child at the homozygote state -would be responsible for the phenotype and could explain the absence of amplification of the promoter and the exon 1.To verify the large deletion hypothesis, several couples of primers were designed to amplify 8 small genomic regions around the promoter and the exon 1 (Table 1).These markers were called D01 to D04 from the promoter towards the centromere and D11 to D14 from the exon 1 towards the telomere.Firstly, the deletion was localized between 2680 bp (amplification of D03) upstream and 2794 bp (amplification of D12) downstream from the codon start adenine in exon 1 (Figure 1).Primers surrounding this region were used to determine the exact breakpoints by amplification and sequencing (5' agcaaggacagatatgcaaa 3' on forward and 5' acacctaagcctgactgcac 3' on reverse).A 4591 bp-deletion was characterized in the child and his parents covering 2335 bp in 5'UTR, the exon 1 and 1377 bp in the intron 1-2.Moreover, the sequences of the child and his parents were strongly reorganized in 5' with several sequence alterations such as mutations (10), insertion-deletions (2), duplication (1) and an insertion (23 bp between the breakpoints).Large deletions are rarely involved in Crigler-Najjar disease but their frequency is probably underestimated as suggested for CFTR gene.7 Gross genomic rearrangements have to be investigated in situations of refractory molecular diagnosis of Crigler-Najjar disease.Quantitative multiplex PCR of short fluorescent fragments should be developed in UGT1A1 gene analysis in these specific situations.
No takes yet. Share an insight, caveat, or question.
Terui et al. (2008) studied this question.