Colonic epithelial upregulation of interleukin 22 (IL-22) in patients with ulcerative colitis

To the Editor: Inflammatory bowel disease (IBD) is a chronic inflammatory disease thought to be mediated by dysfunctional innate and/or adaptive immunity. This aberrant immune response leads to the secretion of harmful cytokines that destroy the epithelium of the gastrointestinal tract and thus cause further inflammation. Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. Expression of IL-22 is induced in several human inflammatory conditions, including IBD.1 A recent article published by Sugimoto et al2 found that IL-22 gene delivery led to rapid amelioration of local intestinal inflammation in a dextran sulfate sodium-induced model of acute colitis. Expression of the IL-22 receptor is restricted to innate immune cells3; however, the role of IL-22 in ulcerative colitis (UC) patients has not yet been defined. This is the first study to our best knowledge with a larger sample that explores IL-22 gene expression from rectal biopsies in patients with UC. We measured the IL-22 gene expression from rectum biopsies of UC patients from September 2008 to September 2009. All individuals were divided in 3 groups: 1) active UC (n = 26); 2) long-term UC remission (n = 11); and 3) a healthy control group (n = 18). Expression of mRNA IL-22 was measured with a real-time polymerase chain reaction (RT-PCR) method. The following primers were used: IL-22 forward: ccctcaatctgataggttccag and reverse: gcaggtcatcaccttcaatatg; GADPH forward: gcccaatac gaccaaatcc and reverse: agccacatcgctcagaca for normalization. These results showed that IL-22 mRNA expression was upregulated in rectal mucosa from patients with active UC compared to UC patients in remission and healthy controls (P < 0.04 and P < 0.0001, respectively). Interestingly, the expression of IL-22 was also significantly increased in remission UC as compared to normal controls (P < 0.01) as shown in Figure 1. Gene expression of IL-22 in rectal mucosa from patients with UC (active/remission) and healthy controls and the constitutive gene GADPH. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com] We also found that IL-22 gene expression correlated with histological activity (r2 = 0.63 P < 0.0007) by Spearman correlation test. These findings confirmed the potential role of the IL-22 gene in the pathogenesis of UC and suggests that IL-22 might be involved as a defense mechanism by enhanced mucus production.2 In conclusion, gene expression of IL-22 was found to be increased from rectal biopsies in patients with UC.