Angiotensin II type 2 receptor activation induces apoptosis by activating MAP kinase phosphatase-1, which inhibits MAP kinase and dephosphorylates Bcl-2.
The AT2 receptor induces apoptosis by activating MAP kinase phosphatase-1, which inhibits MAP kinase activation and leads to the dephosphorylation and inactivation of the survival factor Bcl-2.
We examined the cellular and signaling mechanism of angiotensin II (Ang II) type 2 (AT2) receptor-induced apoptosis in PC12W (rat pheochromocytoma cell line) cells that express abundant AT2 receptor but not Ang II type 1 receptor. In these cells, nerve growth factor (NGF) inhibited the internucleosomal DNA fragmentation induced by serum depletion, whereas Ang II antagonized this NGF cell survival action and induced apoptosis. We studied the mechanism of NGF and AT2 receptor interaction on apoptosis by examining their effects on the survival factor Bcl-2. AT2 receptor activation did affect intracellular Bcl-2 protein levels. Bcl-2 phosphorylation was stimulated by NGF, whereas AT2 receptor activation blocked this NGF effect. Pretreatment with antisense oligonucleotide of mitogen-activated protein (MAP) kinase phosphatase-1 enhanced the effects of NGF on MAP kinase activation and Bcl-2 phosphorylation but attenuated the inhibitory effects of AT2 receptor on MAP kinase, Bcl-2 phosphorylation, and apoptosis. Taken together, these results suggest that MAP kinase plays a critical role in inhibiting apoptosis by phosphorylating Bcl-2. The AT2 receptor inhibits MAP kinase activation, resulting in the inactivation of Bcl-2 and the induction of apoptosis. We examined the cellular and signaling mechanism of angiotensin II (Ang II) type 2 (AT2) receptor-induced apoptosis in PC12W (rat pheochromocytoma cell line) cells that express abundant AT2 receptor but not Ang II type 1 receptor. In these cells, nerve growth factor (NGF) inhibited the internucleosomal DNA fragmentation induced by serum depletion, whereas Ang II antagonized this NGF cell survival action and induced apoptosis. We studied the mechanism of NGF and AT2 receptor interaction on apoptosis by examining their effects on the survival factor Bcl-2. AT2 receptor activation did affect intracellular Bcl-2 protein levels. Bcl-2 phosphorylation was stimulated by NGF, whereas AT2 receptor activation blocked this NGF effect. Pretreatment with antisense oligonucleotide of mitogen-activated protein (MAP) kinase phosphatase-1 enhanced the effects of NGF on MAP kinase activation and Bcl-2 phosphorylation but attenuated the inhibitory effects of AT2 receptor on MAP kinase, Bcl-2 phosphorylation, and apoptosis. Taken together, these results suggest that MAP kinase plays a critical role in inhibiting apoptosis by phosphorylating Bcl-2. The AT2 receptor inhibits MAP kinase activation, resulting in the inactivation of Bcl-2 and the induction of apoptosis. The processes of cell survival and cell death involve highly regulated signaling pathways that are currently the subject of intense investigation. Apoptosis is a ubiquitous, evolutionally conserved, physiological mechanism of cell death that regulates tissue mass and architecture in many tissues (1Wyllie A.H. Cancer Metastasis Rev. 1992; 11: 95-103Crossref PubMed Scopus (575) Google Scholar). The rat PC12W pheochromocytoma cell line is widely used to examine the molecular and cellular mechanism of apoptosis. Xia et al. (2Xia Z. Dickens M. Raingeard J. Davis R.J. Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5019) Google Scholar) demonstrate, using PC12W cells, that signaling through mitogen-activated protein (MAP) 1The abbreviations used are: MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; NGF, nerve growth factor; Ang II, angiotensin II; AT2, Ang II type 2; MKP, MAP kinase phosphatase; PAGE, polyacrylamide gel electrophoresis. 