The GTF2I rs117026326 polymorphism is associated with anti-SSA-positive primary Sjögren’s syndrome

Sir, Primary SS (pSS) represents a systemic autoimmune disease mainly targeting exocrine glands and manifesting as dryness of the mouth (xerostomia) and eyes (xerophthalmia) [1]. It is characterized by lymphocytic infiltrations in these glands and by the presence of a panel of circulating autoantibodies. Among these, those directed against SSA and SSB are the most abundant [1]. As is common for autoimmune diseases, the pathogenesis of pSS involves genetic predisposition as well as environmental factors. Determining the genetic basis of pSS will provide an important research tool for exploring the pathogenesis of the disease. In a recent study published in Nature Genetics, Li et al. [2] reported the first genome-wide association study for pSS. In addition to the HLA locus, three non-HLA susceptibility loci, GTF2I, STAT4 and TNFAIP3, were identified in their study [2]. Unexpectedly, the locus indicating the strongest susceptibility was not the HLA locus but the GTF2I rs117026326 C/T polymorphism, with the T allele as the risk allele (OR 2.20, P = 1.31 × 10−53) for pSS. Moreover, the latter locus has not been reported so far to be associated with any other autoimmune diseases [3, 4], indicating a potential pSS-specific genetic predisposition. The discovery of the GTF2I rs117026326 polymorphism as a strong and disease-specific susceptibility locus provides a hint regarding pSS-specific pathogenesis. Therefore, confirmation of disease relevance and a more detailed analysis of this locus will help considerably in exploring the pathogenesis of pSS. The GTF2I rs117026326 polymorphism was reported to be associated with pSS in Han Chinese but not in Caucasians [2, 5], suggesting an ethnic-specific susceptibility locus. Since most of the samples used in the study of Li et al. were recruited in north China, we aimed to confirm the association in a pSS cohort established in south China that includes 72 pSS patients and 196 healthy controls from Xiamen, China. All pSS patients were diagnosed according to the standards defined by criteria of the American–European Consensus Group in 2002 [1]. This study was approved by the ethics committee of Xiamen University. All patients provided written informed consent according to the Declaration of Helsinki. The GTF2I rs117026326 polymorphism was genotyped using direct sequencing of a PCR amplified fragment comprising the target sequence. The frequency of the GTF2I rs117026326 T allele was 18.06% in pSS cases and 11.48% in the control group. The frequency of the T allele was considerably lower in both pSS cases and controls compared with that reported by Li et al. [2], suggesting that the minor allele of the polymorphism is less prevalent in south China than in north China. Compared with the control group, a significant association of the minor T allele with the pSS cases was detected (OR 1.70, 95% CI 1.01, 2.88; P = 0.048) (Table 1). These results are consistent with the findings reported by Li et al. and confirm the association of the GTF2I rs117026326 polymorphism with pSS in this cohort also. Association of the GTF2I rs117026326 polymorphism with primary SS The rs117026326 polymorphism was genotyped by direct sequencing of the PCR product amplified with forward primer ACTGATACGTGCAACGCTGT and reverse primer TGTCCCCTTGTTATTCATTGC. The OR and P-value were calculated using the χ2 test or Fisher’s exact test for the comparison of T allele vs C allele. pSS: primary SS. Association of the GTF2I rs117026326 polymorphism with primary SS The rs117026326 polymorphism was genotyped by direct sequencing of the PCR product amplified with forward primer ACTGATACGTGCAACGCTGT and reverse primer TGTCCCCTTGTTATTCATTGC. The OR and P-value were calculated using the χ2 test or Fisher’s exact test for the comparison of T allele vs C allele. pSS: primary SS. Based on these results, we next examined whether the GTF2I rs117026326 T allele is associated with autoantibody status. Thus, we stratified our analysis by considering the anti-SSA autoantibody status within the pSS group. Compared with the group including all pSS patients, a slight increase in the frequency of the risk-associated T allele was observed in the anti-SSApositive subgroup (19.49 vs 18.06%), while the frequency of the risk-associated T allele decreased to 11.54% in the anti-SSA-negative subgroup. Compared with healthy controls, we observed a significant difference in the frequency of the risk-associated T allele in anti-SSA-positive patients (OR 1.87, 95% CI 1.08, 3.24; P = 0.026), which is not seen in anti-SSA-negative patients (OR: 1.01, 95% CI 0.29, 3.48, P = 0.992). These results demonstrate that the GTF2I rs117026326 C/T polymorphism is specifically associated with the presence of anti-SSA autoantibodies in pSS. GTF2I encodes the general transcription factor IIi, which has been reported to be involved in the regulation of T- and B-cell activation [6, 7]. Particularly, transcription factor IIi binding to the DICE elements in the Igh promoter is important for the transcription of the heavy chain of IgG [7, 8], emphasizing its role in the generation of antibodies. Within this view, the association of the GTF2I rs117026326 C/T polymorphism with autoantibody status in pSS may be directly related to the function of the GTF2I gene. The rs117026326 polymorphism is located within the intron of GTF2I, suggesting a potential effect on the regulation of gene expression. We then determined the expression of the three genes within the locus (GTF2I, GTF2IRD1 and NCF1) in circulating leucocytes of pSS patients. We did not find any significant difference in the expression of the three genes between leucocytes with the CC genotype and those with the CT genotype (supplementary Fig. S1, available at Rheumatology online). This result is in accordance with predictions from expression quantitative trait locus analysis performed by Li and coworkers [2]. Since the susceptibility locus does not exert its effect by regulating the level of gene expression, the mechanisms by which this polymorphism affects the pathogenesis of pSS remain to be elucidated. In summary, we confirmed the association of the GTF2I rs117026326 polymorphism with pSS in a cohort consisting of south Han Chinese. Furthermore, our results show for the first time that this polymorphism is associated only with anti-SSA positive and not anti-SSA-negative pSS. This finding sheds new light on the pathogenesis of pSS. The GTF2I rs117026326 polymorphism is associated with anti-SSA positive but not anti-SSA-negative pSS. Funding: This work was supported by the National Natural Science Foundation of China (No. 81371325). Disclosure statement: The authors have declared no conflicts of interest.