helen Fletchera,d Andrew Nunne Sebastian Lucasc Alimuddin Zumlaa,d