1The abbreviations used are: MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; NGF, nerve growth factor; Ang II, angiotensin II; AT2, Ang II type 2; MKP, MAP kinase phosphatase; PAGE, polyacrylamide gel electrophoresis. kinases plays a critical role in cell survival and death. Extracellular signal-regulated kinases (ERK) (p42 and p44 MAP kinases known as p42MAPK/ERK2 and p44MAPK/ERK1) act as survival signals, whereas c-JUN NH2-terminal protein kinase and p38 exert cell death signaling. In the presence of nerve growth factor (NGF), the survival signal pathway is activated, whereas the cell death signaling pathway is suppressed. Angiotensin II (Ang II) exerts various actions in its diverse target tissues controlling vascular tone, hormone secretion, tissue growth, and neuronal activities primarily via Ang II type 1 receptor. Recently, a second receptor subtype known as AT2 receptor has been cloned (3Mukoyama M. Nakajima M. Horiuchi M. Sasamura H. Pratt R.E. Dzau V.J. J. Biol. Chem. 1993; 268: 24539-24542Abstract Full Text PDF PubMed Google Scholar, 4Kambayashi Y. Bardhan S. Takahashi K. Tsuzuki S. Inui H. Hamakubo T. Inagami T. J. Biol. Chem. 1993; 268: 24543-24546Abstract Full Text PDF PubMed Google Scholar). We and others have demonstrated that the AT2 receptor stimulates a tyrosine phosphatase (5Bottari S.P. King I.N. Reichlin S. Dahlstroem I. Lydon N. de Gasparo M. Biochem. Biophys. Res. Commun. 1992; 183: 206-211Crossref PubMed Scopus (234) Google Scholar, 6Nakajima M. Hutchinson H. Fujinaga M. Hayashida W. Morishita R. Zhang L. Horiuchi M. Pratt R.E. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10663-10667Crossref PubMed Scopus (641) Google Scholar, 7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar, 8Hayashida W. Horiuchi M. Dzau V.J. J. Biol. Chem. 1996; 271: 21985-21992Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar) that inhibits MAP kinase (p42MAPK/ERK2 and p44MAPK/ERK1) activation and induces apoptosis in PC12W cells and confluent R3T3 cells (mouse fibroblast cell line) (7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar). In this study, we hypothesize that this inactivation of MAP kinase plays a pivotal role in mediating apoptosis via the inactivation of the cell survival factor Bcl-2. Bcl-2 can prevent or delay apoptosis induced by a wide variety of stimuli and insults, suggesting that Bcl-2 controls a distal step in the final common pathway for cell death (9Reed J.C. J. Cell Biol. 1994; 124: 1-6Crossref PubMed Scopus (2384) Google Scholar). Recent data support that the post-translational modification of Bcl-2 such as phosphorylation is important for the regulation of Bcl-2 function (10May W.S. Tyler P.G. Ito T. Armstromg D.K. Qatsha K.A. Davidson N.E. J. Biol. Chem. 1994; 269: 26865-26870Abstract Full Text PDF PubMed Google Scholar, 11Halder S. Jena N. Groce C.M. Proc. Natl. Acad. Sci, U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (743) Google Scholar, 12Chen C.Y. Faller D.V. J. Biol. Chem. 1996; 271: 2376-2379Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Here, we demonstrated that MAP kinase phosphorylated Bcl-2 and AT2 receptor stimulation activated MAP kinase phosphatase 1 (MKP-1) and inhibited the phosphorylation of Bcl-2 in PC12W cells, resulting in the induction of apoptosis. PC12W cells were grown in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) with 10% horse serum, 5% fetal bovine serum. Cell number was counted by Coulter counter. PC12W cells were seeded onto a 10-cm dish (Becton Dickinson) at 2 × 10−6 cells/dish. The cells were first grown in serum-fed Dulbecco's modified Eagle's medium and then kept in serum-free medium for 12 h. The cells were washed three times in serum-free and phosphate-free medium and equilibrated with 32Porthophosphoric acid (Amersham Life Science, Inc.) at the concentration of 100 μCi/ml in phosphate-free medium for 12 h. The radiolabeled cells were treated with NGF (20 ng/ml), Ang II (10−8 and 10−7m), and/or PD123319 (10−5m) at 37 °C for 30 min. The cells were washed with HEPES-buffered saline and lysed in 0.5 ml of radioimmune precipitation buffer containing 1 mmphenylmethylsulfonyl fluoride, 1 mm sodium orthovanadate, and 10 μg/ml aprotinin. Cell lysates were centrifuged at 8,500 × g