Characterization of the dynamics of initial bacterial colonization of nonconserved forage in the bovine rumen

The authors of the article by Edwards et al. (2007) would like to provide the following corrected Tables 1 and 4 due to the previous incorrect presentation of the primer information by target sequence, rather than primer sequence. The authors have also taken this opportunity to correct a few minor typographical errors: the E. coli accession number, primer rP2 position and the ordering of three primer names relative to their references. The authors apologize for any inconvenience caused. Primers used in this study for amplification for DGGE and QPCR analysis Based on numbering of the 16S rRNA gene of E. coli K12 (Accession number U00096). Calculated from E. coli K12 (Accession number U00096); primers included. Primers with a 40 bp GC clamp at the 5′ end (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG). Specificity of bacterial 16S rRNA gene nondegenerate primers Numbering according based on the 16S rRNA gene of E. coli K12 (Accession number U00096). Ribosomal Database Project (RDP) Probe Match was carried out on each primer and the percentage of database matches which had a complete match (Match) or one or two mismatches (1 MM, 2 MM) reported. Percentages are normalized for the number of sequences available which are full length over the whole primer sequence length. Mismatches were determined by aligning primer sequences against chloroplast 16S rRNA gene sequences from the tribes Oryzeae, Adropogoneae, Trifoliae and Loteae. x MM, x number of mismatches;+, no mismatches. References are abbreviated as follows: 1, Baker et al. (2003); 2, Wood et al. (1998); 3, Suau et al. (1999); 4, McBain et al. (2003); 5, Cano et al. (2000); 6, Cocolin et al. (2001); 7, Yu & Morrison (2004); 8, Eschenlauer et al. (2002); 9, ben Omar & Ampe (2000); 10, Pryde et al.(1999); 11, Lane (1991).