Minimal variation in T-20 binding domain of different HIV-1 subtypes from antiretroviral-naive and -experienced patients

In-vitro differences in T-20 susceptibility among HIV-1 subtypes have been reported. We therefore studied the T-20 binding domain of a variety of virus subtypes from both antiretroviral-naive and -experienced patients. Minimal variation in the HR-1 region of gp41 was observed, especially within the region responsible for T-20 resistance. Any subtype differences in T-20 susceptibility do not appear to be related to HR-1 genetic variation. Despite the huge success of potent combination antiretroviral therapy for HIV-1, the emergence of drug-resistant virus has become a widespread and growing problem. The fusion inhibitor T-20 (formerly known as DP178) represents a new class of antiviral drug, targeting virus binding and cell fusion. Viral envelope glycoproteins play a critical role in this infectious process. Binding of gp120 to both CD4 and a co-receptor on the T cell surface triggers a conformational change in the envelope protein complex, leading to the insertion of the transmembrane subunit gp41 into the target cell membrane [1]. The fusion inhibitor T-20 is a synthetic, 36 amino acid peptide corresponding to residues 127–162 of the HR2 (C-helix region) of gp41. It blocks HIV-1 entry by binding to the HR1 (N-helix region), and therefore prevents the formation of the fusion-active conformation of gp41 [2]. In-vitro serial passage experiments identified two specific mutations, namely G36S and V38M, in a glycine–isoleucine–valine (GIV) motif within the amino HR1 region of gp41, which were associated with reduced susceptibility to T-20. These mutations were also detected in vivo in clinical trials [3,4]. HIV-1 subtypes are geographically distributed, with subtype B predominating in north America and Europe. Consequently, the bulk of studies on the biological basis of drug susceptibility have been undertaken on subtype B viruses. However, the most prevalent viruses worldwide are non-B subtype, and the prevalence of non-B viruses is increasing in Europe. Genetic subtypes may influence drug susceptibility, as well as the likelihood of developing drug resistance-associated mutations. The natural occurrence of drug resistance-associated mutations in the target genes of HIV-1 isolates from untreated patients has been reported, and has important implications for therapy and the outcome of drug treatment [5,6]. Currently, there is lack of information on primary resistance of HIV-1 to T-20 in different subtypes. In this report, the sequences of the HR1 region of gp41 from T-20 treatment-naive patients infected with subtype B and non-B HIV-1 strains were analysed for the presence of natural primary mutations linked to resistance to T-20. Plasma samples from 57 T-20-naive patients were studied. These individuals included reverse transcriptase inhibitor and protease inhibitor-experienced and -naive individuals, who were infected with a range of HIV-1 subtypes. The viral RNA extraction and complementary DNA synthesis were performed as previously described [7]. A 272 base pair region covering the gp41 coding sequence from amino acid 1 to amino acid 70 was amplified by nested reverse transcriptase–polymerase chain reaction, and sequenced using Beckman CEQ2000 protocols. The following primer pairs were used: 5′gp41 (CCTGGAGGAGGARAYATGARG) and 3′gp41 (TATCCCTGCCTAACTCTATT) as outer primers, and 5′T-20 (AGGCAAARAGRA GAGTGGTG) and 3′T-20 (KTTGATCYTTTAGG TATCTTTC) as inner primers, covering nucleotides 7735–7995, respectively. These primers were designed to amplify the most commonly observed HIV-1 subtypes circulating in the UK (A, B, C, D, AE and AG). The genetic subtypes were determined on the basis of sequences of pol gene sequences using the database maintained at Stanford University [8]. No primary mutations associated with resistance to T-20 (G36S and V38M) were observed in any of 57 subtype B and non-B strains examined. Of the 57 samples, 17 had a silent mutation at the third position of amino acid 36 (GGT–GGC), mainly in subtype A (12/15), G (2/4) and AE/AG (2/5) viruses (Table 1). No other consistent patterns of changes within the area of genome sequenced were observed. These viruses included those with a range of reverse transcriptase and protease drug resistance-associated mutations, the presence of which did not appear to influence the gp41 sequences.Table 1: Genetic variability in the HR-1 domain of HIV gp41. This is the first report on sequence analysis of the HR-1 domain of different subtypes of HIV-1 in T-20-naive patients. Despite the genetic variability among subtypes, our data suggest that the ‘GIV’ motif within the HR1 region is highly conserved, and natural variants may only rarely occur in the absence of specific selective pressure. Such a conclusion is consistent with the data in the Los Alamos National Laboratory Sequence Database [9], which showed that the ‘GIV’ motif is more conserved than are other residues in the HR1 region. Furthermore, the silent T–C mutation at the third position within the amino acid 36 coding triplet does not confer any advantage/disadvantage with regard to genetic routes to resistance. A previous study of long-term infected and heavily pretreated patients [10] also found no primary resistance mutations to T-20. Recent studies [11] suggest that in addition to the ‘GIV’ sequence as the major determinant, the co-receptor specificity might be also a significant independent modulator of sensitivity to T-20. There is also experimental evidence to suggest that the level of inhibition decreases with divergence in the HR2 region of different subtypes, with the highest inhibition for subtype B HIV-1 NL3-3 strain and the lowest for non-B subtypes [12]. These findings have important implications for understanding the mechanisms of T-20 action on blocking virus fusion and entry, as well as for investigating the potential impact of subtype genetic variations on the treatment response to T-20. Our data suggest that such differences are not caused by subtype-specific changes in the HR-1 region of the virus, although we cannot exclude the presence of variation outside this area, which could impinge on the complex virus entry mechanism, and therefore on the activity of fusion inhibitors. Although the primary mutations to T-20 could not be detected from different subtypes in treatment-naive patients, further clinical studies are required to monitor treated patients infected with different subtypes, and to identify the possible genetic route leading to drug resistance. Finally, studies on the relationship of genotypic basis and drug susceptibility are needed to determine whether the sequence divergence across subtypes in other regions of the envelope may also influence the susceptibility to T-20 and the emergence of drug-resistant variants. Li Xu Stéphane Hué Stephen Taylor Daina Ratcliffe Judith A. Workman Susan Jackson Patricia A. Cane Deenan Pillay