for 20 min, and the supernatant was incubated with 10 μg of Bcl-2 antibody (Santa Cruz Biotechnology) at 4 °C for 12 h. After precipitation with protein A/G-agarose (Santa Cruz Biotechnology), samples were boiled in Laemmli loading buffer for 3 min and resolved by 12% SDS-PAGE. The gel was stained with Coomassie Brilliant Blue, dried, and analyzed by autoradiography. The bands corresponding to the Bcl-2 were cut, and their radioactivity was measured. For immunoblotting, cell lysates (100 μg) were run on 12% SDS-PAGE, electroblotted onto nitrocellulose membrane, and immunoblotted with Bcl-2 antibody or MKP-1 antibody (Santa Cruz Biotechnology). Antibodies were detected by horse radish peroxidase-linked secondary antibody using ECL (enhanced chemiluminescence) system (Amersham). For the assay of tyrosine phosphorylation of Bcl-2, the cells were grown in serum-free medium for 12 h and stimulated with NGF (20 ng/ml), Ang II (10−7m), and NGF (20 ng/ml) plus Ang II (10−7m). The cell lysates were immunoprecipitated with Bcl-2 antibody (10 μg), resolved on 12% SDS-PAGE, electroblotted onto nitrocellulose membrane, and immunoblotted with anti-phosphotyrosine antibody (Upstate Biotechnology, Inc.). MAP kinase activity was assayed by its ability to phosphorylate myelin basic protein as described previously (13Tobe K. Kadowaki T. Tamemoto H. Ueki K. Hara K. Koshio O. Momomura K. Gotoh Y. Nishida E. Akanuma Y. Yazaki Y. Kasuga M. J. Biol. Chem. 1991; 266: 24793-24803Abstract Full Text PDF PubMed Google Scholar) with a slight modification (6Nakajima M. Hutchinson H. Fujinaga M. Hayashida W. Morishita R. Zhang L. Horiuchi M. Pratt R.E. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10663-10667Crossref PubMed Scopus (641) Google Scholar, 7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar, 8Hayashida W. Horiuchi M. Dzau V.J. J. Biol. Chem. 1996; 271: 21985-21992Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). PC12W cells were transfected with 300 nm anti-MKP-1 antisense oligonucleotide (phosphorothioate modified) in Lipofectin (Life Technologies) according to the approach of Duff et al. (14Duff J.L. Monia B.P. Berk B.C. J. Biol. Chem. 1995; 270: 7161-7166Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). After transfection, the cells were maintained in the presence of 10% horse serum and 5% fetal bovine serum for 1 day. Then the medium was changed to serum-free medium with or without Ang II. Two days later, cells were harvested and subjected to analysis of DNA fragmentation. Anti-MKP-1 antisense transfected PC12W cells were also used for Bcl-2 phosphorylation, and MAP kinase activity determinations as described above. Oligonucleotide sequences (20 base pairs) are as follows: MKP-1 antisense, 5′ GGAACTCAGTGGAACTCAGG 3′; MKP-1 sense, 5′ CCTGAGTTCCACTGAGTTCC 3′. DNA extraction, subsequent 3′ end labeling of DNA, gel electrophoresis, and quantitation of DNA fragmentation were performed as described previously (7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar, 15Tilly J.L. Hsueh A.J.W. J. Cell. Physiol. 1993; 154: 519-526Crossref PubMed Scopus (323) Google Scholar, 16Horiuchi M. Yamada T. Hayashida W. Dzau V.J. J. Biol. Chem. 1997; 272: 11952-11958Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). All values are expressed as mean ± S.D. Statistical significance was assessed by ANOVA followed by Scheffe's test. p < 0.05 was considered significant. We recently demonstrated (7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar) that AT2 receptor antagonizes the anti-apoptotic effect of NGF and induces apoptosis in PC12W cells, which express abundant AT2 receptor and very low levels of Ang II type 1 receptor (17Speth R.C,. Kim K.H. Biochem. Biophys. Res. Commun. 1990; 169: 997-1006Crossref PubMed Scopus (178) Google Scholar). In this study, we examined the possibility that the AT2 receptor regulates apoptosis via its influence on Bcl-2 (Fig. 1). We first stimulated these cells with NGF and then studied the effect of Ang II on Bcl-2 protein levels. We observed that the Bcl-2 level was not changed with Ang II (Fig.1 B). Since phosphorylation of Bcl-2 is essential for its physiological function (10May W.S. Tyler P.G. Ito T. Armstromg D.K. Qatsha K.A. Davidson N.E. J. Biol. Chem. 1994; 269: 26865-26870Abstract Full Text PDF PubMed Google Scholar, 11Halder S. Jena N. Groce C.M. Proc. Natl. Acad. Sci, U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (743) Google Scholar, 12Chen C.Y. Faller D.V. J. Biol. Chem. 1996; 271: 2376-2379Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 13Tobe K. Kadowaki T. Tamemoto H. Ueki K. Hara K. Koshio O. Momomura K. Gotoh Y. Nishida E. Akanuma Y. Yazaki Y. Kasuga M. J. Biol. Chem. 1991; 266: 24793-24803Abstract Full Text PDF PubMed Google Scholar), we then focused on the effect of AT2 receptor on the Bcl-2 phosphorylation. PC12W cells were equilibrated with 32Porthophosphoric acid in phosphate-free medium, and the radiolabeled cells were treated with NGF (20 ng/ml), Ang II (10−8 and 10−7m), and PD123319 (10−5m) at 37 °C for 30 min. Cell lysates were immunoprecipitated with Bcl-2 antibody, analyzed by SDS-PAGE, and autoradiographed. As shown in Fig.1, A and C, we observed that NGF stimulated the phophorylation of Bcl-2, whereas Ang II inhibited the NGF-induced Bcl-2 phosphorylation (Fig. 1 B). Inhibition of the NGF-mediated phosphorylation of Bcl-2 by Ang II was restored by PD123319, a specific AT2 receptor antagonist, suggesting that this Ang II effect is exerted specifically via the AT2 receptor. Since the signaling pathway through MAP kinases appears to play a critical role in the survival of PC12W cells (2Xia Z. Dickens M. Raingeard J. Davis R.J. Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5019) Google Scholar), we postulated that MAP kinase enhances Bcl-2 phosphorylation and that the AT2 receptor inhibits this. MAP kinase activity is regulated by a dual-specificity phosphatase known as MKP-1 (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar), leading us to hypothesize that the AT2 receptor activates MKP-1, inhibits NGF-mediated MAP kinase activation, and results in the inhibition of Bcl-2 phosphorylation. We applied antisense oligonucleotide to block basal MKP-1 expression in PC12W cells. Due to the short half-life of MKP-1 mRNA and protein, MKP-1 is an ideal target molecule for studies with antisense inhibition. PC12W cells were transfected with 300 nmanti-MKP-1 antisense or sense oligonucleotides. Indeed, we observed that MKP-1 antisense oligonucleotide treatment reduced the level of MKP-1 protein (Fig. 2 A). In MKP-1 sense oligonucleotide-pretreated PC12W cells, NGF increased MAP kinase activity and AT2 receptor stimulation inhibited the NGF-mediated MAP kinase activation as well as the basal level of MAP kinase activity (Fig. 2 B). We demonstrated that MKP-1 antisense pretreatment enhanced the effect of NGF on MAP kinase activation in PC12W cells (Fig. 2 B). Moreover, we observed that the MKP-1 antisense pretreatment attenuated the antagonistic effect of the AT2 receptor on NGF-mediated MAP kinase activation (Fig. 2 B). We next examined the effect of MKP-1 antisense oligonucleotide on Bcl-2 phosphorylation. As shown in Fig. 3, A–C, we observed that the NGF-mediated phosphorylation of Bcl-2 was enhanced by MKP-1 antisense oligonucleotide pretreatment, suggesting that MAP kinase activation is closely linked to phosphorylation of Bcl-2. Moreover, MKP-1 blockade attenuated the inhibitory effect of the AT2 receptor on Bcl-2 phosphorylation. Since MKP-1 possesses tyrosine phosphatase activity (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar), we also examined the possibility that MKP-1 directly dephosphorylates the tyrosine residue of Bcl-2. Our data showed that NGF and AT2 receptor does not influence tyrosine phosphorylation (Fig. 4).Figure 4Tyrosine phosphorylation of Bcl-2 by NGF and Ang II. The cells were grown in serum-free medium for 12 h and stimulated with NGF (20 ng/ml) (A), Ang II (10−7m) (B), and NGF (20 ng/ml) plus Ang II (10−7m) (C). Cell lysates were immunoprecipitated with Bcl-2 antibody, resolved on 12% SDS-PAGE, electroblotted onto nitrocellulose membrane, and immunoblotted with anti-phosphotyrosine antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next examined the effect of MKP-1 antisense oligonucleotide pretreatment on AT2 receptor-mediated DNA fragmentation (Fig.5 A and B). The most striking biochemical feature of apoptosis is the activation of endonuclease, which cleaves cellular DNA between regularly spaced nucleosomal units of 180 base pairs or multiples thereof that are readily detected as a DNA ladder by electrophoresis (16Horiuchi M. Yamada T. Hayashida W. Dzau V.J. J. Biol. Chem. 1997; 272: 11952-11958Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). In MKP-1 sense oligonucleotide-treated cells, we observed that NGF inhibited apoptotic changes in PC12W cells after serum depletion and AT2 receptor antagonized the effect of NGF and induced apoptosis. We observed that MKP-1 antisense oligonucleotide pretreatment blocked AT2 receptor-mediated apoptosis (Fig. 5, A and B). As shown in Fig. 5 C, serum deprivation alone induces DNA fragmentation in MKP-1 antisense oligonucleotide treated cells. The highly abundant expression of AT2 receptor during embryonic and neonatal growth, the rapid disappearance after birth M. J. 1991; PubMed Scopus Google Scholar, K. J. Physiol. 1991; Google Scholar, K. M. 1991; PubMed Scopus Google Scholar), and the of AT2 receptor in such as in Y. H. S. M. M. J. 1995; PubMed Google Scholar), J. H. J. Physiol. 1994; Scholar), and M. 1992; PubMed Scopus Google Scholar) suggest that this receptor is closely with growth, and/or Indeed, we have demonstrated that the AT2 receptor the regulated in rat DNA at and we have also using in of the AT2 receptor rat that of the AT2 receptor results in an of (6Nakajima M. Hutchinson H. Fujinaga M. Hayashida W. Morishita R. Zhang L. Horiuchi M. Pratt R.E. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10663-10667Crossref PubMed Scopus (641) Google Scholar). with this in vascular cells transfected with the AT2 receptor expression also of DNA al. M. M. M. S.P. R. T. J. 1995; PubMed Google Scholar) also an influence of the AT2 receptor on cells. Moreover, we have demonstrated that the AT2 receptor induces apoptosis in PC12W and in R3T3 cells (7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar, 16Horiuchi M. Yamada T. Hayashida W. Dzau V.J. J. Biol. Chem. 1997; 272: 11952-11958Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), abundant AT2 (17Speth R.C,. Kim K.H. Biochem. Biophys. Res. Commun. 1990; 169: 997-1006Crossref PubMed Scopus (178) Google Scholar, 1991; Google Scholar, 1993; PubMed Scopus Google Scholar). results support the that AT2 receptor plays an important role in fetal and in the of in which apoptosis is the molecular and cellular mechanism of AT2 receptor-mediated apoptosis has not been MAP kinase cellular In neuronal cells, MAP kinase activity the action of growth growth which stimulates cellular as well as NGF, which neuronal survival and Cell. 1992; Full Text PDF PubMed Scopus Google Scholar, E. J. Biol. Chem. 1993; 268: Full Text PDF PubMed Google Scholar, J. Cell. 1992; Full Text PDF PubMed Scopus Google Scholar). of the and p44 of MAP kinase phosphorylation on and J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). has been that the inactivation of MAP kinase is a critical that regulates the physiological for cell growth (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar). inactivation is by of and by a phosphatase known as MKP-1, which is by the (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar). Recently, an of MKP-1 was PC12W cells A. H. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). to various stimuli MAP kinase activity by the action of the MAP kinase activation C.H. H. Lau L.F. Tonks N.K. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar) and resulting in the cell and survival or cell death. MKP-1 antisense we demonstrated that MKP-1 is in the inactivation of MAP kinase by the AT2 receptor. MKP-1 was as an rapid and subsequent have been to a to growth factor signaling (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar, C.H. H. Lau L.F. Tonks N.K. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar). the mechanism of activation of this phosphatase is not We previously that the of MAP kinase was observed 5 min after AT2 receptor stimulation in PC12W cells and that this effect was blocked by sodium and (7Yamada T. Horiuchi M. Dzau V.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 156-160Crossref PubMed Scopus (663) Google Scholar). In Duff et al. J.L. Charles C.H. Lau L.F. Berk B.C. J. Biol. Chem. 1993; 268: Full Text PDF PubMed Google Scholar) that Ang II type 1 receptor stimulation induced MKP-1 mRNA min in rat vascular cells. we examined MKP-1 mRNA expression in PC12W cells after AT2 receptor stimulation and observed that AT2 receptor stimulation did not the MKP-1 mRNA in this cell line not Taken together, these results suggest that AT2 receptor stimulation activates MKP-1 phosphatase activity without the induction of MKP-1 Apoptosis is in by a of the Bcl-2 Bcl-2 can prevent or delay apoptosis induced by a wide variety of stimuli and (9Reed J.C. J. Cell Biol. 1994; 124: 1-6Crossref PubMed Scopus (2384) Google Scholar). has been that the Bcl-2 protein post-translational specifically phosphorylation, to T. S. Cell. 1993; Full Text PDF PubMed Scopus Google Scholar, C.M. Proc. Natl. Acad. Sci. U. S. A. 1992; PubMed Scopus Google Scholar). Recent data support the that phosphorylation of Bcl-2 is important for the regulation of Bcl-2 function and apoptosis (10May W.S. Tyler P.G. Ito T. Armstromg D.K. Qatsha K.A. Davidson N.E. J. Biol. Chem. 1994; 269: 26865-26870Abstract Full Text PDF PubMed Google Scholar, 11Halder S. Jena N. Groce C.M. Proc. Natl. Acad. Sci, U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (743) Google Scholar, 12Chen C.Y. Faller D.V. J. Biol. Chem. 1996; 271: 2376-2379Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). In this study, we demonstrated that NGF enhanced the phosphorylation of Bcl-2 and that the AT2 receptor inhibited the NGF-mediated Bcl-2 phosphorylation and induced apoptosis. Our results suggest that NGF-mediated MAP kinase activation is closely linked to in the phosphorylation of Bcl-2, resulting in the cell survival MAP kinase is a kinase, and the of of this kinase is the R.J. J. Biol. Chem. 1993; 268: Full Text PDF PubMed Google Scholar) and in and Bcl-2 at the and M. E. Y. C.M. Cell. Full Text PDF PubMed Scopus Google Scholar, S.D. J. Cell. 1992; Full Text PDF Scopus Google Scholar). Indeed, the phophorylation of the residue in Bcl-2 has been (10May W.S. Tyler P.G. Ito T. Armstromg D.K. Qatsha K.A. Davidson N.E. J. Biol. Chem. 1994; 269: 26865-26870Abstract Full Text PDF PubMed Google Scholar, 11Halder S. Jena N. Groce C.M. Proc. Natl. Acad. Sci, U. S. A. 1995; 92: 4507-4511Crossref PubMed Scopus (743) Google Scholar, 12Chen C.Y. Faller D.V. J. Biol. Chem. 1996; 271: 2376-2379Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). results suggest that MAP kinase the residue of Bcl-2. Moreover, we examined the possibility that MKP-1 directly the tyrosine residue of Bcl-2, MKP-1 exerts tyrosine phosphatase activity (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1020) Google Scholar). in PC12W cells, we did not effect of NGF and AT2 receptor on tyrosine phophorylation of Bcl-2. We also observed that inhibition of MKP-1 expression blocked the AT2 receptor-mediated DNA fragmentation. on these we that MAP kinase plays a critical role in apoptosis in PC12W cells by phosphorylating and Bcl-2. The AT2 receptor inhibits MAP kinase activation by MKP-1 and dephosphorylates Bcl-2, resulting in the of apoptosis.
Horiuchi et al. (Tue,) reported a other. Angiotensin II vs. Nerve growth factor (NGF) alone / Control was evaluated on Bcl-2 phosphorylation and apoptosis. Angiotensin II type 2 receptor activation induces apoptosis by activating MAP kinase phosphatase-1, which inhibits MAP kinase and dephosphorylates Bcl-2.